ID: 1061712000

View in Genome Browser
Species Human (GRCh38)
Location 9:132494369-132494391
Sequence ACCAAAAATATGTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061711998_1061712000 -10 Left 1061711998 9:132494356-132494378 CCAAACCATGACGACCAAAAATA 0: 1
1: 0
2: 4
3: 37
4: 237
Right 1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG No data
1061711992_1061712000 24 Left 1061711992 9:132494322-132494344 CCTTTACCCACTAAATGGAGGAT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG No data
1061711997_1061712000 -9 Left 1061711997 9:132494355-132494377 CCCAAACCATGACGACCAAAAAT 0: 1
1: 0
2: 5
3: 44
4: 298
Right 1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG No data
1061711989_1061712000 29 Left 1061711989 9:132494317-132494339 CCTGGCCTTTACCCACTAAATGG 0: 1
1: 3
2: 44
3: 343
4: 1041
Right 1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG No data
1061711995_1061712000 -3 Left 1061711995 9:132494349-132494371 CCCTCTCCCAAACCATGACGACC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG No data
1061711996_1061712000 -4 Left 1061711996 9:132494350-132494372 CCTCTCCCAAACCATGACGACCA 0: 1
1: 0
2: 0
3: 8
4: 167
Right 1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG No data
1061711993_1061712000 18 Left 1061711993 9:132494328-132494350 CCCACTAAATGGAGGATAGCACC 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG No data
1061711994_1061712000 17 Left 1061711994 9:132494329-132494351 CCACTAAATGGAGGATAGCACCC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061712000 Original CRISPR ACCAAAAATATGTCCAGACA TGG Intronic
No off target data available for this crispr