ID: 1061702462

View in Genome Browser
Species Human (GRCh38)
Location 9:132426392-132426414
Sequence CTTGGGTTGCAGGTGGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061702462_1061702473 18 Left 1061702462 9:132426392-132426414 CCCGTTTCCACCTGCAACCCAAG 0: 1
1: 0
2: 3
3: 19
4: 211
Right 1061702473 9:132426433-132426455 CAACAGTAATGTCTTCAAACAGG No data
1061702462_1061702475 22 Left 1061702462 9:132426392-132426414 CCCGTTTCCACCTGCAACCCAAG 0: 1
1: 0
2: 3
3: 19
4: 211
Right 1061702475 9:132426437-132426459 AGTAATGTCTTCAAACAGGGAGG No data
1061702462_1061702474 19 Left 1061702462 9:132426392-132426414 CCCGTTTCCACCTGCAACCCAAG 0: 1
1: 0
2: 3
3: 19
4: 211
Right 1061702474 9:132426434-132426456 AACAGTAATGTCTTCAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061702462 Original CRISPR CTTGGGTTGCAGGTGGAAAC GGG (reversed) Intronic
901379469 1:8863333-8863355 CTTGGCTTCCAGGTGCAAGCTGG - Exonic
901562655 1:10085009-10085031 CTTGGATTCCAACTGGAAACTGG - Intronic
901656985 1:10775026-10775048 CTAGGGTTGGGGCTGGAAACCGG + Intronic
902972062 1:20061027-20061049 CTTTTGTTGCAGCAGGAAACTGG + Intronic
903484053 1:23676532-23676554 CTTGTGGGGCAGGTGGAAGCAGG + Intergenic
907588293 1:55641232-55641254 CTTGCTTTACAGGAGGAAACGGG + Intergenic
910290732 1:85597990-85598012 CTTTGGTTGAGGGTGGAGACAGG - Intergenic
910409543 1:86925689-86925711 CATGTGTTGCAGGAGGGAACTGG - Intronic
912450193 1:109763698-109763720 CCTGGGCTGCAGCTGGGAACAGG + Intronic
914914097 1:151807622-151807644 CTTGGGTGGCAGCTGGATATGGG + Exonic
916347870 1:163814604-163814626 ATTGGGGTGCAGGTGGTATCTGG + Intergenic
919185770 1:194146980-194147002 TTTTGGTTGCAGGTGGAGACTGG + Intergenic
919362365 1:196611144-196611166 CATGGGTTGCAGGAGGGACCCGG + Intergenic
920701369 1:208220071-208220093 CTTGGGTTCCAGGTGGAGAGTGG + Intronic
920839466 1:209542010-209542032 CTTGGGTGGCAAGTGGCATCAGG - Intergenic
920859782 1:209696184-209696206 CTGGGGCTGGGGGTGGAAACAGG + Intronic
922065111 1:222129743-222129765 CAGGGGTTGCAGGTGGAGACAGG + Intergenic
924396260 1:243624535-243624557 CTTGGTGTGGAGGTGGAAAATGG - Intronic
924629256 1:245721556-245721578 CATGGGCTGCCTGTGGAAACGGG + Intergenic
924813706 1:247424855-247424877 CTTTGGCTGCAGATGGAATCTGG + Exonic
1062794781 10:336352-336374 CTTGTGTTGGTGGTGGTAACTGG + Intronic
1064223329 10:13460311-13460333 CGTGGGGTGCAGGTGGAATTGGG - Intronic
1065126187 10:22576606-22576628 CTTGGTCTGCATTTGGAAACTGG + Intronic
1065999785 10:31093417-31093439 CTTGAGTTACAGGAGGAAACAGG - Intergenic
1069673670 10:70232490-70232512 CTAGGGCTGCACGGGGAAACCGG - Intronic
1070566550 10:77607655-77607677 CTGGGGATGCAGGTGGCTACTGG + Intronic
1071939437 10:90572984-90573006 CTTTGGCTGTAGGTGGACACAGG + Intergenic
1072417769 10:95263249-95263271 GTAGGGCTGCAGGTGGAAAGGGG - Intronic
1074388683 10:113038023-113038045 CCTGGGTTACAGATGGAGACTGG + Intronic
1076163377 10:128263149-128263171 CTGGGGTCGCAGGTGGGAGCTGG + Intergenic
1082679555 11:56151918-56151940 CTTGGGTTCAAGCTGGAGACTGG - Intergenic
1083860000 11:65415245-65415267 CTTGGGTTGCACGGGGCAGCAGG + Intergenic
1083887760 11:65581139-65581161 CTGGGGTTGGGGGTGGAGACTGG + Intronic
1083913867 11:65727401-65727423 CTTGGGCAGCAGCTGGACACTGG + Intergenic
1084578397 11:70006160-70006182 ATTGGCTTGCAGGTGGAGATGGG - Intergenic
1084869893 11:72091361-72091383 CTGGGGTTGCAGGAGGGTACTGG - Intronic
1085059096 11:73428123-73428145 GTTGAGTAGCAGGTGGAGACAGG - Intronic
1087218283 11:95518462-95518484 TTTGGGATGTAGGAGGAAACTGG + Intergenic
1089353017 11:117832041-117832063 GTTGGCTTGCAGCTGGAAAGGGG + Intronic
1089366061 11:117921752-117921774 CCTGGGAGGCAGGTGGAAAGTGG + Intronic
1090251160 11:125252795-125252817 TTTGGGTTGGAGGTGGCATCAGG + Intronic
1090335510 11:125960533-125960555 CTGGGTTTTCAGGTGGAAAATGG - Exonic
1094074560 12:26458478-26458500 CTTTGGGTGCAGGTGGTGACAGG - Intronic
1095309949 12:40687044-40687066 CTCGTGTTGGAGGTGGAGACTGG - Intergenic
1097748581 12:63327408-63327430 CTTGGGATCCAGGGGAAAACTGG + Intergenic
1099380736 12:81949233-81949255 CTAGGGTTGTGGGAGGAAACAGG + Intergenic
1102035760 12:109769641-109769663 GGTGGGGTGCAGGAGGAAACAGG + Exonic
1102469403 12:113151112-113151134 CTGGGGGTGCAGCTGTAAACAGG - Intronic
1102643124 12:114383834-114383856 CTTTGATTGCAGGTGGGAATGGG + Intronic
1105705147 13:22963708-22963730 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1105858060 13:24388724-24388746 CTGGAAATGCAGGTGGAAACAGG + Intergenic
1106460739 13:29965516-29965538 CTTGGGGTGGAAGTGGAGACAGG - Intergenic
1109690300 13:65879363-65879385 CTTGGGATGTAAGAGGAAACTGG + Intergenic
1113819499 13:113203168-113203190 TTTGGGTTGGAGGTGTAAGCAGG + Intronic
1118862475 14:69675239-69675261 CTTGGTGTGCAGGTGGAAGAGGG + Intronic
1119234364 14:73007054-73007076 CTTGGGTCGCAGGTTGATGCTGG - Intronic
1119771425 14:77222458-77222480 CTCTGGATGCAGGTGGAAAATGG - Intronic
1124869800 15:33529447-33529469 GTGTGGTTGCAGGTGGACACGGG + Intronic
1125970830 15:43910197-43910219 CTTGAGCTACAGGAGGAAACTGG - Intronic
1127900531 15:63337843-63337865 CTGGGATTGCAGGTGAGAACGGG + Intronic
1129076188 15:72998286-72998308 CTTGGGTGCCAGGCTGAAACAGG + Intergenic
1131184587 15:90263930-90263952 CTTGGGCTGCAGATGGTACCGGG - Exonic
1134004590 16:10809764-10809786 CTTGGGATGCAGGAGGAGCCTGG - Intronic
1135421094 16:22306064-22306086 CTGGGGTTGGAGGTGGGAATGGG - Intronic
1137067355 16:35862379-35862401 CATGGGTTGCATGTGCAAATTGG - Intergenic
1139200173 16:64967349-64967371 CTGGGGCTGCAGGTGCACACCGG + Intronic
1141107486 16:81245426-81245448 TTTGGTTTGCAGGTGGAAACGGG + Intronic
1141476777 16:84279367-84279389 CTAGGGCTGCAGGAGGAAGCTGG - Intergenic
1141916217 16:87098981-87099003 CCTGGGTTCTAGGTGGAGACAGG + Intronic
1141935146 16:87233595-87233617 CATGGGGTGCAGGGGGCAACAGG + Intronic
1143027826 17:3951468-3951490 CCTGGGATGGAGGTGGAAGCAGG + Intronic
1143374543 17:6459497-6459519 TCTGGGCTGCAGGTGGAGACTGG - Intronic
1143542919 17:7580263-7580285 CTGGGCTTGGAGGTGGACACAGG - Exonic
1145286835 17:21512252-21512274 CTTGTTTTGGAGGTGGAGACTGG + Intergenic
1147418180 17:40308649-40308671 CTTAGATGGCAGCTGGAAACAGG - Intergenic
1152503959 17:80734675-80734697 CTTGGGAGGCAGGAGGAAATGGG + Intronic
1152797690 17:82316159-82316181 TTTGGGGTGCAGGTGGCAGCTGG + Intronic
1152968553 18:139539-139561 CTGGGGTTGTAGTGGGAAACTGG + Intergenic
1153527316 18:6009400-6009422 CTTGAGTTCCTGGTGGAAACAGG - Intronic
1153676583 18:7461149-7461171 CATGGGTTTCAGTTGTAAACAGG + Intergenic
1156285868 18:35695348-35695370 GTAGGTTTGGAGGTGGAAACTGG + Intronic
1156396618 18:36705102-36705124 CCTGTGATGCAGGTGGAGACAGG + Intronic
1156789148 18:40950831-40950853 CTTGGGTTACAGGTGGAGGATGG - Intergenic
1157644054 18:49248964-49248986 ATTGGGAGGCAGGTGGAATCAGG + Intronic
1159475366 18:68914250-68914272 TTTGGGATGTAGGAGGAAACAGG - Intronic
1162345056 19:10114023-10114045 CTTGGGTCGCAGGTGGCTTCGGG - Exonic
1164599615 19:29552117-29552139 CCTGGGGAGCAGGTGGACACAGG + Intronic
1165222422 19:34327823-34327845 CTTTGGATTCAGGTGGAAGCCGG - Exonic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166122174 19:40692466-40692488 CTTGTGTTGATGGTGGAGACTGG - Intronic
1167959442 19:53094556-53094578 TTTTGTTTGCAGGTGGAGACAGG - Intronic
925207330 2:2018313-2018335 CTTGGGTTGCAGGTCGAGTTTGG + Intronic
927312551 2:21647632-21647654 CTTGAGTTGCATTTGGAAACTGG + Intergenic
927872051 2:26629928-26629950 CTTGGGTTGAGGATGGAAATTGG - Intronic
928896821 2:36275395-36275417 TTTGGGATGTAGGTGGCAACTGG - Intergenic
932276257 2:70454390-70454412 CTTATGTTACAGGTGAAAACCGG + Intronic
932430503 2:71671340-71671362 CTTGGCTTTCTGATGGAAACAGG - Intronic
934753109 2:96806944-96806966 GCTGGGTTGCAGGTGGAAGTGGG + Intronic
936008315 2:108909167-108909189 CTTGAGTTGCAGTTGAAGACAGG - Intronic
936114585 2:109691735-109691757 CTAAAGTTGGAGGTGGAAACAGG - Intergenic
937038819 2:118805216-118805238 CCTGGGTTTCAGTTGGAATCTGG + Intergenic
937080090 2:119134658-119134680 ATTGGGGTGCAGGTGGAGAGGGG - Intergenic
937987289 2:127643802-127643824 TTCGGGTGGCAGGTGGAGACGGG - Intronic
940036051 2:149313026-149313048 CTTGAGTTACAGGTGGACAGAGG - Intergenic
946112027 2:217428230-217428252 CTTGGGTTGGGGGTAGAACCTGG + Intronic
948172791 2:235918961-235918983 CTTGAGTTGGATGTGGTAACAGG + Intronic
948301333 2:236909466-236909488 CATGGGGTGCTGGTGGCAACTGG + Intergenic
1170012165 20:11736084-11736106 CTTGGGAAGCAGGTGGAAGAGGG - Intergenic
1173751774 20:45482072-45482094 CTGGGGTGGAAGGTGGAGACAGG - Intergenic
1174412404 20:50344492-50344514 CTTTGGCTGCAGGTGAAAAATGG + Intergenic
1174559875 20:51423323-51423345 CTTGGGTTGTGGCTGGAATCAGG + Intronic
1174839571 20:53888796-53888818 CTGGGGCTGCAGGTGAAACCTGG + Intergenic
1176423151 21:6532425-6532447 CTTGGGATGTGGGAGGAAACTGG + Intergenic
1177079752 21:16624012-16624034 CTTGGGTTGCAACAGGAAAATGG - Intergenic
1179698644 21:43140741-43140763 CTTGGGATGTGGGAGGAAACTGG + Intergenic
1181635565 22:24172850-24172872 CCTGGGTGGCAGGTGGAACCTGG - Intronic
1181655078 22:24290320-24290342 CTGGAGTTGGAGGTAGAAACAGG + Intronic
1182112411 22:27732885-27732907 CTTGGGGTGGGGGTGGGAACAGG + Intergenic
1184938423 22:47741732-47741754 CTTTTGTAGAAGGTGGAAACAGG + Intergenic
1185084601 22:48733324-48733346 CTTGGGTTTCAGATGGACGCTGG - Intronic
1185180953 22:49362846-49362868 CTAGGGTTGCAGGTGGAACTTGG - Intergenic
949456909 3:4248684-4248706 CTGGGATTCCAGGTGGAAGCAGG - Intronic
951830040 3:26916418-26916440 CTTTACTAGCAGGTGGAAACTGG + Intergenic
952748947 3:36808537-36808559 CTGTGGTTGAAGGTGGATACAGG + Intergenic
953799502 3:46011487-46011509 CTGGAGTTGCAGGAGGAAACTGG + Intergenic
953915800 3:46920523-46920545 CTGGGATTGCAGCTGGAAACAGG - Intergenic
954150107 3:48653057-48653079 CTGGAGTTGCAGGAGGAACCAGG - Exonic
954582716 3:51711774-51711796 CTTGTGTTGCAACTGGATACAGG - Intronic
955395247 3:58552598-58552620 CTTGGGATGCTGGTTGAAGCAGG + Intergenic
955839561 3:63097347-63097369 CTTAGGTGGCAGCTGGAGACTGG - Intergenic
956238937 3:67107368-67107390 CTTGGGATGTGGGAGGAAACCGG - Intergenic
957783069 3:84844798-84844820 CTTGGGCAGCAGATGGATACTGG + Intergenic
959025308 3:101234034-101234056 CTTTGGCTGCATGTGGTAACAGG + Intronic
961056976 3:123797599-123797621 CTTGGGATGAAGGTGGGGACAGG + Intronic
961819221 3:129566718-129566740 CTTGGGCTGCTGGGGGAAACTGG + Intronic
962722275 3:138187298-138187320 CCTGGGTTAGAGGTGGAAGCGGG - Exonic
962891033 3:139673234-139673256 CTTGGGTAGCAGCAGCAAACAGG - Intronic
966946603 3:184781222-184781244 CTGGGGCTGCAGTTGGAAATGGG + Intergenic
968384777 4:125932-125954 CCTGGGTTGGAGAAGGAAACGGG - Intronic
969928686 4:10609707-10609729 GATGGGTTGCAGGTGCAAAGTGG + Intronic
969973543 4:11073435-11073457 CTTGAGCCCCAGGTGGAAACAGG - Intergenic
973647749 4:52967269-52967291 CTGGGGTTCCATGTGGAAGCTGG - Intronic
979131784 4:117056297-117056319 TTTGGGCTGCAGTAGGAAACTGG - Intergenic
985563071 5:601755-601777 CTTGGGGTGCTGGGGGACACGGG + Intergenic
985776704 5:1848114-1848136 CTTTGGTGGCAGGAGGAGACTGG + Intergenic
986211562 5:5678310-5678332 CTTGGGTTCCAGGTGGGAGAGGG + Intergenic
988888721 5:35589980-35590002 TTTGGGATGTAGGGGGAAACTGG - Intergenic
993214920 5:85008145-85008167 ATGGGGTTACAGGTGGAATCTGG - Intergenic
995621343 5:114029521-114029543 CTTGGGTTGCTGCTGGACCCTGG + Intergenic
996488835 5:124068367-124068389 CTTGGGTTGCAGGGGCAAAGTGG - Intergenic
996950047 5:129115066-129115088 CTTAGGTTGCAGATGGAATAAGG - Intergenic
1000480365 5:161766383-161766405 CTTGGGTTGAAGTAGGAAAGTGG + Intergenic
1001078926 5:168652609-168652631 CCTGCTTTGCAGGTGGAACCTGG + Intergenic
1001815447 5:174665056-174665078 CTTGGATTGCCGGTCCAAACTGG + Intergenic
1002179536 5:177423787-177423809 CTTTGGCTGTAGGTGGAAAATGG + Intronic
1003259969 6:4508137-4508159 CTAGGTTTGGAGGTGGGAACTGG + Intergenic
1003652295 6:7972400-7972422 CTAGGGTTGCAGGTGGCTGCTGG - Intronic
1004239132 6:13902859-13902881 CTGGGGCTGGAGGAGGAAACCGG - Intergenic
1004697789 6:18050212-18050234 TTTGGGTTACAGGTGTAACCTGG - Intergenic
1005696927 6:28360024-28360046 CTGGGATTTCAGGAGGAAACAGG - Intronic
1006027553 6:31157267-31157289 CTTGGGTTCCATGAGGAACCAGG - Intronic
1007062675 6:38955998-38956020 CAAGGGTTGTAGGTGGAATCAGG + Intronic
1007280910 6:40711776-40711798 CATGGGTTGCAACTGTAAACAGG - Intergenic
1007281201 6:40713699-40713721 CATGGGTTGCAAATGTAAACAGG - Intergenic
1007753261 6:44082764-44082786 CTTGGGTTTCATGTGGAAACAGG + Intergenic
1008340787 6:50361595-50361617 CTGGGGCTGCAGATGGAAAGAGG + Intergenic
1010664328 6:78610028-78610050 GTTGGGTTGCAGGTTTAAAAAGG + Intergenic
1011767041 6:90633019-90633041 CTTGGGCTTTAGGTGGAACCTGG + Intergenic
1012743294 6:103048937-103048959 CTTGGGTTGTAGGAGGAAACTGG - Intergenic
1012932409 6:105330658-105330680 CTTGGGTTTCATGTGGAAGGGGG + Intronic
1014231297 6:118905211-118905233 CCTGGGTTGAAGAGGGAAACTGG + Intronic
1014550409 6:122783873-122783895 CTTGGTGTGGAGGTGGAAAATGG + Exonic
1015073290 6:129123724-129123746 TCTGGGTTGGAGGGGGAAACAGG + Intronic
1018613327 6:165662990-165663012 CTTGGGTTGCGGGAGGACCCGGG + Intronic
1019659271 7:2214887-2214909 TTTCGGTTGCAGCAGGAAACTGG - Intronic
1020511515 7:9062690-9062712 CGTGGGTTGAAGGTGGAGAGAGG - Intergenic
1021359516 7:19693260-19693282 CTTGGGGTGCAAATGGGAACTGG + Intergenic
1021779314 7:24086629-24086651 CTTGTGTTGCAGTTGGGAAATGG - Intergenic
1022871169 7:34481443-34481465 CTTGGGTGTCAGGAGGACACTGG + Intergenic
1023553979 7:41400582-41400604 ATTGAGTTGCAGATAGAAACAGG - Intergenic
1023705607 7:42938684-42938706 CTTGGGCTCAAGGTGGACACAGG - Intronic
1024479962 7:49852857-49852879 CTACAGTTGCAGATGGAAACTGG + Intronic
1027784388 7:82562160-82562182 GTGTGGTTGCAGGTGGAAATAGG + Intergenic
1030301210 7:107976595-107976617 GTTGTGTTGCAGGGGGAGACAGG - Intronic
1033276759 7:139977442-139977464 CTTGTGTTGTGGGAGGAAACTGG - Intronic
1033766030 7:144491530-144491552 GTTGGGATGCAGGTGGGCACAGG - Intronic
1036786451 8:11691182-11691204 CTTGGATTGCAGATGAAAACTGG - Intronic
1037458367 8:19084850-19084872 CTGGGGTTGCCGCTGGAGACGGG + Intergenic
1038642302 8:29338191-29338213 CCTGGGTTGAAGGTGGACATTGG - Intronic
1041010339 8:53536161-53536183 TTTGTGCTGCAGGTGGAAATTGG - Intergenic
1042478775 8:69280245-69280267 CCTGGGTTTCAGGTAGAAAATGG + Intergenic
1045188218 8:99858954-99858976 CTTGGGTTGCAGGTGTTTGCAGG - Intronic
1046998909 8:120554175-120554197 TTTGGGATGCAGGAGGAAACTGG - Intronic
1047357959 8:124141155-124141177 CTGGTGTTACAGGTGGAGACAGG - Intergenic
1047448884 8:124944632-124944654 CTTGGGAACCAGGTGGAAACAGG - Intergenic
1047691965 8:127365084-127365106 CTTGGGTGGCTGGTGGAAATGGG + Intergenic
1048564765 8:135584013-135584035 CTTTGGTAGCAGATGGAAAAGGG - Intronic
1050293903 9:4185105-4185127 CTAGGGTTGGAGATGGGAACAGG - Intronic
1050836557 9:10087667-10087689 CTTGCTTTGAAGGTGGAACCGGG + Intronic
1052990078 9:34513989-34514011 TCTGGGCTGCAGGTGGAACCAGG + Intronic
1055371448 9:75604158-75604180 CATGCTTTGCAGTTGGAAACGGG + Intergenic
1056185037 9:84126084-84126106 CTAATGTTGTAGGTGGAAACTGG - Intergenic
1057817067 9:98303676-98303698 GTTGGGATGCAGGTGGCATCAGG - Intronic
1057884869 9:98822531-98822553 CTTGGGGGGCAGGTGGCAGCGGG + Intronic
1058880029 9:109277896-109277918 CTTGGAGTGCAGGTGGTGACAGG + Intronic
1058884638 9:109314094-109314116 CACGGGCTACAGGTGGAAACTGG + Intronic
1059260494 9:112971495-112971517 CTTGGGATGCAGTTTGAAGCTGG + Intergenic
1060877174 9:127091785-127091807 CTCAGGTTCCAGGCGGAAACTGG + Exonic
1061250989 9:129426271-129426293 CTGAGGTTGGAGGTGGGAACAGG + Intergenic
1061702462 9:132426392-132426414 CTTGGGTTGCAGGTGGAAACGGG - Intronic
1061713992 9:132507321-132507343 CTCAGGTTGCACGTGGCAACTGG - Intronic
1186103310 X:6179695-6179717 ATTGGGCTGCAGGTGGCAAATGG - Intronic
1186363611 X:8868903-8868925 CAGGGGTTGGAGGTGGAAAATGG - Intergenic
1186386586 X:9116208-9116230 CTTGGGCAGCAGGTGGAGAAAGG - Intronic
1190867513 X:54397200-54397222 CTTGGGTTGCAGGCTGAAGGGGG + Intergenic
1193494734 X:82197224-82197246 GTTGGGTTGCTGGTGGACACAGG + Intergenic
1197149793 X:123207756-123207778 CTGGGTTTTCAGGTGGGAACTGG + Intronic
1197996586 X:132382750-132382772 CTAGATTTGCAGGTGCAAACAGG + Intronic
1199037090 X:143064109-143064131 CTTGGGTGTTAGGTGGATACTGG + Intergenic
1200067962 X:153514082-153514104 CCTGGGCTGCAAGTGGACACGGG + Intergenic
1200076529 X:153553987-153554009 CTGGGGGTGCAGGTGCAACCTGG + Intronic
1200713563 Y:6511745-6511767 CTTGGGTTTCAGGTGGGTCCAGG - Intergenic
1200785813 Y:7259453-7259475 CTTCTGTTTCAGGTGGAATCCGG + Intergenic
1200832688 Y:7702989-7703011 CTTGGGTTTCAGGTGGGTCCAGG + Intergenic
1200837905 Y:7750803-7750825 CCTGGGTTGCTGGTGGTTACTGG + Intergenic
1201020364 Y:9650296-9650318 CTTGGGTTTCAGGTGGGTCCAGG + Intergenic
1201862222 Y:18611437-18611459 ACTAGGTTTCAGGTGGAAACTGG - Intergenic
1201863111 Y:18621261-18621283 ATTAGGTTTCAGGTGGAAACTGG - Intergenic
1201870212 Y:18699117-18699139 ATTAGGTTTCAGGTGGAAACTGG + Intergenic
1201871101 Y:18708943-18708965 ACTAGGTTTCAGGTGGAAACTGG + Intergenic
1202164331 Y:21970289-21970311 ATTAGGTTTCAGGTGGATACTGG + Intergenic
1202227025 Y:22616083-22616105 ATTAGGTTTCAGGTGGATACTGG - Intergenic
1202316097 Y:23579571-23579593 ATTAGGTTTCAGGTGGATACTGG + Intergenic
1202554667 Y:26090495-26090517 ATTAGGTTTCAGGTGGATACTGG - Intergenic