ID: 1061709648

View in Genome Browser
Species Human (GRCh38)
Location 9:132478844-132478866
Sequence ATGAATGACAAGCTGCAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061709648_1061709650 16 Left 1061709648 9:132478844-132478866 CCGCTCTGCAGCTTGTCATTCAT 0: 1
1: 0
2: 8
3: 46
4: 412
Right 1061709650 9:132478883-132478905 TTTTCTATTTTGGTAATTATAGG No data
1061709648_1061709651 20 Left 1061709648 9:132478844-132478866 CCGCTCTGCAGCTTGTCATTCAT 0: 1
1: 0
2: 8
3: 46
4: 412
Right 1061709651 9:132478887-132478909 CTATTTTGGTAATTATAGGCTGG No data
1061709648_1061709649 6 Left 1061709648 9:132478844-132478866 CCGCTCTGCAGCTTGTCATTCAT 0: 1
1: 0
2: 8
3: 46
4: 412
Right 1061709649 9:132478873-132478895 ATGCTGTTCTTTTTCTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061709648 Original CRISPR ATGAATGACAAGCTGCAGAG CGG (reversed) Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
901121369 1:6896871-6896893 AAGAATGAAAAGTTGCACAGGGG - Intronic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
903337492 1:22634905-22634927 TTGGATGACCAGCTGCCGAGAGG - Intergenic
903499917 1:23795163-23795185 ATGACTGAGAAGCAGCTGAGTGG - Exonic
903959030 1:27044990-27045012 ATGAATGACAAGGGGAGGAGGGG - Intergenic
904365709 1:30009905-30009927 TGGGATGACCAGCTGCAGAGGGG - Intergenic
905001350 1:34672151-34672173 AAGGATGACCAGCTGCAGAGAGG + Intergenic
906132407 1:43468579-43468601 CCCAATGACCAGCTGCAGAGAGG - Intergenic
906391227 1:45418367-45418389 ATTGATGACAAGATGCAGAATGG - Intronic
906854795 1:49292552-49292574 GGGGATGACTAGCTGCAGAGAGG + Intronic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907614842 1:55913173-55913195 TGGAATGACAAGCTGCAGTCAGG + Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
908340694 1:63175588-63175610 ATGATTGATAGGCTGCAGAATGG + Intergenic
909815986 1:79994378-79994400 ATGGATGAGGAGCTGCAAAGGGG + Intergenic
910654915 1:89609776-89609798 TGGGATGACCAGCTGCAGAGAGG - Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911275582 1:95853909-95853931 TGGGATGACCAGCTGCAGAGAGG + Intergenic
911540054 1:99146864-99146886 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
912419725 1:109534931-109534953 ATTAATGACAAGCTGAAAAAAGG + Intergenic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
913696454 1:121330609-121330631 ATGAAAGACAAGACGCAGACTGG + Intronic
914141107 1:144949444-144949466 ATGAAAGACAAGACGCAGACTGG - Intronic
916203506 1:162294104-162294126 AGGACTGTCAGGCTGCAGAGAGG + Intronic
917371775 1:174301057-174301079 ATCCATGACAAACTGCAGACCGG - Intronic
918403980 1:184193285-184193307 AGGAATGCCAATCTGAAGAGAGG + Intergenic
918690387 1:187471959-187471981 ATGAATGAATAGTTGCATAGGGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
920317885 1:205092216-205092238 TTTATTGACCAGCTGCAGAGTGG - Intronic
920483780 1:206348975-206348997 ATGAAAGACAAGACGCAGACTGG + Intronic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
922201691 1:223408354-223408376 TAAAATGACAAGCTGCAGAGTGG + Intergenic
922861416 1:228819640-228819662 AAAAAAGACAAGCTACAGAGTGG - Intergenic
922916360 1:229260841-229260863 AAGAAAGACAGGCTGCTGAGAGG + Intergenic
923334742 1:232958412-232958434 CTGAATGTCAAGGAGCAGAGAGG - Intronic
924095296 1:240544841-240544863 AGGAATGAGAAGATCCAGAGAGG - Intronic
924721693 1:246628911-246628933 ATGAATTGCAAGATGCTGAGTGG - Intronic
1063271650 10:4515710-4515732 ATGTGGGACAAGCTGAAGAGAGG + Intergenic
1063805968 10:9641479-9641501 ATGAATGAAATGCTGGAGGGAGG - Intergenic
1065647747 10:27853948-27853970 ATGAAAGACTAGCTACAGACGGG + Intronic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1067755314 10:49000508-49000530 ATGAATGACAAACTGAAAGGAGG + Intergenic
1068060575 10:52063806-52063828 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068060585 10:52063874-52063896 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068083614 10:52347846-52347868 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1068846182 10:61677521-61677543 AGAAAAGACAAGCTGCAGACTGG - Intronic
1068878542 10:62023994-62024016 TTGAAAGTGAAGCTGCAGAGGGG - Intronic
1069384712 10:67873912-67873934 ATGAAAGATAAGCTGCAGTCTGG + Intergenic
1069496941 10:68913441-68913463 ATCAAAGACCATCTGCAGAGTGG + Exonic
1070706900 10:78646355-78646377 ATGAATGACCAACAGCAGTGTGG + Intergenic
1070941336 10:80350837-80350859 ATGGAGTACAAGCTGGAGAGAGG - Intronic
1072753363 10:97999965-97999987 TGGAATGACCAGCTGCAGAGAGG + Intronic
1074163339 10:110852625-110852647 ATGAAAAACAAGGTGGAGAGCGG + Intergenic
1074604932 10:114952662-114952684 ATAAATGAAAAGCTTCAGTGTGG + Intronic
1074895100 10:117770483-117770505 ATGAATGGCAAGTGGCAGGGAGG + Intergenic
1074940192 10:118228635-118228657 ATAAAAGACAAGCTACAGAGTGG + Intergenic
1075544647 10:123345897-123345919 ATGACCGGCAAGCTACAGAGAGG + Intergenic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1078315127 11:10288486-10288508 TGGGATGACCAGCTGCAGAGAGG - Intronic
1078836394 11:15034861-15034883 ACGAAGGACCAGCTGCAGAGAGG - Intronic
1079139581 11:17799136-17799158 ATGACTGAGAATCTGCTGAGGGG - Intronic
1079472288 11:20789956-20789978 CAGAAGGACCAGCTGCAGAGAGG - Intronic
1079487305 11:20948697-20948719 TTGGGTGAGAAGCTGCAGAGAGG - Intronic
1079710672 11:23679698-23679720 AGGGATGACCAGCTGCGGAGAGG - Intergenic
1079710700 11:23679859-23679881 TGGAACGACCAGCTGCAGAGAGG - Intergenic
1079843975 11:25440599-25440621 ATAAATGACAAACTAAAGAGAGG + Intergenic
1079882296 11:25943673-25943695 ATGGAAGACCAGCTGCAGAGAGG - Intergenic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1085835083 11:79946729-79946751 ATGAATGGCAAGCTACAAACAGG + Intergenic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1086545707 11:87965360-87965382 ATGAAAGGCAATCTCCAGAGTGG - Intergenic
1087148033 11:94831503-94831525 ATGAAGACAAAGCTGCAGAGGGG + Exonic
1088704254 11:112447754-112447776 CCTAATGACCAGCTGCAGAGAGG - Intergenic
1088810647 11:113389371-113389393 ATGAATGAATAGCTGGAAAGAGG - Intronic
1088881708 11:113977995-113978017 ATGCCTAACAAGCTGCATAGGGG - Intronic
1089394998 11:118130960-118130982 ATGCAGGAAAATCTGCAGAGGGG - Intergenic
1089647301 11:119888792-119888814 AAGAATGCCAAGGAGCAGAGAGG + Intergenic
1089727649 11:120496730-120496752 ATGCATGACAGGCTGGAGAGCGG - Intergenic
1090605491 11:128419344-128419366 GTCAATGAAATGCTGCAGAGTGG - Intergenic
1090926126 11:131251836-131251858 ATCAATCACAAGATGGAGAGTGG - Intergenic
1091955316 12:4636414-4636436 ATGAATGATAAGGTTCAGAGGGG + Intronic
1092283715 12:7116421-7116443 ATGAGTGACAAGCCGCAGGGAGG - Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1094454998 12:30622077-30622099 ATGAATGACTACATGGAGAGAGG + Intergenic
1095658395 12:44698473-44698495 ATGAATGTTAATCTGGAGAGTGG + Intronic
1096602157 12:52737021-52737043 AAGGAGGACCAGCTGCAGAGAGG - Intergenic
1096602901 12:52742712-52742734 AGGGAGGACCAGCTGCAGAGAGG + Intergenic
1097140660 12:56900172-56900194 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1097229525 12:57501337-57501359 GTGAATGACAAGCTGCTCTGTGG + Intronic
1097794750 12:63849546-63849568 TTGTATGTCAGGCTGCAGAGTGG - Intronic
1098143858 12:67478280-67478302 CTGAATAACCAGCTGAAGAGGGG - Intergenic
1099573302 12:84353048-84353070 ATGAATGAGAATCTTCAAAGTGG - Intergenic
1100019652 12:90053809-90053831 AGGAATGTCAAGCTGAAGAAAGG - Intergenic
1100095220 12:91025748-91025770 AAGAATGAAAAGATGCAGAATGG + Intergenic
1100299854 12:93296988-93297010 AAGAAAGAAATGCTGCAGAGAGG - Intergenic
1101974906 12:109348899-109348921 ATCAATGACAAGCTGTAGCTAGG - Intronic
1104534611 12:129607371-129607393 CTGCATGCCAAGCTCCAGAGGGG - Intronic
1104805573 12:131587177-131587199 AAGGACGACCAGCTGCAGAGAGG + Intergenic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106331270 13:28741735-28741757 ATGAATGACAGTGGGCAGAGGGG + Intergenic
1106564865 13:30875405-30875427 CTGAAGGACAATATGCAGAGGGG - Intergenic
1106771750 13:32968083-32968105 CTGAATAACAACCTGCAGATTGG - Intergenic
1106816456 13:33413537-33413559 AAGGATGAAAAGCTACAGAGAGG + Intergenic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1107663909 13:42669274-42669296 ATGAAAGACAAGCCACAGATGGG + Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109815565 13:67578393-67578415 TTGAACCACAGGCTGCAGAGTGG + Intergenic
1110093868 13:71490418-71490440 AGGAAAGAAAAGCTGGAGAGGGG + Intronic
1111337202 13:86839836-86839858 TGAAATGACCAGCTGCAGAGAGG - Intergenic
1111337213 13:86839946-86839968 TGAAATGACCAGCTGCAGAGAGG - Intergenic
1111523748 13:89439940-89439962 TGGAAAGACAAGCTACAGAGTGG + Intergenic
1113879166 13:113613374-113613396 AAGTATGAAAAGGTGCAGAGAGG + Intronic
1115108741 14:29794655-29794677 AAGAATGAGAAGGGGCAGAGGGG - Intronic
1115501386 14:34052990-34053012 ATGAAGGAACAGCTGAAGAGGGG - Intronic
1115601538 14:34960325-34960347 CTGAATAACAAGCTGCATACTGG - Intergenic
1115696755 14:35907655-35907677 ATGAAAGACAACCTACACAGTGG - Intronic
1116257247 14:42571514-42571536 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1116960011 14:50959542-50959564 GTGATGGAGAAGCTGCAGAGGGG + Intergenic
1116994786 14:51311650-51311672 ATGCAGGAGAAGCTGTAGAGTGG + Intergenic
1117207917 14:53463614-53463636 ATGAATGACAAAGTGCAGATAGG - Intergenic
1120405744 14:84091464-84091486 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1120879992 14:89408235-89408257 ATGAATCACAATCTCCAGAAAGG + Intronic
1121254410 14:92520590-92520612 CTGAAAGATAAGCTGGAGAGAGG + Intronic
1121625619 14:95383718-95383740 TTGGAGGACAAGCTGGAGAGGGG - Intergenic
1121974083 14:98386043-98386065 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1122710987 14:103658011-103658033 ATGGAAGCCAAGCTACAGAGGGG - Intronic
1123155464 14:106220588-106220610 ATGAATGTCAAGTTTCAGATGGG - Intergenic
1123402123 15:19997711-19997733 ATGAATGTCAAGTTTCAGATGGG - Intergenic
1123511465 15:21004373-21004395 ATGAATGTCAAGTTTCAGATGGG - Intergenic
1124431984 15:29615831-29615853 AAGAAAGACAATCTGCACAGTGG - Intergenic
1124691025 15:31823079-31823101 TTGAAACACAGGCTGCAGAGAGG - Intronic
1124820893 15:33044635-33044657 GAGGATGACCAGCTGCAGAGAGG + Intronic
1125240642 15:37570894-37570916 ATAAAAGACAAGCTACAGATTGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128790675 15:70431637-70431659 TGGAATGACCAGCTGCAGATAGG - Intergenic
1129154769 15:73710928-73710950 GAGAATGACAAGCCACAGAGTGG + Intronic
1130028966 15:80295012-80295034 TAGGATGACCAGCTGCAGAGAGG - Intergenic
1131756487 15:95568935-95568957 ATGATCCACAAGCTGCAGAATGG + Intergenic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1133227410 16:4348386-4348408 GTGAATGCCAAGCTGGGGAGTGG - Intronic
1133520836 16:6555022-6555044 AGGAATGAGAAGCTGGGGAGAGG + Intronic
1133816787 16:9203716-9203738 ATGAATGAGGAGCTGGAAAGGGG - Intergenic
1135523836 16:23198296-23198318 CTGAATGGCAAGATGAAGAGTGG + Intronic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1137238221 16:46633158-46633180 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1137316951 16:47335431-47335453 TAAAAAGACAAGCTGCAGAGTGG + Intronic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1137438331 16:48476929-48476951 AAGAATGACAAACAGCAGAAAGG - Intergenic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138033501 16:53579920-53579942 CAGAATGACCAGCTACAGAGAGG - Intergenic
1139944906 16:70633807-70633829 ATGATTGAGAAACTGCAGTGAGG - Intronic
1141024333 16:80530268-80530290 ATAACAGACAAGCTGCAGACTGG - Intergenic
1141474218 16:84261508-84261530 AAGGATGCCAAGCTGCAGAGAGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1142484269 17:236580-236602 AGGGCTGGCAAGCTGCAGAGCGG + Intronic
1142723456 17:1793659-1793681 AGCAATGTCAAGCTGCAAAGAGG + Intronic
1143533155 17:7517967-7517989 ATGAATGAAAAAATGGAGAGAGG - Intergenic
1144424094 17:15125194-15125216 ATGAAAGACAGGCTGCAATGTGG + Intergenic
1145061261 17:19735747-19735769 GTGAATGTCACCCTGCAGAGTGG - Intergenic
1145757168 17:27401159-27401181 ATGAAAGACTAGCAGCAAAGTGG - Intergenic
1145996789 17:29109583-29109605 ACAAATGACAAGGTGCAGGGTGG + Intronic
1146859148 17:36281574-36281596 ATTAATGACAAGCAATAGAGTGG - Intronic
1147089470 17:38085661-38085683 ATTAATGACAAGCAATAGAGTGG - Intergenic
1147107741 17:38234858-38234880 ATTAATGACAAGCAATAGAGTGG + Intergenic
1149085491 17:52710421-52710443 CTGGAGGACATGCTGCAGAGAGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1151395267 17:73819193-73819215 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1152340134 17:79719888-79719910 ATGAATGACCACATGCTGAGTGG - Intergenic
1152899131 17:82929945-82929967 ACGAGTGACAAGATGCAGAGAGG - Intronic
1153091249 18:1346460-1346482 GTGAATGACAAAGTGCAGAATGG + Intergenic
1153134107 18:1893983-1894005 ATGAATGAAAAGAAGCAGGGCGG - Intergenic
1153522897 18:5968803-5968825 TTGTATGAGAAGCTGCACAGAGG - Intronic
1155830866 18:30513721-30513743 ATGGATAACCAGCTGCAGAGAGG - Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1163347368 19:16752013-16752035 AAAAATAACAAGCAGCAGAGAGG + Intronic
1164296809 19:23917949-23917971 AAGAAGGACAAGCTGCTTAGAGG - Intronic
1164554300 19:29239007-29239029 CTTACTGAAAAGCTGCAGAGAGG - Intergenic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
926203475 2:10818026-10818048 ATGAATGAGAAAGTCCAGAGAGG - Intronic
926268687 2:11348132-11348154 CTGAATGACAAGCAACAGACTGG - Intronic
926353536 2:12019431-12019453 ATGAATGGAAATCTGCAAAGAGG - Intergenic
926738430 2:16091581-16091603 ATTAATGACAAGGAGAAGAGAGG - Intergenic
927034267 2:19156995-19157017 TTAAATGATAAGCTGCAGACTGG - Intergenic
927226228 2:20767956-20767978 TGGGATGACCAGCTGCAGAGAGG + Intronic
927315399 2:21675583-21675605 ATGAATGCCAAGCTAAAAAGTGG - Intergenic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927832907 2:26369607-26369629 ATGAATGACAGGCTGGAGAGAGG - Intronic
927876985 2:26664199-26664221 ATGAAAGACAAGCCACAGAGTGG - Intergenic
928145724 2:28773369-28773391 AGGAGTGAGAAGCAGCAGAGAGG - Intronic
928312218 2:30220495-30220517 GTGCATGGCAAGCTGAAGAGAGG + Intergenic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
929639188 2:43559117-43559139 ATGAATGATAAGGTGAGGAGTGG + Intronic
930255908 2:49091050-49091072 ATGAAGGACAAACTACAGATAGG - Intronic
930739138 2:54811394-54811416 ATGAAAGACAAGGTGCAAAGGGG - Intronic
930800595 2:55438725-55438747 TGGAATGACCAGCTACAGAGAGG + Intergenic
932619993 2:73259598-73259620 ATGAATGGCAAGGAACAGAGTGG + Intronic
932761116 2:74439904-74439926 AGGAAAGGCCAGCTGCAGAGGGG + Intronic
933093325 2:78146924-78146946 TGGGATGACTAGCTGCAGAGAGG + Intergenic
933219248 2:79669730-79669752 ATCCTTGACCAGCTGCAGAGAGG - Intronic
933937588 2:87218978-87219000 ATGAATGGGCAGCTGGAGAGGGG + Intergenic
934535800 2:95132184-95132206 TTAAATGACAAGCTACAGACTGG + Intronic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
934712549 2:96525505-96525527 AGGAAGGACAAGAAGCAGAGTGG - Intergenic
935308503 2:101759914-101759936 AGGAGTCACAAGCTGCAGTGAGG - Intronic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
937767807 2:125681485-125681507 TTGATTGACAAGCTACAGATTGG - Intergenic
938178621 2:129160023-129160045 TGAAATGACAAGCTGCAGACTGG + Intergenic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
943922841 2:193731516-193731538 ATGAAGGACAATCTACAGAATGG + Intergenic
943961236 2:194265342-194265364 TGGGATGACAAGCTGCAGAGAGG + Intergenic
944586696 2:201179105-201179127 TGGGATGACCAGCTGCAGAGAGG + Intergenic
945330092 2:208529633-208529655 TGGAATGACCAGCTACAGAGAGG - Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946232696 2:218302405-218302427 ATGAAAGAGTAGCTACAGAGGGG + Intronic
946280860 2:218664542-218664564 ATAAGTGACAAGATGCAGTGAGG + Intronic
946457959 2:219844292-219844314 ATGCTTGAAAAGCTGGAGAGGGG + Intergenic
946805319 2:223465400-223465422 ATCAATGGCAAGCTGGAGAAAGG + Intergenic
946836325 2:223776311-223776333 ACAATTGACAAGCTGGAGAGGGG - Intronic
947459928 2:230295156-230295178 ATGAATGAGAACCTGAGGAGGGG + Intronic
947475249 2:230441026-230441048 ATGAAAGAGAAGCTACAGACTGG + Intronic
948575368 2:238946522-238946544 ATGGATGACTAGCTGCAAAGAGG - Intergenic
948587892 2:239031393-239031415 ATGAAAGACAAGCTTCAGACAGG - Intergenic
948678568 2:239614091-239614113 GTGAAAGGCAAGCTGCAGTGTGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
1168841443 20:912487-912509 ATGGATGAGAAGCTGCAGGCAGG - Intronic
1170915200 20:20616552-20616574 ATGAGTGAGAAACTGTAGAGGGG + Intronic
1172063572 20:32203905-32203927 ATGAATCACATGCTGGGGAGGGG + Intronic
1173068358 20:39736796-39736818 ATGAATGGAAAGCTACAGACAGG - Intergenic
1173086960 20:39930797-39930819 ATAAATGACAAGCCACAGACTGG + Intergenic
1173307755 20:41866451-41866473 TAGAAAGACAAGCTTCAGAGTGG - Intergenic
1173524435 20:43721289-43721311 AGGGATGACCAGCTGCAGAGAGG - Intergenic
1173872033 20:46348270-46348292 AGTAATTACAAGGTGCAGAGCGG - Intronic
1173979712 20:47214342-47214364 GTGAGTGAGAAGCTGCAGGGAGG - Intronic
1175064395 20:56272742-56272764 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175065136 20:56277706-56277728 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1175352737 20:58336917-58336939 ATGAATGTCAAGCAGCAGCCTGG - Intronic
1177280414 21:18974954-18974976 GTGAATGACATCCTGCAGAGTGG + Intergenic
1178367020 21:31996720-31996742 ATGAAAGACCAGGTTCAGAGAGG + Intronic
1178809652 21:35869805-35869827 AAGAATGCCAGGATGCAGAGAGG + Intronic
1178919755 21:36730991-36731013 ATGAAAGGCAGTCTGCAGAGTGG + Intronic
1179058076 21:37954340-37954362 AGGAAAGAGAAGATGCAGAGAGG - Intronic
1181846184 22:25710942-25710964 TTGAATGACATGCTGCGCAGTGG + Intronic
1182589095 22:31365115-31365137 ATGAATGAAAGGCTTCAGAGAGG - Intergenic
1183943431 22:41309730-41309752 ATGGATGACAAGCTGCACCAGGG + Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184869404 22:47225805-47225827 ATGGATGACCAGTTGCAGAGAGG - Intergenic
1184925763 22:47636076-47636098 GTGAAGAACAAGATGCAGAGAGG - Intergenic
949273383 3:2247981-2248003 AGGAATGAGAGACTGCAGAGAGG - Intronic
950050888 3:9988354-9988376 AGGAATTACAAGTAGCAGAGAGG - Intronic
951136193 3:19107114-19107136 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951479910 3:23149092-23149114 AGGAAAAAGAAGCTGCAGAGAGG - Intergenic
951562431 3:23982063-23982085 AGGGATGACCAGCTGCAGAGAGG - Intergenic
951718440 3:25673727-25673749 TGGGATGACCAGCTGCAGAGAGG - Intergenic
952797351 3:37252904-37252926 ATGAATGGCAAGCCACTGAGTGG - Intronic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954748502 3:52800546-52800568 ATCAATGACGGGCTGCTGAGGGG + Exonic
955241490 3:57182578-57182600 AGGAATGACCAGCTGCAGAGAGG - Intergenic
957679550 3:83415816-83415838 ATGATTGGCAAGCTGCCGATGGG + Intergenic
958597967 3:96255157-96255179 AAGACTGACAAGCTGGAGAATGG + Intergenic
958812580 3:98878775-98878797 GTGAATGGAAAGCTGCAGAAAGG - Intronic
959519448 3:107308673-107308695 AAGAAAAACAAGCTCCAGAGCGG - Intergenic
960305359 3:116053718-116053740 ATGAATGTCAGGCTGAAGTGTGG + Intronic
960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG + Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
960710564 3:120523531-120523553 ATGAATGAAAAGCTACACATTGG + Intergenic
962539822 3:136369216-136369238 ATTAATGACAGGTGGCAGAGAGG - Exonic
962653768 3:137521680-137521702 ATGAACCAGAAGCTGCAGACTGG + Intergenic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963047899 3:141116629-141116651 ATGAATGGCCAGCTACAGACTGG - Intronic
963106390 3:141651010-141651032 ATAGATGAGAAGCTGCAAAGAGG - Intergenic
963454229 3:145522950-145522972 CAGAATGACCAGTTGCAGAGAGG - Intergenic
963454232 3:145523006-145523028 TGTGATGACAAGCTGCAGAGAGG - Intergenic
964523599 3:157593543-157593565 TTGGATGAAACGCTGCAGAGTGG + Intronic
964709362 3:159655535-159655557 ATGAATCAGAAGCTGGAGATAGG + Intronic
964942797 3:162181180-162181202 ATAAAGGACAAGCTACAGACAGG + Intergenic
965284171 3:166795837-166795859 AAGAAGGACAACCTGCAGAATGG + Intergenic
965309863 3:167115424-167115446 GGGGAGGACAAGCTGCAGAGAGG - Intergenic
965603398 3:170476443-170476465 AAGAATGCCACCCTGCAGAGTGG - Intronic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966840179 3:184081713-184081735 CAGAATGACCGGCTGCAGAGAGG + Intergenic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
967818950 3:193823409-193823431 ATGAGTGAAATGATGCAGAGAGG - Intergenic
968189035 3:196654090-196654112 ATGAATGAACAACTGGAGAGTGG - Intronic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
971342357 4:25782201-25782223 GTGACTGACTAGTTGCAGAGTGG + Intronic
971938779 4:33188547-33188569 TGGGATGACTAGCTGCAGAGAGG - Intergenic
972432560 4:38997271-38997293 GTCAATGACAAGGGGCAGAGGGG + Intronic
975321365 4:73012334-73012356 AGGGATGACCAACTGCAGAGAGG + Intergenic
975876376 4:78842405-78842427 ATGAATAAGAAGCTACAGACGGG + Exonic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976775997 4:88706794-88706816 CTGGATGACAATCTGCAGACTGG - Exonic
977276483 4:94983529-94983551 ATGAATGTCAACAGGCAGAGAGG + Intronic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
977499070 4:97815795-97815817 ATGAATGCCAAGCTGACAAGAGG + Intronic
977931208 4:102751175-102751197 ATGAGTGATAACCTGCAGATTGG + Intronic
978219705 4:106256030-106256052 ATGGATGGCCAGCTGTAGAGAGG - Intronic
978249293 4:106610743-106610765 TGGGATGACCAGCTGCAGAGAGG + Intergenic
979448179 4:120839492-120839514 TGGAATGACCAGCTGCAGAGAGG - Intronic
979495956 4:121382330-121382352 ATAAATAACAAGCTACAGACTGG - Intergenic
980909080 4:138977723-138977745 ATAAATGACAAACTGAGGAGGGG - Intergenic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
982619026 4:157679514-157679536 ATGAATGACAGTAGGCAGAGAGG + Intergenic
984557696 4:181234934-181234956 AAGGATTGCAAGCTGCAGAGAGG - Intergenic
984591062 4:181618308-181618330 CTGAATGAAGTGCTGCAGAGCGG - Intergenic
985757680 5:1728931-1728953 ATCAATGACAAGCAGGAGAATGG - Intergenic
985979804 5:3452896-3452918 ATGAATGACAAGCGCCACAGAGG + Intergenic
986245769 5:6005523-6005545 ATGAATGACAAGCAGAAGTATGG + Intergenic
986927570 5:12775932-12775954 ATAAAAGACAAGCTGCAGGCTGG + Intergenic
987323164 5:16788717-16788739 ATGACTGAGAAGCTGAGGAGTGG + Intronic
988025098 5:25675541-25675563 TTGAATGATATGCTGCAGGGAGG + Intergenic
989187912 5:38642793-38642815 AGGAAGGACAAGGTGGAGAGAGG + Intergenic
989279136 5:39621603-39621625 AGGGATGACCAGCTGCAGAGAGG - Intergenic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991107599 5:62861943-62861965 AGGGATGACCAGCTGCAGAGAGG - Intergenic
993118363 5:83744603-83744625 ATGAATGCCAAGCTGCATCGTGG - Intergenic
994063510 5:95508403-95508425 TGGAATGACCAGCTGGAGAGTGG - Intronic
994162713 5:96574473-96574495 ATGAAAGACAAGCTACACAATGG - Intronic
994641037 5:102410295-102410317 AAGGATGACCAGCTACAGAGAGG - Intronic
994790791 5:104223817-104223839 TGGGATGACCAGCTGCAGAGAGG - Intergenic
995571055 5:113482689-113482711 GTGAAAGACAACCTGCAGAATGG - Intronic
995742446 5:115369012-115369034 GAGGATGACCAGCTGCAGAGAGG + Intergenic
995744959 5:115393668-115393690 TGGAATTACCAGCTGCAGAGAGG - Intergenic
995877382 5:116804513-116804535 ATGAATCATAAGGTGCAAAGAGG - Intergenic
998595772 5:143528492-143528514 CTGAATGACAAGATGCAGTTAGG + Intergenic
998662979 5:144261484-144261506 ATGAAAGAATTGCTGCAGAGAGG - Intronic
998835686 5:146201148-146201170 ATGAAAGAAAAGGTCCAGAGAGG - Intergenic
999374581 5:151077961-151077983 AAAAATGACAAAGTGCAGAGTGG - Intronic
999924698 5:156362180-156362202 ATGAATGACATAGTGCAGTGTGG - Intronic
1000821708 5:165992737-165992759 ATGAATTACAACATACAGAGTGG + Intergenic
1001397522 5:171427947-171427969 AGGAATGATAAGCCACAGAGAGG - Intronic
1002782613 6:379172-379194 GGCAGTGACAAGCTGCAGAGGGG - Intergenic
1002802886 6:543000-543022 CTGGATGATAAGCTGGAGAGTGG + Intronic
1002986265 6:2192205-2192227 TGGGATGACCAGCTGCAGAGAGG + Intronic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1004932996 6:20479699-20479721 GGGAATGACAAGATGCTGAGTGG + Intronic
1005021433 6:21423172-21423194 AAGGATGACTAGCTGCAGAGAGG - Intergenic
1005433422 6:25782473-25782495 ATGAATGAACAGCTCCAGAGTGG + Intergenic
1005805815 6:29473487-29473509 ATGCATGACATTCTGCAGGGTGG + Intergenic
1006327448 6:33365092-33365114 ATGACTGAGAAGCAGCTGAGTGG + Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1006753781 6:36396785-36396807 TGGAATGATCAGCTGCAGAGAGG + Intronic
1008885366 6:56426553-56426575 ATGAAAGACAATCTACAGAATGG + Intergenic
1008911091 6:56734088-56734110 ATGAAAGAAAAGCTTGAGAGAGG + Intronic
1009610138 6:65930903-65930925 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1010118358 6:72342217-72342239 ATGAATGACAAAATGGAGAGTGG - Intronic
1011483289 6:87816454-87816476 AAGAATGACATGCTGCCAAGAGG + Intergenic
1011530133 6:88312477-88312499 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1012052234 6:94361092-94361114 ACGAATGACCAGCTGTAGAGAGG - Intergenic
1012231141 6:96762449-96762471 CCAGATGACAAGCTGCAGAGAGG - Intergenic
1012848862 6:104423808-104423830 ATGAATAAAAAGTTGCTGAGTGG - Intergenic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1014996147 6:128147618-128147640 ATCAATGACATGCTGCTGATAGG - Intronic
1015143336 6:129959077-129959099 CAGAATGACCAGCTGCAGATGGG + Intergenic
1016758831 6:147715846-147715868 ATGGATGACCAGCTGTGGAGAGG - Intronic
1018284481 6:162222580-162222602 ATGAATCCCAAACTGCAGAAAGG + Intronic
1018659933 6:166076640-166076662 GGGAATGACCAGCTGCAGAGAGG - Intergenic
1019566434 7:1682044-1682066 ATGAAAGACAAGCTCCAGAGTGG - Intergenic
1021021113 7:15599795-15599817 TGGAACGACCAGCTGCAGAGAGG - Intergenic
1021222727 7:17992098-17992120 AAGAATGCGAAGCTGCTGAGTGG - Intergenic
1021500746 7:21329872-21329894 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1024018534 7:45342954-45342976 ATGAAGGACAAGCAACAGACTGG + Intergenic
1024479226 7:49847090-49847112 AAGAATAGCAAGCTGTAGAGAGG + Intronic
1026396950 7:69965007-69965029 ATGAGTGACATGCTGCTGGGAGG - Intronic
1027185947 7:75970901-75970923 AGGAAAGGCAAGCTGCAGTGTGG - Intronic
1027812664 7:82925148-82925170 ATGAATGGCCAGGAGCAGAGCGG - Intronic
1027868011 7:83673106-83673128 ATGAATGTCAAGCTGTTAAGGGG + Intergenic
1027972275 7:85099965-85099987 GCGAAAGACAAGCTGCAGACTGG - Intronic
1028037322 7:86001331-86001353 ATGAATGACAACCTGCAGAATGG + Intergenic
1028089246 7:86677150-86677172 ATAAATGAGAAAATGCAGAGTGG - Intronic
1028520917 7:91729471-91729493 AGTAAGGACAAGCTGAAGAGAGG + Intronic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1029650877 7:101890464-101890486 ACGAAGGACAGGCTGCAGGGTGG - Intronic
1030232696 7:107224727-107224749 AATAATGCCATGCTGCAGAGAGG + Intronic
1030538312 7:110796299-110796321 CTGGATGCCAAGCTTCAGAGAGG + Intronic
1031060272 7:117044026-117044048 ACTAATGACAAGAGGCAGAGTGG - Intronic
1031836486 7:126686043-126686065 CCAGATGACAAGCTGCAGAGAGG + Intronic
1033004306 7:137544888-137544910 ATGAATGATAAACTCCAGTGAGG + Intronic
1034139011 7:148799192-148799214 GTTAAGGACAAGCTGCACAGAGG - Intronic
1034237071 7:149580271-149580293 ATGAATAAGAAGAGGCAGAGTGG - Intergenic
1034240146 7:149604075-149604097 ATGAATAAGAAGAGGCAGAGTGG - Intergenic
1034410006 7:150935622-150935644 ACGAAGGACCAGCAGCAGAGTGG - Intergenic
1034481262 7:151321651-151321673 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1035252366 7:157605727-157605749 GGGGATGACCAGCTGCAGAGAGG - Intronic
1035451018 7:158976754-158976776 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1035561184 8:604701-604723 ATGAAAGACAAGCTCCAGGTGGG - Intergenic
1036787623 8:11698453-11698475 ATGACTGGCCAGCAGCAGAGAGG - Intronic
1037330100 8:17735903-17735925 ATAAATGCAAAGCAGCAGAGAGG + Intronic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1037904948 8:22710782-22710804 ATGAATTAAAAGCAGAAGAGGGG + Intergenic
1039000454 8:32973992-32974014 ACAAATGACAAGCAACAGAGTGG - Intergenic
1039155250 8:34548339-34548361 GTGAATGACAACCTACAGAATGG - Intergenic
1039879833 8:41618254-41618276 ATGAATGACAGGATGCTGAGAGG + Intronic
1040440107 8:47432610-47432632 AGAAATGATAAACTGCAGAGTGG + Intronic
1040627397 8:49164997-49165019 ATGAAAGACAAGCCACAGACTGG - Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1041349687 8:56935907-56935929 ATGAATGACATGCAGGACAGGGG + Intergenic
1041806703 8:61858572-61858594 ATGAAAAACAAGCTACAGACTGG + Intergenic
1042146385 8:65734455-65734477 ATGAATGAGGAGCTACAGAGAGG - Intronic
1043947217 8:86267917-86267939 ATGATTTAAAAGGTGCAGAGAGG + Intronic
1044309139 8:90673107-90673129 AGGAATGACAAGTAGAAGAGGGG + Intronic
1044932945 8:97267272-97267294 ATCAGTGACAAACTACAGAGAGG - Intergenic
1044992063 8:97804853-97804875 ATGAATGCAAAGCTACATAGTGG - Intronic
1046395238 8:113632579-113632601 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1046658032 8:116917378-116917400 GTGAATGTCAAGCTCAAGAGTGG + Intergenic
1048524685 8:135191298-135191320 ATGAATGCCAGGCTGGAGTGAGG + Intergenic
1048718632 8:137297557-137297579 ATGGATCACAATCTGCAGTGTGG - Intergenic
1048863765 8:138743788-138743810 CTGAATGCCAAGATGCTGAGCGG + Intronic
1049545143 8:143227278-143227300 GTGAAAGAGAATCTGCAGAGAGG + Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050725522 9:8644141-8644163 TGGGATGACCAGCTGCAGAGAGG + Intronic
1050985545 9:12077232-12077254 ATGAAAGACAGGCAGAAGAGTGG + Intergenic
1051019395 9:12523516-12523538 TAAAAAGACAAGCTGCAGAGTGG + Intergenic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1053505949 9:38643253-38643275 AGGAATGAGAAGCAGCAGATGGG + Intergenic
1054702695 9:68429649-68429671 ATCAATGAAAAATTGCAGAGGGG - Intronic
1055588947 9:77789313-77789335 ATAAATGGCAAGCTACAAAGTGG + Intronic
1055798598 9:80005075-80005097 ATGAAGGACAAGCAGTAAAGAGG - Intergenic
1057088256 9:92231024-92231046 ATGAAAGACAAGCTACAGACTGG - Intronic
1057223495 9:93270895-93270917 ATGAATGACAAGGTGGCAAGAGG - Intronic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057768386 9:97943881-97943903 AGGAATTATAAGCTGCAGAGAGG - Intronic
1058037520 9:100269210-100269232 ATGGATGAACAGCTCCAGAGAGG - Intronic
1058510819 9:105714052-105714074 GGGGATGACCAGCTGCAGAGAGG + Intronic
1060934599 9:127507863-127507885 ATGAAGGACATCCTGCAGGGTGG - Exonic
1061709648 9:132478844-132478866 ATGAATGACAAGCTGCAGAGCGG - Intronic
1062005044 9:134234828-134234850 GTGTATGCCAAGGTGCAGAGGGG - Intergenic
1062184745 9:135211903-135211925 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1185926125 X:4148955-4148977 ATGAAAGACAATCTGCAGATTGG + Intergenic
1186031747 X:5376130-5376152 ATGAATGGGGAGCTGCAAAGGGG - Intergenic
1186194450 X:7097301-7097323 ATGGCTCACAAGCTTCAGAGAGG - Intronic
1189128923 X:38478467-38478489 AGGAAGGACAAGCTGCACAAAGG - Intronic
1190081855 X:47362875-47362897 CTGAATGCTAAGCTGCAGAAAGG - Intergenic
1190135522 X:47793251-47793273 ATGAAAGACAAGCTATAGACAGG + Intergenic
1190620653 X:52284354-52284376 CAGGATGACAAGCTGCAGAAAGG - Intergenic
1190939643 X:55028029-55028051 ATGAAGGCCAAGATCCAGAGAGG - Intronic
1191221273 X:57990296-57990318 TGGAATGATCAGCTGCAGAGAGG + Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193467632 X:81868141-81868163 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1193720214 X:84976984-84977006 ATGAGAGAGGAGCTGCAGAGGGG - Intergenic
1194451222 X:94046583-94046605 ATGAATGAACAGCTCCAGATAGG + Intergenic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1195178502 X:102333936-102333958 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1195180362 X:102353147-102353169 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1195392302 X:104375348-104375370 AGAAGTGACTAGCTGCAGAGAGG - Intergenic
1195868075 X:109454996-109455018 ATAAAAGTCAAGATGCAGAGAGG + Intronic
1196815165 X:119659814-119659836 GAGAAGGACAAGCTGGAGAGGGG - Intronic
1197378446 X:125710117-125710139 ATGGATGACCAGCTGTGGAGAGG + Intergenic
1197421304 X:126238672-126238694 TAGAATGACCAGCTGCAGAGAGG + Intergenic
1197718909 X:129731362-129731384 ATGGCAGACATGCTGCAGAGAGG + Intergenic
1199659973 X:150039114-150039136 ATAAATGACAAGTTACAGACAGG + Intergenic
1199861081 X:151801074-151801096 GAGGATGACCAGCTGCAGAGAGG - Intergenic
1201566321 Y:15368624-15368646 ATGGCTCACAAGCTTCAGAGAGG - Intergenic