ID: 1061708564

View in Genome Browser
Species Human (GRCh38)
Location 9:132471519-132471541
Sequence AAACGTGAAACTCTGAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061708564_1061708567 23 Left 1061708564 9:132471519-132471541 CCACTTCTCAGAGTTTCACGTTT 0: 1
1: 0
2: 1
3: 26
4: 263
Right 1061708567 9:132471565-132471587 GTTGTGCTATAAACATAATCAGG No data
1061708564_1061708568 27 Left 1061708564 9:132471519-132471541 CCACTTCTCAGAGTTTCACGTTT 0: 1
1: 0
2: 1
3: 26
4: 263
Right 1061708568 9:132471569-132471591 TGCTATAAACATAATCAGGTAGG No data
1061708564_1061708566 -10 Left 1061708564 9:132471519-132471541 CCACTTCTCAGAGTTTCACGTTT 0: 1
1: 0
2: 1
3: 26
4: 263
Right 1061708566 9:132471532-132471554 TTTCACGTTTCTTTCACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061708564 Original CRISPR AAACGTGAAACTCTGAGAAG TGG (reversed) Intronic
901292159 1:8132552-8132574 AAAAGTGAAACTCAAAGAAGTGG + Intergenic
902142878 1:14371143-14371165 GAACCTGGAACTCTGAGATGGGG - Intergenic
905418618 1:37822875-37822897 AAACGTGATACTTTGACCAGAGG - Intronic
905835987 1:41121669-41121691 GAACATGAAACCCTGAGCAGAGG - Intronic
907070433 1:51529869-51529891 AAGTATAAAACTCTGAGAAGAGG + Intergenic
907110988 1:51926102-51926124 AAAGGTCAAACCCTCAGAAGGGG + Intronic
907823850 1:57996643-57996665 AAAAGTGTAACTCTGAGAATAGG + Intronic
908051512 1:60237195-60237217 AAACATAAAACTTTTAGAAGTGG + Intergenic
913802261 1:122728697-122728719 AAAAGTTAAACTCTGAGAGTTGG - Intergenic
913826481 1:123162973-123162995 AAAAGTTAAACTCTGAGAGTTGG - Intergenic
913841085 1:123424307-123424329 AAAAGTTAAACTCTGAGAGTTGG - Intergenic
913880178 1:124125946-124125968 AAAAGTTAAACTCTGAGAGTTGG - Intergenic
913898659 1:124456981-124457003 AAAAGTTAAACTCTGAGAGTTGG - Intergenic
913914590 1:124742822-124742844 AAAAGTTAAACTCTGAGAGTTGG - Intergenic
914998203 1:152563247-152563269 AAAAGTGACCCTGTGAGAAGAGG + Intronic
915057798 1:153151530-153151552 AAATGTGAAGCTTTAAGAAGGGG - Intergenic
915837073 1:159185975-159185997 AAGTGTGTAACTCAGAGAAGTGG + Intronic
918277949 1:182972406-182972428 AAACATCAGACTCTGAGCAGTGG - Intergenic
918378477 1:183932501-183932523 AGACGTGAAACTCTTAGAGGTGG + Intronic
919687071 1:200493670-200493692 AACCGTCAGGCTCTGAGAAGTGG - Intergenic
920021854 1:202962429-202962451 AAACCTGAAACTCTGAGGAAAGG + Exonic
920258487 1:204672982-204673004 TTACGTGGATCTCTGAGAAGTGG - Intronic
920347124 1:205313647-205313669 AAACCCGAGGCTCTGAGAAGGGG - Intronic
920926570 1:210347191-210347213 AAAAGTCAAACTCACAGAAGTGG - Intronic
921727799 1:218543183-218543205 AAACGTGAAACTGAAAGAATAGG - Intergenic
923115221 1:230930326-230930348 AAAAGTGAAAATCAAAGAAGTGG - Intronic
923852919 1:237816798-237816820 AACAGTGAATCTGTGAGAAGGGG - Intronic
924465611 1:244296734-244296756 AAACAGGAAACTCTGAGGACTGG + Intergenic
924669590 1:246110096-246110118 AACTGTGAAACTCTCGGAAGTGG + Intronic
1063961651 10:11310918-11310940 AAAGAGGAAACTCAGAGAAGGGG + Intronic
1064136500 10:12755198-12755220 AAAACTTAATCTCTGAGAAGTGG + Intronic
1067674589 10:48361168-48361190 AAAAGTGGAACTCTAAAAAGTGG - Intronic
1070309041 10:75259917-75259939 AACTGTAAAACTCTTAGAAGAGG - Intergenic
1070391488 10:75974564-75974586 GAATGTGAAACTCTTAGAATAGG - Intronic
1072341253 10:94453284-94453306 GAAAGTGAAACTGTGATAAGGGG - Intronic
1073727612 10:106252618-106252640 AAATGTGAAAATGTGGGAAGTGG - Intergenic
1076205532 10:128597774-128597796 AAAACTGAAACTATGAAAAGTGG + Intergenic
1076237304 10:128874322-128874344 AAAAGTGAAAATCTAAGATGGGG + Intergenic
1076858962 10:133131080-133131102 TAACGTGCACCTCCGAGAAGAGG + Exonic
1077336737 11:2008627-2008649 AAAAGTGAGGCTCAGAGAAGTGG - Intergenic
1077662628 11:4083178-4083200 AAACTTGTTCCTCTGAGAAGAGG + Intronic
1078515580 11:12019245-12019267 AAAAATGAAACTCAGAGAAGTGG - Intergenic
1078652896 11:13212503-13212525 ACACCTGGAACTCAGAGAAGAGG + Intergenic
1079963269 11:26950172-26950194 AAAGGTGCAATTCTGAGATGAGG - Intergenic
1083545354 11:63545332-63545354 AAATGTGAAAGACTGTGAAGGGG - Intronic
1086996221 11:93359472-93359494 CAACATAAGACTCTGAGAAGTGG + Intronic
1089152390 11:116374096-116374118 AAACCTGAAGGTCTGAGAACTGG + Intergenic
1090035290 11:123244659-123244681 AAACGTGTAGCTCTTGGAAGAGG - Intergenic
1090165982 11:124547850-124547872 AAATGTGAAACACTGAAAATAGG + Intergenic
1090765924 11:129876347-129876369 AAAAGCATAACTCTGAGAAGGGG + Intronic
1202819721 11_KI270721v1_random:63809-63831 AAAAGTGAGGCTCAGAGAAGTGG - Intergenic
1092082034 12:5724251-5724273 CAACGAGAAACCCTAAGAAGAGG + Intronic
1093493837 12:19733758-19733780 AAACTGGAAACTCTGAAAAACGG - Intergenic
1094318870 12:29163105-29163127 AAACCTCAGACTTTGAGAAGGGG - Intronic
1094518343 12:31158265-31158287 AAATGTGAAATTCTGAGGATAGG - Intergenic
1094730830 12:33173159-33173181 AAAAGTGAAAGTCTTAGGAGGGG + Intergenic
1094753123 12:33437693-33437715 AAAGGTAACACTCAGAGAAGGGG - Intronic
1094873447 12:34613581-34613603 AAACTGGAAACTCTAAAAAGGGG - Intergenic
1095124140 12:38455660-38455682 AAATGAGAAACTTTGAGAAGAGG + Intergenic
1095168665 12:39006642-39006664 AAAGGTCAAACTCATAGAAGCGG + Intergenic
1095591391 12:43907411-43907433 AAACTGGAAACTCTAAAAAGCGG + Intronic
1096791503 12:54047822-54047844 AAACGGGAAAGTCGGAGAAGGGG - Intronic
1096917163 12:55045723-55045745 AAACTAGGAACACTGAGAAGGGG - Intergenic
1098102979 12:67038428-67038450 CATTGTGAAACTCTGAGGAGGGG - Intergenic
1098915378 12:76251715-76251737 AAAGGAGGAATTCTGAGAAGTGG + Intergenic
1100487918 12:95049078-95049100 ACATGTGAATCGCTGAGAAGTGG + Exonic
1103239997 12:119405059-119405081 AAACGTGAAAGCCTGAATAGAGG - Intronic
1104263207 12:127204352-127204374 AAACGTGGCATTCTGGGAAGCGG + Intergenic
1104346948 12:128008808-128008830 AAAAATGAAAATCTGAGATGTGG - Intergenic
1108026221 13:46180877-46180899 AAATGTGAAACTGAGATAAGAGG - Intronic
1108182555 13:47855303-47855325 AAACGTTAGACTCAGAAAAGTGG - Intergenic
1108286200 13:48910504-48910526 GAAAGTGAAAATCAGAGAAGGGG + Intergenic
1108743829 13:53368970-53368992 ATACGTGAAATTCTTAGAATAGG - Intergenic
1109393627 13:61725477-61725499 AATAGTGAAACTGTAAGAAGAGG - Intergenic
1111049872 13:82867789-82867811 AAACTTGAAACATTGGGAAGGGG + Intergenic
1111483823 13:88868786-88868808 AAATCTGAATCTCTGAGAAATGG + Intergenic
1112694688 13:101934918-101934940 ACACGTGAAAATCTGTTAAGAGG - Intronic
1114338935 14:21722960-21722982 AAAAATGAAACTCTGAGAAGGGG - Intergenic
1115923656 14:38407002-38407024 AAAAGTGAAACTCAGAAAAGTGG - Intergenic
1116340621 14:43718702-43718724 AAATGTTAAACTCATAGAAGCGG + Intergenic
1117617371 14:57547266-57547288 GATCTTAAAACTCTGAGAAGGGG - Intergenic
1117982400 14:61354849-61354871 AAACAGTAAACTCTGAGAACAGG + Intronic
1118270830 14:64340571-64340593 CAAAGTGAAACTCTTTGAAGAGG - Intergenic
1119559195 14:75577018-75577040 TAACTTGAAGCTCTGGGAAGTGG - Intergenic
1121681135 14:95793565-95793587 TACCGTGAAACTCCCAGAAGGGG + Intergenic
1122733277 14:103818612-103818634 AAATGTGAAGCCCAGAGAAGAGG - Intronic
1125133381 15:36311410-36311432 GAACGTGAAACTCTGAGTTTGGG - Intergenic
1125592392 15:40862982-40863004 AAACATGAAGCTCTGAGATGTGG + Intergenic
1126393472 15:48185361-48185383 ACAAGTGAAACTGTGAGAAAAGG + Intergenic
1127967716 15:63935907-63935929 AAATGTAAAACTCTGTGAATGGG - Intronic
1130323304 15:82857743-82857765 AAATGGGCAACTCTGAGGAGGGG + Intronic
1130601536 15:85278195-85278217 CAATGTGAAACCCTAAGAAGAGG + Intergenic
1132928959 16:2448836-2448858 AAACCTGCAACGCCGAGAAGGGG - Exonic
1134322585 16:13177099-13177121 CAAGGTGAAACTCTCAGAAGTGG + Intronic
1134661597 16:15988527-15988549 AAACATGAGAGTCTGATAAGAGG + Intronic
1138354790 16:56368426-56368448 AAACCTGAGACTCTTTGAAGAGG - Intronic
1139550697 16:67671363-67671385 AAACATGAGACTATGAGAGGGGG + Intergenic
1139584926 16:67896062-67896084 ACAAGGGAAACTCTGGGAAGAGG - Intronic
1139761060 16:69185246-69185268 AAAACAGAAAGTCTGAGAAGGGG - Intronic
1140311477 16:73852994-73853016 AAACATGAAAATCTGAGCAGAGG + Intergenic
1140694298 16:77517052-77517074 AGAAGTGGGACTCTGAGAAGAGG + Intergenic
1143589456 17:7873139-7873161 GAAACTGAAACTCTGAGAAGTGG + Intronic
1145418555 17:22745913-22745935 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145418727 17:22748292-22748314 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145419580 17:22760183-22760205 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145420076 17:22817138-22817160 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145421016 17:22830228-22830250 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145421361 17:22834986-22835008 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145424838 17:22882565-22882587 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145425865 17:22896837-22896859 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145426893 17:22911111-22911133 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145429303 17:22944423-22944445 CAACGTGAAACTCTGTGAGTTGG - Intergenic
1145429648 17:22949181-22949203 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145429820 17:22951559-22951581 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145434594 17:23016991-23017013 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145441883 17:23118119-23118141 CAACGTGAAACTCTGTGATTTGG - Intergenic
1145447324 17:23193081-23193103 CAACGTGAAACTCTGTGATTTGG - Intergenic
1146215241 17:30973763-30973785 AACCATAAAACTCTTAGAAGAGG - Intronic
1146749492 17:35365206-35365228 AAAAGTGAAGCTATCAGAAGGGG - Intronic
1148283364 17:46366594-46366616 AAAATTAAAACTCTGACAAGAGG + Intergenic
1148305582 17:46584515-46584537 AAAATTAAAACTCTGACAAGAGG + Intergenic
1148630649 17:49105733-49105755 AAGGGTGAGGCTCTGAGAAGGGG + Intergenic
1151704922 17:75762402-75762424 AAACGTGAAAATGTCAGCAGTGG + Intronic
1158218132 18:55121806-55121828 AAACTGGAAACTCTGAGATGGGG + Intergenic
1159127124 18:64236697-64236719 AATCCAGAAACTCTGATAAGTGG + Intergenic
1162283753 19:9721878-9721900 CAAAGTGAAACTCTTTGAAGAGG - Intergenic
1163079040 19:14923217-14923239 AAGAGTGAAACTCTGAGAAAAGG + Intergenic
1164617590 19:29676130-29676152 GCACGTGAACCTCTGAGAACTGG - Intergenic
1166885787 19:45960317-45960339 AAACGTGAGACTATGAGAGGTGG + Intronic
1167284210 19:48589658-48589680 AAACGTGAAAATCAGGCAAGGGG + Intronic
925598365 2:5582277-5582299 AAAAGTGAATTTCTCAGAAGAGG - Intergenic
928958409 2:36895977-36895999 ATATGTGGAACTCTGAGAATTGG - Intronic
929286954 2:40146320-40146342 ATAGCTGAAACTCTCAGAAGTGG - Intronic
929384898 2:41394847-41394869 AAAAGTGAAAATTTGAGGAGGGG + Intergenic
930478037 2:51910007-51910029 AAACATTAAACTAGGAGAAGGGG - Intergenic
931806205 2:65808557-65808579 AAAAGTCAAACTATTAGAAGAGG + Intergenic
933081718 2:77996910-77996932 AAAAGTAGAAATCTGAGAAGAGG + Intergenic
934232938 2:90202442-90202464 AAAAGAGAAAGTCTGAGAGGGGG + Intergenic
936909393 2:117574921-117574943 TCAAGTGGAACTCTGAGAAGAGG - Intergenic
938942206 2:136179147-136179169 AAGCCTGAAGCTCTGAGGAGAGG - Intergenic
939103935 2:137927616-137927638 ATATGTGAGACTCTCAGAAGAGG - Intergenic
939165525 2:138637501-138637523 AAAATGGAAACTCTGAAAAGAGG + Intergenic
939194907 2:138959649-138959671 AAATTTTAAACTCTCAGAAGAGG - Intergenic
939541011 2:143493539-143493561 AAAAATGAAACTCTGGGTAGGGG - Intronic
940394752 2:153175085-153175107 AAAAGTGAAAATATCAGAAGGGG - Intergenic
942403614 2:175629708-175629730 AAATCAGAAACTCTGAGCAGGGG + Intergenic
944159900 2:196647955-196647977 AAAAGTCAAACTCATAGAAGTGG - Intronic
946082714 2:217137841-217137863 AAACTGGAGACTATGAGAAGTGG - Intergenic
946367674 2:219259681-219259703 AAAGGTGAGACCCTGGGAAGGGG - Intronic
947183984 2:227438562-227438584 AGACATAAGACTCTGAGAAGTGG + Intergenic
949000842 2:241611907-241611929 AAAGGTGAAACTAAGAGAAAGGG + Intronic
1169402031 20:5290160-5290182 AAAGGTTAAACTCTTAGAAATGG + Intergenic
1171339656 20:24417508-24417530 AAGCGTGAAACTCTGATACGTGG + Intergenic
1174204099 20:48827159-48827181 AAACCTGAAGCTCAGAGGAGGGG - Intronic
1177254583 21:18644442-18644464 AGAAGTGAAACTCAAAGAAGTGG - Intergenic
1177362630 21:20093245-20093267 AAACCAGAAACTCTGGGAATGGG - Intergenic
1177947158 21:27484994-27485016 AAATGTCAAACTCATAGAAGTGG + Intergenic
1178376310 21:32070446-32070468 AAACCTGAAATTGTGGGAAGAGG - Intergenic
1179538421 21:42067701-42067723 ACACGAGAAACTCCCAGAAGAGG - Intronic
1179928997 21:44554863-44554885 AAACAAGAAAGACTGAGAAGCGG + Intronic
1180581240 22:16840453-16840475 ATATGTGGAACTCTGAGAATTGG - Intergenic
1181884216 22:26006914-26006936 AAATCTGAGACTCAGAGAAGGGG + Intronic
1183255598 22:36759678-36759700 AAAAGTGCAACCTTGAGAAGAGG + Intronic
1184287889 22:43482312-43482334 AGACATTAAACTTTGAGAAGTGG + Intronic
949497995 3:4651700-4651722 AAATGTGAAACTCAGAGCCGGGG - Intronic
951125316 3:18976990-18977012 AAGCTGGAAACTCTGAAAAGCGG + Intergenic
951422796 3:22507899-22507921 AAATGTGAAACTCAGAAAAGAGG + Intergenic
951699506 3:25480920-25480942 GAACCTGAAACTCTGGGAATAGG - Intronic
951754096 3:26070377-26070399 AAAAAGAAAACTCTGAGAAGTGG + Intergenic
952669416 3:35948177-35948199 GAATGAGAAACTCTGAGAATGGG + Intergenic
953056020 3:39387809-39387831 AAACCAGAAACTGTGAGGAGAGG + Intronic
953308474 3:41853168-41853190 AAATGAGAAACTCTGAGGAAGGG - Intronic
955358961 3:58256299-58256321 AAATGTGAAAATCTGAGTAAGGG - Intronic
956441381 3:69283803-69283825 AAACCTGAATCTCAGAAAAGAGG + Intronic
957252603 3:77793111-77793133 AACAGTGAAGCTTTGAGAAGTGG - Intergenic
958524480 3:95237736-95237758 AATAGTCAAACTCTTAGAAGAGG - Intergenic
959135104 3:102408769-102408791 AAACGTCAAACAGTGAAAAGGGG - Intronic
959906208 3:111713614-111713636 TAACATGTAATTCTGAGAAGGGG + Intronic
959985143 3:112563207-112563229 GAAAGTGAAAATCTGATAAGAGG - Intronic
960151468 3:114252931-114252953 GAATGTGAATCTCTGTGAAGAGG - Intergenic
961148733 3:124617812-124617834 AAAAGTGGAACTCAGAGAACAGG + Intronic
961295069 3:125877954-125877976 AAACTTGAGACTCGGAGAACGGG + Intergenic
962008513 3:131371345-131371367 AAAAGTGCAATGCTGAGAAGTGG - Intergenic
962010552 3:131386688-131386710 AAAAGTGCAATGCTGAGAAGTGG - Intronic
964444399 3:156743641-156743663 AAAAGTTAAACATTGAGAAGAGG - Intergenic
964529592 3:157652710-157652732 GAAAGTGGAACTCTGACAAGAGG + Intronic
964609695 3:158598782-158598804 AAATGGTAATCTCTGAGAAGGGG - Intronic
966023840 3:175250465-175250487 AAACCAGAATCTCTGAGAATTGG - Intronic
967962058 3:194933441-194933463 AAACTTCAACCTCTGAGGAGGGG + Intergenic
971540438 4:27809757-27809779 AAAAATGAAAATCAGAGAAGAGG + Intergenic
971735829 4:30450587-30450609 AAACTATAAACTATGAGAAGTGG - Intergenic
972002135 4:34050913-34050935 AAACGAGCATCTCTGAGAAGTGG + Intergenic
972011672 4:34190538-34190560 CAAAGTGAAGCTGTGAGAAGAGG + Intergenic
972075629 4:35082772-35082794 ACAGGTAAAATTCTGAGAAGGGG + Intergenic
972791887 4:42380492-42380514 GAACGTGAAACTCTCACAACAGG - Intergenic
974074377 4:57155395-57155417 AGAAGTGAAACTCAAAGAAGTGG + Intergenic
975260679 4:72294244-72294266 AAAAGTGGAACTCACAGAAGTGG + Intronic
978337574 4:107686158-107686180 ACAGTTGAAACTCTGGGAAGCGG + Intronic
979826218 4:125236167-125236189 ACACGTGACACTCAGAGAAGGGG - Intergenic
980051527 4:128044758-128044780 AAATCAGAACCTCTGAGAAGGGG + Intergenic
981436292 4:144726865-144726887 GGAAGTGAAACTCTGAAAAGTGG - Intronic
982938489 4:161517753-161517775 AAACCTGAAACTTTCAGAAAAGG - Intronic
983302227 4:165941276-165941298 AAAAGAGAGACTTTGAGAAGGGG + Intronic
983506801 4:168562048-168562070 GAACTTAAAACTCAGAGAAGTGG + Intronic
983513897 4:168637003-168637025 AAACTGGTAACTCTGTGAAGAGG + Intronic
984389515 4:179110859-179110881 CCATGTGAGACTCTGAGAAGAGG - Intergenic
985861314 5:2472875-2472897 CAGCGTGAAACTCTGGGCAGTGG - Intergenic
986610557 5:9562628-9562650 AAAACTGAAACGGTGAGAAGAGG - Intergenic
987524156 5:19026110-19026132 AAATGTGAATCTCAGATAAGTGG + Intergenic
987879140 5:23718832-23718854 AAAAGTGAAATTGTGAAAAGTGG - Intergenic
987989885 5:25197364-25197386 AAAAGTCAAACTCATAGAAGCGG - Intergenic
989005261 5:36803656-36803678 AAGCGTAAAACTCTGATCAGGGG + Intergenic
989635833 5:43531944-43531966 TAACTTGAAACTCTGAGAAAAGG + Intronic
990562988 5:57002373-57002395 AAATGTGAAAGAATGAGAAGAGG + Intergenic
991590176 5:68242897-68242919 AAATGTTAACCTCTGAGATGGGG - Intronic
991939062 5:71832457-71832479 AGAAGTGAAACTCAAAGAAGTGG - Intergenic
992491810 5:77251875-77251897 AAATTGGAAACTATGAGAAGAGG - Intronic
992809422 5:80371836-80371858 AAAAGTGAAATTCTCAAAAGGGG + Intergenic
995322494 5:110852290-110852312 AAACAGGAAACTCTGAAGAGGGG - Intergenic
995912523 5:117204603-117204625 AAACGTGAAACTTAGAGGAGTGG + Intergenic
1004095066 6:12545876-12545898 AAAACAGAAACTCAGAGAAGTGG + Intergenic
1005639227 6:27779067-27779089 AAAAGGTAAACTCAGAGAAGTGG - Intergenic
1005639595 6:27783373-27783395 AAAAGGTAAACTCAGAGAAGTGG - Intergenic
1007045179 6:38766321-38766343 AAAAGTCAAACTCTTAGAAGTGG + Intronic
1007080864 6:39102884-39102906 AAACCTGAAACACTTAGAATAGG + Intergenic
1007230165 6:40342703-40342725 AAGGGTGAAACTCTGAGCTGAGG + Intergenic
1008746772 6:54680597-54680619 AAAAGTTAAACTCAGAGAAGTGG + Intergenic
1008898756 6:56586976-56586998 AAACTGGAAACTCTAAAAAGTGG + Intronic
1009296037 6:61948902-61948924 ACACGTGGAAATCTGAAAAGTGG - Intronic
1015710541 6:136134449-136134471 ACATTTCAAACTCTGAGAAGCGG + Intronic
1016302771 6:142650544-142650566 AAACCAGAAACTCTAAGAAAAGG - Intergenic
1018382013 6:163266738-163266760 AAACTGGAAGCTCAGAGAAGTGG + Intronic
1018795347 6:167181012-167181034 AAAAATGAAACTCTGACTAGGGG - Intronic
1018820976 6:167374050-167374072 AAAAATGAAACTCTGACTAGGGG + Intronic
1020484352 7:8703191-8703213 GGACTTGAACCTCTGAGAAGAGG - Intronic
1021563700 7:21995051-21995073 AAAGGTGGAACTCATAGAAGTGG + Intergenic
1021955622 7:25821515-25821537 TAACTTGAAACACTGAGAATTGG + Intergenic
1024183388 7:46920936-46920958 AAACAAGAAATTTTGAGAAGTGG + Intergenic
1025184041 7:56843453-56843475 AAACTGGAAACTCTAAAAAGCGG - Intergenic
1025591537 7:62866003-62866025 AAACGTTTAACTCTGTGAGGTGG - Intergenic
1027399339 7:77791082-77791104 AGACTTGAAACTATGACAAGGGG - Intergenic
1029885382 7:103864490-103864512 AAATGTCAAACTCACAGAAGCGG - Intronic
1031129913 7:117820410-117820432 AAACATGAAACTTTAAAAAGTGG - Intronic
1032560813 7:132891568-132891590 GCTCTTGAAACTCTGAGAAGGGG - Intronic
1032957827 7:136992779-136992801 AATCATGAAACTATGAGAACTGG + Intronic
1034552025 7:151827163-151827185 AAATGAGAAACTCTGAGACCAGG - Intronic
1036703703 8:11030956-11030978 AAAACTGAGGCTCTGAGAAGTGG + Intronic
1037270198 8:17118607-17118629 AAAAGTCAAACTCATAGAAGTGG - Intronic
1038480045 8:27895603-27895625 AAAGCTGAGACTCAGAGAAGGGG + Intronic
1039448308 8:37649827-37649849 AAACCCTGAACTCTGAGAAGAGG + Intergenic
1039597928 8:38807720-38807742 AAACTTGAAAGTCTTAGAAGAGG - Intronic
1041849892 8:62378868-62378890 CATAGTGGAACTCTGAGAAGAGG + Intronic
1042984832 8:74571856-74571878 AAAGCAGAAACTCTGAGAAAGGG + Intergenic
1045264893 8:100610703-100610725 AGATGTGAAACCCTGAGAAGGGG - Intronic
1047959755 8:130002544-130002566 AAACGTGAAAATGAGAGAAAGGG + Intronic
1048217565 8:132510301-132510323 AAATGTGGATCTGTGAGAAGAGG - Intergenic
1048394428 8:134000554-134000576 AAATGTTAAACTCTTTGAAGAGG - Intergenic
1048418475 8:134252764-134252786 AAAAATGAAACTGAGAGAAGGGG + Intergenic
1052361985 9:27571957-27571979 AAACTTGGAACTGTGAGAAATGG - Intronic
1052632965 9:31064477-31064499 AAAAGTTAAACTCATAGAAGTGG + Intergenic
1053461982 9:38278304-38278326 AAAACTGAGACTCTGTGAAGAGG - Intergenic
1053573296 9:39331975-39331997 ACACGTGAAACACTGGGAATGGG - Intergenic
1053624653 9:39856207-39856229 ACACGTGAAACACTGGGAATGGG - Intergenic
1054094866 9:60890681-60890703 ACACGTGAAACACTGGGAATGGG - Intergenic
1054123848 9:61287036-61287058 ACACGTGAAACACTGGGAATGGG + Intergenic
1054219243 9:62394491-62394513 ACACGTGAAACACTGGGAATGGG + Intergenic
1054231471 9:62514682-62514704 ACACGTGAAACACTGGGAATGGG - Intergenic
1054591427 9:67015959-67015981 ACACGTGAAACACTGGGAATGGG + Intergenic
1055640594 9:78316132-78316154 AAATATGAAACACTGAGGAGCGG - Intronic
1057332265 9:94126863-94126885 AAAAGAGAAACTTTCAGAAGTGG + Intergenic
1059509316 9:114829267-114829289 AAATCTGAAGCTCTGAGAGGTGG + Intergenic
1059607237 9:115846982-115847004 AAACATCAGACACTGAGAAGGGG + Intergenic
1059737004 9:117110905-117110927 AAAGGAGAGACTCAGAGAAGGGG + Intronic
1059907224 9:119001133-119001155 AAAGGTGTAACTAGGAGAAGAGG + Intergenic
1059956088 9:119517344-119517366 AAATCAGAAACTCTGGGAAGAGG - Intronic
1060202188 9:121657722-121657744 AAACCTGAACCGCTGAGATGAGG - Intronic
1060518027 9:124277952-124277974 CAAAGTGAAGCTGTGAGAAGGGG + Intronic
1060578997 9:124726519-124726541 AAAAGTGAAAATCTGAAATGTGG - Intronic
1060970167 9:127733326-127733348 AGAGCTGAACCTCTGAGAAGTGG + Intronic
1061565570 9:131437199-131437221 TAATGTGACTCTCTGAGAAGAGG + Intronic
1061708564 9:132471519-132471541 AAACGTGAAACTCTGAGAAGTGG - Intronic
1185714393 X:2329637-2329659 AAAAGTGAACCTATGAAAAGAGG + Intronic
1187003242 X:15204171-15204193 AAACTTGAAATTCTGAGAACAGG - Intergenic
1188694770 X:33176967-33176989 AAAAGAGAAACTGTGTGAAGGGG + Intronic
1190500309 X:51069538-51069560 AAAAGTCAAACTCATAGAAGTGG + Intergenic
1191090905 X:56619804-56619826 AAACAGGAAACACTGAGATGGGG + Intergenic
1194178835 X:90688370-90688392 AATAGTGGAGCTCTGAGAAGAGG - Intergenic
1196820618 X:119697513-119697535 AAATCAGAAACTCTGTGAAGGGG + Intergenic
1197284029 X:124574278-124574300 AAAAGTAAATCTCAGAGAAGTGG - Intronic
1198601585 X:138289732-138289754 AAACATGAAACTGGAAGAAGAGG - Intergenic
1202099796 Y:21295228-21295250 CAAAGTGAAACTCTTTGAAGAGG - Intergenic