ID: 1061701461

View in Genome Browser
Species Human (GRCh38)
Location 9:132419395-132419417
Sequence GGGCTGCTTCTCTGACGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061701461_1061701472 22 Left 1061701461 9:132419395-132419417 CCGTGGCGTCAGAGAAGCAGCCC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1061701472 9:132419440-132419462 CACAGCCTCCCACAAAGATGGGG No data
1061701461_1061701469 20 Left 1061701461 9:132419395-132419417 CCGTGGCGTCAGAGAAGCAGCCC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1061701469 9:132419438-132419460 GCCACAGCCTCCCACAAAGATGG No data
1061701461_1061701464 -5 Left 1061701461 9:132419395-132419417 CCGTGGCGTCAGAGAAGCAGCCC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1061701464 9:132419413-132419435 AGCCCCAGGGAGCCAAAGCTCGG No data
1061701461_1061701471 21 Left 1061701461 9:132419395-132419417 CCGTGGCGTCAGAGAAGCAGCCC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1061701471 9:132419439-132419461 CCACAGCCTCCCACAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061701461 Original CRISPR GGGCTGCTTCTCTGACGCCA CGG (reversed) Intronic
900271977 1:1795282-1795304 GGGGTGCTTCCCTGAAGCAAGGG - Intronic
900577458 1:3390400-3390422 GGGCTGCTTCTCTCAATCCAGGG - Intronic
902143149 1:14373747-14373769 GTGTTCCTTCTCTGACCCCAAGG + Intergenic
902980500 1:20119357-20119379 GGGCTGCTGCTCTGATCCCCAGG - Intronic
903069178 1:20718072-20718094 GGGCCGCTCTTGTGACGCCACGG - Intergenic
903231932 1:21927364-21927386 CTGCTGTTTCTCTGAGGCCACGG + Intronic
903828100 1:26159476-26159498 GCACTGCTTGTCTGACCCCATGG - Intronic
904173580 1:28609510-28609532 GGGCTACTGCTCTGTCGCCCAGG + Intronic
906523165 1:46479077-46479099 GGGCTGCTTTTCTCAAGCCATGG + Intergenic
909555025 1:76944074-76944096 GTGTTGCTTCTCTTACCCCAAGG + Intronic
913477147 1:119249044-119249066 GGGCTGTAGCTATGACGCCATGG + Intergenic
915351206 1:155227516-155227538 GGGCTGCTTTTCTCGCGGCACGG - Intergenic
920068701 1:203287429-203287451 GGGCTGCCCCTCTGTCCCCAGGG + Intergenic
920173296 1:204084677-204084699 GGGCTGGCTCCCTGAGGCCAGGG - Intronic
920745209 1:208620381-208620403 GGGCATCTTCTCTGACCACATGG + Intergenic
921631901 1:217443988-217444010 GTGGTGCTTCTCTGAGGCCTGGG + Intronic
922549613 1:226484380-226484402 GGGCTGCCTCTCTGCTGCCCTGG - Intergenic
923597023 1:235368289-235368311 GGACTGCTTCTCTGAGGATAAGG - Intronic
1067033624 10:42897736-42897758 GGGCTGCTTCTCTGCCTGGAGGG - Intergenic
1067349524 10:45463317-45463339 GGGCTTCTGCTCTGACGAGATGG - Exonic
1067565428 10:47332592-47332614 GAGCTTCTGCTCTGACTCCAGGG + Intergenic
1069774432 10:70918555-70918577 CTGCTGCTTCTCTGTCGCCCGGG - Intergenic
1069943067 10:71968620-71968642 GGGCTGTTTCCCTGTTGCCATGG - Intronic
1070526768 10:77302249-77302271 GGGCTGCTTCTCTGAGCTCCAGG + Intronic
1070712265 10:78691401-78691423 GGGCTGTTTCCCTGGCACCAAGG + Intergenic
1071553368 10:86584399-86584421 GGGCTGCTCCTCTGCTCCCAGGG - Intergenic
1072533482 10:96341560-96341582 GGGCCTTTTCTCTGACACCATGG - Intergenic
1073578553 10:104643649-104643671 GGGTTGATTCTCTGACAGCAGGG + Intronic
1073952180 10:108822301-108822323 GGCATTCTTCTCTGACACCAGGG - Intergenic
1074097398 10:110326089-110326111 GGTCAGCTTCCCTGAAGCCACGG - Intergenic
1074146290 10:110720262-110720284 GGGCTGTTTCTTTGATGCCAAGG + Intronic
1074577997 10:114689104-114689126 AGGCTGCTTCTCTCACCTCATGG + Intergenic
1075351062 10:121725765-121725787 TGTCTGCTGCTCTGTCGCCAGGG - Intergenic
1076471813 10:130724279-130724301 GGGCAGCTTCTCTCCAGCCATGG - Intergenic
1076513738 10:131031454-131031476 GGCCTCCATCTCTGACGGCATGG + Intergenic
1076847704 10:133077506-133077528 GGGCAGTTTCTCACACGCCACGG - Intronic
1076847759 10:133077834-133077856 GGGCAGTTTCTCACACGCCAAGG - Intronic
1076847798 10:133078070-133078092 GGGCAGTTTCTCACACGCCAAGG - Intronic
1076847834 10:133078288-133078310 GGGCAGTTTCTCACACGCCAAGG - Intronic
1076848039 10:133079536-133079558 GGGCAGTTTCTCACACGCCAAGG - Intronic
1076848091 10:133079850-133079872 GGGCAGTTTCTCTCACGCCACGG - Intronic
1077251625 11:1563347-1563369 GGGCGGCTTCCCTGCCTCCAGGG + Intronic
1079318549 11:19430639-19430661 GGCCTGCTTCACTAACACCAGGG + Intronic
1080575584 11:33596373-33596395 TGGCTGCTCCTCTCACTCCAAGG - Intronic
1080575828 11:33598318-33598340 GGGCTGCTCTTCTCACTCCAAGG - Intronic
1081665724 11:44916050-44916072 GGGCTGCTTTGCTGAAGCAAGGG + Intronic
1082822370 11:57552725-57552747 GAGGAGCTTCTCTGAAGCCATGG - Intronic
1083733634 11:64667444-64667466 GGGCTGCTGCTCTTCAGCCAGGG - Exonic
1089056076 11:115586022-115586044 GGTTTGTTTCTCTGACCCCAAGG - Intergenic
1089619292 11:119713304-119713326 GGGCTTCTTTTCTGAGGCCTGGG + Intronic
1090343848 11:126051145-126051167 TGGCTGCTGCTCTGATTCCATGG + Intronic
1092099566 12:5872034-5872056 GGACTGCTTCTCTGACTCTGTGG - Intronic
1095721594 12:45407319-45407341 GACCTGCTTCTCTGAGGGCATGG + Intronic
1096461621 12:51824607-51824629 GGGCTGCATATCTGCCCCCAAGG - Intergenic
1096800344 12:54106542-54106564 GGCGTGCTTCTGTGACCCCACGG - Intergenic
1102915730 12:116750378-116750400 GGGCTCCTCCTCTGAAGCCCAGG + Intronic
1104461842 12:128962592-128962614 GGGCTGTATGTCTGACCCCAAGG - Intronic
1104775246 12:131387051-131387073 GGGCGGCTGCTCTGACCCCACGG - Intergenic
1107245107 13:38284638-38284660 GTGCTGCTTCTCTGTCCCCCAGG - Intergenic
1113748323 13:112761634-112761656 GGGGTGCTTCTAAGACCCCAGGG - Intronic
1114239057 14:20849203-20849225 GGTCTGCTTTTCTGAGGACAGGG - Intergenic
1114407314 14:22468825-22468847 ACTCTGCTTCTCTGAAGCCAGGG + Intergenic
1114794310 14:25695322-25695344 TGGCTTCTTATCTGACACCAAGG + Intergenic
1117868608 14:60174833-60174855 GGGCTCGTTGTCTCACGCCAAGG - Intergenic
1122274756 14:100585868-100585890 GGGCGGCTGCGCTGCCGCCAAGG - Intronic
1128537330 15:68500990-68501012 GGCCTGCTGCTGTGATGCCATGG + Intergenic
1131066899 15:89440457-89440479 GGGCTGCTTCTCTCACCAGAGGG + Intergenic
1131152107 15:90053750-90053772 GCCCTGCTTCTCTGAGGTCAGGG - Intronic
1132161422 15:99546742-99546764 GGCCTGCTTGCCTGAGGCCAGGG + Intergenic
1132847155 16:2005908-2005930 AGGCAGCCTCTCTGAGGCCAGGG + Intronic
1134012563 16:10866261-10866283 GGGCAGCTGCCCTGACTCCAAGG + Intergenic
1134364763 16:13567102-13567124 GAGCTGATTATCTGAAGCCAAGG - Intergenic
1135110386 16:19686498-19686520 AGGATGCTTCTGTGAAGCCAAGG + Intronic
1135171376 16:20186998-20187020 GGGCTGTTTCTCCCACCCCATGG + Intergenic
1135272907 16:21084530-21084552 GGGCTGGTTCTCAGACTCCTGGG + Intronic
1135990629 16:27216638-27216660 GGACTGCTTCTCTGTCTCGATGG + Intronic
1141194541 16:81850582-81850604 GTGCTGCTTCTCTTATGCCTGGG - Intronic
1141806547 16:86345621-86345643 GGGCGGCCTCTCTGACGAGAAGG - Intergenic
1141807547 16:86351890-86351912 GGGCGGCCTCTCTGACGAGAAGG + Intergenic
1142611645 17:1111757-1111779 GGGCTGCTTCTCTGGGGGAAGGG - Intronic
1142790765 17:2263755-2263777 GGGCTGTTTGTTTGACTCCAGGG - Intronic
1142851869 17:2708235-2708257 GGGCTGCTTCACAGCCCCCATGG + Intronic
1142868243 17:2804243-2804265 GGCCTGCAGCTCTGACGACAGGG + Intronic
1146936668 17:36816468-36816490 GGGCTGAATGTCTGTCGCCAAGG - Intergenic
1148324149 17:46773564-46773586 GTGCCTCTTCTCTGAAGCCAGGG - Intronic
1151696892 17:75722365-75722387 GGGCTTCTCCTCTGCCCCCATGG + Intronic
1152321288 17:79610008-79610030 AGGCTGCCTCTCTGAAGCCTCGG - Intergenic
1153302492 18:3603433-3603455 GGGCTGCTTTTCTCACTCCCTGG - Intronic
1154021591 18:10668289-10668311 GGGTTGTTTCCCTGACGTCAGGG - Intronic
1155437503 18:25828188-25828210 GGGCGGCTTCTCTGATGTCGGGG - Intergenic
1157464309 18:47930830-47930852 GAGCTGCTTCTCCGCCGCCGCGG + Intronic
1160697343 19:491566-491588 GGTCAGCTGCTCTGACGCCTTGG - Intronic
1161428281 19:4216441-4216463 GGGCTGGTTCCCTGAGGTCAGGG + Intronic
1162840047 19:13349614-13349636 GGGCTGCTTCTCTGAGCTCAAGG - Intronic
1165845869 19:38817251-38817273 GGGCTGCTGCTCCGATGCCGCGG - Intronic
1167238548 19:48329640-48329662 GGGCTACATCTCTGCCCCCAGGG + Intronic
925759128 2:7167373-7167395 GGGCTGCTTTTCTGAAGCAGGGG + Intergenic
929609682 2:43261484-43261506 GGACTGCTGCTCTGTCGCCCAGG + Intronic
931182246 2:59914742-59914764 GGTCTGCTTCCCTGACACCAGGG + Intergenic
932127531 2:69157390-69157412 GGGCTGGTCCTCTGGAGCCAAGG - Intronic
932244281 2:70183401-70183423 GGGGTCCTGCTCTGTCGCCAAGG - Intronic
936055289 2:109257878-109257900 ACACTGCTTCTCTGACACCAGGG + Intronic
941165510 2:162079026-162079048 GGCTTGCTTCTCTGAAGCAATGG + Intergenic
946121104 2:217515651-217515673 GGGAGGCTTCTCTGAGCCCAGGG - Intronic
946292403 2:218755122-218755144 GGGCTCCTTCACTGGGGCCATGG - Exonic
946481339 2:220059709-220059731 GGACTTCTTCTCTGTAGCCAAGG - Intergenic
947362351 2:229359328-229359350 GGACTGCCTCTCAGAAGCCAAGG + Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1170695932 20:18658873-18658895 GGGCTGCTTCTCTAAGTGCAAGG - Intronic
1171511072 20:25685490-25685512 AGGAGGCTTCTCTGAGGCCAGGG - Intronic
1173824676 20:46040619-46040641 GTGCTGCTGCTCTGAGCCCAAGG + Intronic
1174310906 20:49653541-49653563 TTGCTGATTCTCTGACTCCAGGG - Intronic
1179376553 21:40854386-40854408 GGGCAGCTTTTCAGACACCAGGG + Intergenic
1182423963 22:30262500-30262522 GGGCTGCTTCTGGGCCCCCATGG - Intergenic
1182555180 22:31125302-31125324 GGGCTGCTCCTCAGAAGCCAGGG - Exonic
1182740581 22:32564394-32564416 AGGCTGCTTCTCTGTAACCATGG + Intronic
1183979750 22:41532525-41532547 GGCAAGCTTCTCTGACACCACGG + Intronic
950124511 3:10503263-10503285 GGGCTGGTTTCCTGATGCCAGGG + Intronic
950157090 3:10729669-10729691 GGGCTGAGTCTCTGGAGCCAAGG + Intergenic
950333564 3:12176205-12176227 GGGCTGCTCCTCAGACTCCCAGG + Intronic
950497678 3:13343734-13343756 GGGGTGCTTCTCTAGCACCAGGG - Intronic
952284911 3:31958844-31958866 GGGCTGCTTTTATGCTGCCATGG + Intronic
952321053 3:32278019-32278041 GGGCAGCGTCTCTGACACCACGG - Intronic
953093494 3:39752624-39752646 GGACTTATTCTCTGACCCCATGG + Intergenic
953297097 3:41729740-41729762 GGGCTGCTTCCCTGAGGGCAGGG - Intronic
954081808 3:48216642-48216664 GAGCTGCTTCCCTGCAGCCATGG + Intergenic
954664672 3:52245622-52245644 CGGCTGGTTCGCTGACTCCAGGG - Intergenic
957107301 3:75906908-75906930 GGGCTGCTTCCCTGTCCCCCTGG + Exonic
960998990 3:123359672-123359694 GAGCTGGTTCTCTGCCCCCAGGG - Intronic
961402973 3:126660161-126660183 GGGGTGCTTCTCTACCGCCAGGG + Intergenic
961567351 3:127773209-127773231 GGGCTGCTGCTTAGAGGCCAGGG + Intronic
967388389 3:188931534-188931556 GGCCTGCCTCTCTGTCGCCAAGG - Intergenic
969155617 4:5207106-5207128 TGGCTGCTTCTATGCTGCCATGG + Intronic
969181916 4:5448816-5448838 TGGCTGCTTCTTTGACCCAAAGG + Intronic
970038615 4:11770425-11770447 GGCCTGCTCATCTGACTCCAAGG - Intergenic
972628778 4:40825552-40825574 GGCCTCCATCTCTGAGGCCAGGG - Intronic
978761250 4:112357903-112357925 AGGCAGCTTCTCTGAGACCATGG + Intronic
982436151 4:155384626-155384648 GGGCTCCTTTCCTGACCCCAAGG + Intergenic
985848342 5:2370796-2370818 TGCCGGCTTCTCTGATGCCAAGG - Intergenic
986338243 5:6770352-6770374 GTGCTGCTTCCCTGTCCCCAGGG + Intergenic
992559406 5:77935233-77935255 TGGCTGCTTCTCTGGATCCAAGG - Intergenic
992848972 5:80784718-80784740 GGGCTGCCTGTCTGATGCTAGGG + Intronic
1006813324 6:36834959-36834981 GGGCTGCCTCTCTGGCTCCAGGG + Intronic
1007959654 6:45947231-45947253 GGGCTGCTTCTCTAACTCAGGGG - Intronic
1010955724 6:82088796-82088818 GAGCTGCTTCTCTGACCCTCTGG - Intergenic
1013079795 6:106802123-106802145 TGGTTGCTTCTGTGAGGCCATGG - Intergenic
1015815155 6:137202249-137202271 GGGCTGCTGCTCAGGAGCCACGG + Intronic
1016745968 6:147580892-147580914 TGGCTGCTGCTATGACTCCAAGG - Intronic
1016834087 6:148459602-148459624 GGGCTGGTTCTCTGGCACCTCGG - Intronic
1017129276 6:151094089-151094111 GGGCTGCTTCTCCTACCCCAGGG + Intronic
1018421636 6:163645129-163645151 AGCCTGCTTCTCTGACTTCAAGG + Intergenic
1019060572 6:169254784-169254806 GGGCTGCTTCTCCCAGGTCAGGG + Intergenic
1021624079 7:22575723-22575745 GGGGTGCTTCTCTGTTCCCAGGG - Intronic
1029776610 7:102688084-102688106 GGCTTTCTTCTCTGACCCCAGGG + Intergenic
1032224124 7:130017087-130017109 GGACTCTTGCTCTGACGCCAAGG + Intergenic
1032850844 7:135793811-135793833 GGTCTGGGTCTCTGATGCCAGGG - Intergenic
1034931507 7:155167301-155167323 GGGCTGCTTCACCTGCGCCAGGG - Intergenic
1035376816 7:158411819-158411841 GGGCTGCTTCTCTGTGGCTCAGG + Intronic
1036133291 8:6136118-6136140 AGGCGCCTTCTCTGACTCCAGGG + Intergenic
1039465120 8:37779873-37779895 TGGCTGCGTCTGTGACCCCAGGG - Intergenic
1043566446 8:81553930-81553952 GTGCTGCATCTTTGACACCAAGG - Intergenic
1047812141 8:128422466-128422488 GTGCTCCTTCACTGATGCCAGGG - Intergenic
1047955769 8:129974079-129974101 GGGCAGCCTGTCTGAGGCCAAGG + Intronic
1049345911 8:142138534-142138556 GAGCTGCTTCTCTGGGCCCAGGG + Intergenic
1049656798 8:143802632-143802654 GGGGTTCTTCACTGGCGCCAGGG - Intronic
1052007855 9:23371931-23371953 GAGCTCCTTATCTGACCCCAGGG - Intergenic
1053162950 9:35826102-35826124 GGGGTGCTTCTCTGCATCCATGG + Exonic
1053310974 9:37019487-37019509 AGGCTGCTTGTTTGAGGCCAAGG - Intronic
1053503679 9:38621928-38621950 CTGCTGCTTCTCCGACGTCAGGG - Intergenic
1057152455 9:92807969-92807991 CTGCTGCTTCTCCGACGCCAGGG + Intergenic
1059468386 9:114484204-114484226 GGGCTGCCCCTCCGAGGCCACGG + Intronic
1060976942 9:127770503-127770525 AGGCTGCTCCCCTGACTCCAGGG + Intronic
1061090726 9:128424463-128424485 GGGCTGCTTCCGTGTCCCCATGG + Exonic
1061701461 9:132419395-132419417 GGGCTGCTTCTCTGACGCCACGG - Intronic
1062195223 9:135269264-135269286 GGGGTGGTTCTCTGATGCCCAGG + Intergenic
1062259735 9:135655592-135655614 GGACTGCTTCTCAGCAGCCATGG + Intergenic
1185763697 X:2707771-2707793 AGGCTCCTTCTCTGAGGGCATGG + Intronic
1187639667 X:21274245-21274267 GGGCTGCCCCTCTGAAGCCAGGG + Intergenic
1197120922 X:122891322-122891344 GGGCTGTGTCTCTCATGCCAAGG - Intergenic
1198050979 X:132953454-132953476 GGGATGCTTCTCTGCCTCCGCGG - Intronic
1200256346 X:154585099-154585121 GGGCTGCCCATCTCACGCCAGGG + Intergenic
1200261423 X:154619304-154619326 GGGCTGCCCATCTCACGCCAGGG - Intergenic
1200267406 X:154653601-154653623 GGGCTGCCCATCTCACGCCAGGG - Intergenic
1202056869 Y:20843481-20843503 GGGGAGCATCTCTGGCGCCATGG + Intergenic