ID: 1061708568

View in Genome Browser
Species Human (GRCh38)
Location 9:132471569-132471591
Sequence TGCTATAAACATAATCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061708564_1061708568 27 Left 1061708564 9:132471519-132471541 CCACTTCTCAGAGTTTCACGTTT 0: 1
1: 0
2: 1
3: 26
4: 263
Right 1061708568 9:132471569-132471591 TGCTATAAACATAATCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061708568 Original CRISPR TGCTATAAACATAATCAGGT AGG Intronic
No off target data available for this crispr