ID: 1061712615

View in Genome Browser
Species Human (GRCh38)
Location 9:132498491-132498513
Sequence CAGGGTCACACAGCAGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 3, 2: 18, 3: 57, 4: 534}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061712615_1061712624 11 Left 1061712615 9:132498491-132498513 CCCGCTTCTGCTGTGTGACCCTG 0: 1
1: 3
2: 18
3: 57
4: 534
Right 1061712624 9:132498525-132498547 GCCTGCGCTCCTCCCAGGGAGGG 0: 1
1: 0
2: 4
3: 29
4: 234
1061712615_1061712623 10 Left 1061712615 9:132498491-132498513 CCCGCTTCTGCTGTGTGACCCTG 0: 1
1: 3
2: 18
3: 57
4: 534
Right 1061712623 9:132498524-132498546 AGCCTGCGCTCCTCCCAGGGAGG 0: 1
1: 0
2: 1
3: 23
4: 224
1061712615_1061712621 6 Left 1061712615 9:132498491-132498513 CCCGCTTCTGCTGTGTGACCCTG 0: 1
1: 3
2: 18
3: 57
4: 534
Right 1061712621 9:132498520-132498542 CCACAGCCTGCGCTCCTCCCAGG 0: 1
1: 0
2: 3
3: 40
4: 488
1061712615_1061712622 7 Left 1061712615 9:132498491-132498513 CCCGCTTCTGCTGTGTGACCCTG 0: 1
1: 3
2: 18
3: 57
4: 534
Right 1061712622 9:132498521-132498543 CACAGCCTGCGCTCCTCCCAGGG 0: 1
1: 0
2: 1
3: 30
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061712615 Original CRISPR CAGGGTCACACAGCAGAAGC GGG (reversed) Intronic
900145388 1:1156949-1156971 CAAGGTCGCACAGCAGGACCAGG + Intergenic
900147649 1:1165446-1165468 GAGGGGCACACGGCAGAGGCTGG - Intergenic
900313024 1:2043563-2043585 CAGGGACACACACCAGCAGGGGG - Intergenic
900380978 1:2383766-2383788 CAGCCTCACACAGCAGCACCTGG + Intronic
900486190 1:2923906-2923928 CAGGGTGCCACAGAAGGAGCAGG + Intergenic
900541834 1:3206777-3206799 CAAGGTCACACGGCACCAGCTGG + Intronic
900834448 1:4989487-4989509 CAGGGACACATAGAAGAATCTGG + Intergenic
900911249 1:5598481-5598503 CAGGGTCACATGGCAGGAGGAGG - Intergenic
901222317 1:7590243-7590265 CAGGGACTCATAGCAGCAGCAGG - Intronic
901681415 1:10914942-10914964 CTGGGTCACAGAGAAGAAGCAGG - Intergenic
901847978 1:11996637-11996659 CAGAGACACACAGCAAATGCAGG - Intronic
901883307 1:12206587-12206609 CAAGGTCACACAGCAGAGCTGGG + Intronic
902392132 1:16112949-16112971 AAGGGTCACACAGCACACGATGG + Intergenic
902450716 1:16495139-16495161 CAGGGTCACACAGCTGGTGAGGG - Intergenic
902502151 1:16918200-16918222 CAGGGTCACACAGCTGGTGAGGG + Intronic
902673205 1:17990148-17990170 CAGTGTCACACAGCAAAAAATGG + Intergenic
902696867 1:18146024-18146046 AAAGGTCACACAGCAGAGCCAGG - Intronic
902776843 1:18680303-18680325 CAGGGTCACACAGCAGGTCATGG + Intronic
903179934 1:21600072-21600094 CAGGGTCACTCAGCACAGGTGGG + Intronic
903192554 1:21664999-21665021 CAAAGTCACACAGCAGAGACTGG + Intronic
903465371 1:23548772-23548794 CAGGGTTGCACAGCAAAAGAGGG + Intergenic
903908191 1:26701531-26701553 CAGGGTCACACAGCTTAATCTGG - Intronic
904029209 1:27523520-27523542 CAGGGTCACACAGCAGAACCAGG + Intergenic
904317255 1:29673481-29673503 CAAGGTCACACAGCTCAAGATGG - Intergenic
904376315 1:30084605-30084627 CAGGGTCACCAAGCAGAAACAGG - Intergenic
904422992 1:30406015-30406037 CAAGGACACACAGCATCAGCAGG + Intergenic
904449530 1:30601958-30601980 CAGTGCCACACAGCAGACACAGG + Intergenic
904483512 1:30808603-30808625 CAAGATCACACAGCAGAAACTGG + Intergenic
904496583 1:30890720-30890742 CAGGGTCACACAGCAGAGCCTGG + Intronic
904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG + Intronic
904926888 1:34056501-34056523 CAAGGTCACACAGCTGAGCCAGG - Intronic
905370144 1:37478669-37478691 CAGGGTCACACAGCAGTTAACGG - Intronic
905876510 1:41435171-41435193 CAGAGTCACACAGCAGAACCAGG - Intergenic
905939832 1:41854246-41854268 CAGGGCCACCCAGCAGGCGCTGG + Intronic
907487403 1:54787367-54787389 CAGGGCCAGACAGCAAGAGCAGG - Intronic
907516882 1:54998456-54998478 CAAGGTCACACAGCTAAAGATGG - Intergenic
907525834 1:55053494-55053516 CAGGGTCGCACAGCTCAAGCTGG + Intronic
910395277 1:86787086-86787108 CAGTGTCACATGGCAAAAGCAGG - Intergenic
912618748 1:111133877-111133899 CAGGGACACTCAGCTGAAGCTGG - Intronic
913276993 1:117147805-117147827 TAGGGTCATACAGGAGAAGCTGG + Intronic
913343123 1:117780084-117780106 TAGGGCCCCAGAGCAGAAGCTGG + Intergenic
913435972 1:118848001-118848023 TAAGGTCACACAGCAGAGGATGG - Intergenic
916678817 1:167086284-167086306 CAGGGCCACAGAGCAGATGGTGG + Intronic
917598444 1:176552702-176552724 TAAGGACACACAGCAGGAGCTGG - Intronic
917600430 1:176568449-176568471 CAAGGTCACACAGCTGGTGCAGG + Intronic
920232348 1:204479104-204479126 CAGGGTCAGGAACCAGAAGCTGG + Intronic
920247630 1:204600353-204600375 CACGGTCACACAGCTGAGACTGG - Intergenic
920255895 1:204654080-204654102 TGGGGTCAAACAGCTGAAGCTGG + Intronic
920351223 1:205339291-205339313 CAGGGTCACAAAGCTGGAGAAGG + Exonic
920849794 1:209621014-209621036 CAGGGTCAGAGAGAAAAAGCAGG - Intronic
921030975 1:211334968-211334990 AAGGGCCACACAGCAGTAGGAGG - Intronic
921358531 1:214308686-214308708 CAGTGCCACACAGCAGATGGTGG + Intronic
921489245 1:215754046-215754068 CAAGGTCACACTGCAGAGCCAGG - Intronic
923035368 1:230281463-230281485 CAGGGTCTGACAGAAGAACCTGG - Exonic
924826803 1:247548310-247548332 CAGAGCCACAAAGCACAAGCTGG - Intronic
1062899323 10:1130487-1130509 CAGGCTCACTCAGCAGTGGCGGG - Exonic
1064402813 10:15035458-15035480 ACGGGTCACACAGCGAAAGCAGG + Intronic
1065383705 10:25114246-25114268 CAAGGTCACACAGTAGATGGGGG + Intergenic
1065669686 10:28102840-28102862 AAGGGAGAAACAGCAGAAGCAGG - Intronic
1065942860 10:30580746-30580768 CAAGGTCACACAACAGAGCCAGG - Intergenic
1067066305 10:43105981-43106003 CAAGGTCACACAGGAACAGCCGG - Intronic
1067469921 10:46528629-46528651 CAGGGTCACCCTGCAGCTGCAGG - Intergenic
1068650628 10:59518654-59518676 CAAGGTCACTCAGCATAAGAGGG - Intergenic
1068727711 10:60321687-60321709 CATGGTCACACCGCAGAAGTGGG + Intronic
1069492119 10:68869957-68869979 CAGGGTCACAGAGCAGAATCTGG + Intronic
1069828813 10:71270450-71270472 CAGGGTCACAGAGAAGCCGCAGG + Intronic
1070058221 10:72955268-72955290 GTGGGTTCCACAGCAGAAGCTGG - Intergenic
1070336591 10:75461287-75461309 CAGGGACACAGAGAAGAAACTGG - Intronic
1070703135 10:78617968-78617990 CAAGGTCACACAGCTAAAACAGG + Intergenic
1071299895 10:84248564-84248586 CAAGGTCACACAGAAGATGAAGG - Intronic
1071789962 10:88942969-88942991 CAGGGTCACACAGCTAGAACTGG - Intronic
1072211253 10:93248931-93248953 CAGGGTCCCGCAGCTGCAGCTGG - Intergenic
1073581995 10:104677086-104677108 CTGGGACACACAGAATAAGCGGG + Intronic
1073786985 10:106900447-106900469 CAGAGTCAGACAGCACATGCAGG + Intronic
1074100114 10:110348232-110348254 CAGGGTCACCCATCAGGGGCTGG - Intergenic
1074336358 10:112580420-112580442 CAAGGTGACTCAGCAGGAGCGGG + Intronic
1074921314 10:118016763-118016785 CAAGGTCACAGGGCAGAAACAGG - Intronic
1076266888 10:129115635-129115657 CAAGGTCACACAGCCAAAGATGG + Intergenic
1077125554 11:934051-934073 CAGGGACACACAGCAGCTGTGGG - Intronic
1077699838 11:4431341-4431363 CAGGGCCCCACTTCAGAAGCCGG + Intergenic
1078271817 11:9802592-9802614 CAGGGACACACAACAGAACTAGG - Intronic
1078882332 11:15464447-15464469 CTGAGGCAGACAGCAGAAGCAGG - Intergenic
1079400942 11:20105810-20105832 CAGGCACAGTCAGCAGAAGCTGG + Intronic
1080618422 11:33966304-33966326 CAGAGTGGCACAGAAGAAGCTGG + Intergenic
1080820451 11:35800899-35800921 TAGAGTCACACAGCAGAACCAGG + Intronic
1080855313 11:36106808-36106830 CCAGGTCACACAGCAGAGGGAGG - Intronic
1080943970 11:36950516-36950538 CAGGGTCAAAGAGGAGAAGAAGG + Intergenic
1081676078 11:44970400-44970422 CAAGGTCACACAGCAAGAGGAGG - Intergenic
1081763800 11:45595239-45595261 CAGGGTTACATGGCAGAAGCTGG + Intergenic
1081852914 11:46286012-46286034 CAGGGTCACACAGCAAGTGAGGG - Intronic
1082085849 11:48048948-48048970 CAGGCTCACACAGCCAATGCTGG + Intronic
1083015374 11:59447788-59447810 CAGGCTAACCCAGGAGAAGCAGG + Intergenic
1083252682 11:61478347-61478369 GAGTCACACACAGCAGAAGCAGG + Intronic
1083273784 11:61585756-61585778 CAGGGCCCCAAAGCAGAACCTGG - Intergenic
1083278950 11:61613712-61613734 CAGGGTCACACAGCAACACAGGG + Intergenic
1084089045 11:66868503-66868525 CGGGGTCACACAGCTGGCGCTGG - Intronic
1084323749 11:68387526-68387548 CAGGGTCACACAGCAGGATGTGG + Intronic
1084574653 11:69981269-69981291 CAAGGTCACACAGCAGTAAGTGG - Intergenic
1084644777 11:70449588-70449610 CAGGGTCACTCAGAGGAAGGAGG + Intergenic
1084680908 11:70665855-70665877 CAGGGTCACCCAGCTCAAGAAGG - Intronic
1084872185 11:72105786-72105808 CAGAGTCACAGAGCAGAACTGGG - Intronic
1084957543 11:72699297-72699319 CAGAGTCACACAGCAAACGGAGG - Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1088373057 11:109112385-109112407 CAGGGCCCCACAGTACAAGCTGG + Intergenic
1089225021 11:116911935-116911957 CAGGGAGAAACAGAAGAAGCTGG + Intronic
1089613488 11:119682344-119682366 CAGGGACAGGCAGCAGAAACAGG + Intronic
1089685804 11:120146054-120146076 CAAGGCCACACAGCAGAGCCGGG + Intronic
1089688839 11:120173471-120173493 CAGGGAGACACAGCAGAGGCTGG - Intronic
1089731745 11:120523645-120523667 CAGGGTCACACAGCTGAACCTGG + Intronic
1090529739 11:127578259-127578281 CAGGGTCACACAGCAGGTAGAGG + Intergenic
1090709595 11:129373477-129373499 CAGGGTCCCGCCGCGGAAGCAGG + Intergenic
1091306053 11:134536806-134536828 CAGGGTTACAGGGCAGAAGAAGG - Intergenic
1091663604 12:2402515-2402537 TAGGGTCACACAGCAGCAAGTGG - Intronic
1091804711 12:3347639-3347661 CAGGGTCACACTGCTGTAGGTGG - Intergenic
1092040263 12:5378125-5378147 CAGGCTCACAAAGCAGATGTTGG - Intergenic
1092734266 12:11565319-11565341 CTGGGCCACACAGCAGAAGGTGG + Intergenic
1094822519 12:34237547-34237569 CAGGGTCAGAGAACAGAACCAGG - Intergenic
1095048420 12:37534962-37534984 TAGGGTCCCACAGGAGAAGGAGG - Intergenic
1096054240 12:48637665-48637687 CATCGGCACACAGCAGAAGGTGG - Intergenic
1096229726 12:49890149-49890171 CAGGGTCTGAAAGGAGAAGCAGG + Exonic
1096542385 12:52314990-52315012 CAAAGTCACAAAGCAGAACCAGG - Intronic
1096613200 12:52816470-52816492 CAGGGTCACACAGCAGCACGTGG + Intergenic
1096749094 12:53747490-53747512 CAGGGACACAAGGCAGATGCTGG + Intergenic
1097277515 12:57823515-57823537 CAGCGTGACAGAGTAGAAGCTGG - Exonic
1097376533 12:58849747-58849769 CAGGATCCCACAGGGGAAGCTGG - Intergenic
1099132371 12:78851097-78851119 CAGGGTGTAACAGCAGAAGTAGG - Intergenic
1101725639 12:107385994-107386016 CAAGGTCACACAACAGGAGCTGG - Intronic
1101838086 12:108309017-108309039 CATGGTCACACAGCAGAGCTGGG - Intronic
1101925978 12:108971717-108971739 CAGGCTCCCACAGCAGACACTGG + Intronic
1102200528 12:111054996-111055018 CAAGGCCACACAGCAGAGCCAGG + Intronic
1102228551 12:111246777-111246799 CAGGCTCACACAAGAGAGGCAGG - Intronic
1102413428 12:112739884-112739906 CAGTGTCACCCAGTAGAAGCTGG - Intronic
1102699050 12:114823374-114823396 CAAGGTCACACAGCATGAGGTGG - Intergenic
1102787501 12:115616685-115616707 CAGGGTCCCAGAGCAGGAGTGGG - Intergenic
1102998656 12:117368479-117368501 CAAGGTCACACAGCAGATGGAGG - Intronic
1103226335 12:119291125-119291147 CAGGGCCACACAGCAGGAAGTGG + Intergenic
1103487727 12:121294629-121294651 CAGGGTCACACAGCCAGTGCAGG - Intronic
1103855128 12:123962741-123962763 GAGAGTCAGACTGCAGAAGCAGG - Intronic
1103948236 12:124538798-124538820 CAGGGTCAGAGAGGAGGAGCGGG - Intronic
1103998457 12:124844957-124844979 CATGGTCACACAGCAGCAGGAGG + Intronic
1104589992 12:130076368-130076390 CATGGTCACAGAGCAGGAGGTGG + Intergenic
1104681415 12:130754542-130754564 CAGGAACAAGCAGCAGAAGCAGG + Intergenic
1104902621 12:132197577-132197599 CAGGGTCACACAGCCAGAGAGGG - Intronic
1105245326 13:18645178-18645200 CAAGGCCACAGAGCAGCAGCAGG - Intergenic
1105821765 13:24086739-24086761 AAGGGCCAGCCAGCAGAAGCGGG + Intronic
1105892614 13:24692415-24692437 CAGGGTCACCTAGCAGGAGAGGG - Exonic
1106102429 13:26706622-26706644 CAGGGTCACACAGGGGCTGCTGG - Intergenic
1107106402 13:36648001-36648023 CTGGGCCACACAGCAGGAACTGG - Intergenic
1107803514 13:44132627-44132649 CTGAGTCACTCAGCAGAATCGGG + Intergenic
1108089221 13:46829403-46829425 CAAGGTCAGACAACAGCAGCAGG + Intergenic
1108191928 13:47950521-47950543 GAGGGCCATACAGGAGAAGCTGG - Intronic
1108259903 13:48646071-48646093 GGGAGTCACACAACAGAAGCTGG + Intergenic
1111861727 13:93715562-93715584 CAGCGTCACACAGTATAACCAGG + Intronic
1112327232 13:98449940-98449962 CCGGGCCACACAGCAGCATCAGG + Intronic
1113893164 13:113747311-113747333 CAGGGTCACACAGCAGGCAGTGG - Intergenic
1114411918 14:22508994-22509016 AAGGGTCACACAGCCAAAGACGG + Intergenic
1115596420 14:34913836-34913858 CTGGGTGACACAGCAAAACCTGG + Intergenic
1117224660 14:53642714-53642736 CAAGGCCACACAGCAGGAGGTGG - Intergenic
1117704370 14:58448114-58448136 TAAGGTCACACAGCAGAGTCAGG + Intronic
1117756483 14:58979515-58979537 CAGGGTCACCCGACAGTAGCTGG - Intergenic
1118323082 14:64764720-64764742 CAGGGACGCATGGCAGAAGCAGG + Intronic
1119115090 14:72012758-72012780 CAGAGTCACACAGTAGTAACTGG - Intronic
1120077178 14:80172293-80172315 CAGGGTCACACAATAAAAGAAGG + Intergenic
1120720934 14:87889094-87889116 CAGGGTTACAGAGCTGAAGTAGG - Intronic
1121419381 14:93801949-93801971 GAGGGCCCCACAGCAGCAGCTGG + Intergenic
1121429240 14:93875050-93875072 CAAGGTCACATGGCAGAAGATGG - Intergenic
1121493298 14:94375350-94375372 CAGGCTCTCACACCAGAAACAGG - Intergenic
1121553886 14:94821982-94822004 CAAGGTCACACAGCAGAAGTGGG - Intergenic
1122132316 14:99611847-99611869 CAGGGTCACACAGTACACACAGG + Intergenic
1122624792 14:103079013-103079035 CATAGACACACAGCAGACGCTGG + Intergenic
1123666569 15:22613183-22613205 CATGGCCACACAGAAGAAGAAGG - Intergenic
1124240578 15:28024615-28024637 CCCAGTCACACGGCAGAAGCCGG - Intronic
1124251681 15:28110308-28110330 CAGAGCCACTCAGCAGAGGCCGG + Intergenic
1124320412 15:28707756-28707778 CATGGCCACACAGAAGAAGAAGG - Exonic
1124482102 15:30087654-30087676 CATGGCCACACAGAAGAAGAAGG + Exonic
1124488560 15:30139754-30139776 CATGGCCACACAGAAGAAGAAGG + Exonic
1124543646 15:30608726-30608748 CATGGCCACACAGAAGAAGAAGG + Exonic
1124575207 15:30902012-30902034 CAGGGTCATACATCAGGTGCTGG + Intergenic
1124754968 15:32398568-32398590 CATGGCCACACAGAAGAAGAAGG - Exonic
1124791622 15:32732366-32732388 CAGGTACACTCAGCAGAGGCAGG - Exonic
1125514212 15:40308877-40308899 CTGGGGTACACAGCAGAGGCGGG - Intergenic
1126993899 15:54417308-54417330 CAAGGTCACACAGCAAAAGACGG - Intronic
1128218880 15:65953776-65953798 CAGGGACACGGGGCAGAAGCAGG - Intronic
1128291096 15:66479041-66479063 CAAAGTCACACAGCAAAAACTGG - Intronic
1128391630 15:67186487-67186509 CAGAGTCACACAGCAAGAACAGG + Intronic
1128609228 15:69060405-69060427 CAAGGTCACACAGCAGACTGTGG - Intronic
1128711490 15:69875594-69875616 CAATGTCACACAGCAGAAATGGG - Intergenic
1128780398 15:70355303-70355325 CAAGGTCACACAGCAGGCACGGG - Intergenic
1129059311 15:72848216-72848238 CAGGGTCACCCAGCAAGAGCTGG + Intergenic
1129682433 15:77665409-77665431 CAGGGTCACACACAAGCAGTGGG - Intronic
1129711122 15:77820603-77820625 CAAGGTCACACAGCAGGAGCGGG - Intronic
1129869202 15:78929919-78929941 CAGGGCCACACAGCTAAAGCTGG + Intronic
1130394417 15:83489637-83489659 CAAGATCACAAAGCAGAAGCAGG - Intronic
1130516835 15:84632208-84632230 CTGGGTCAGACAGCAGCATCCGG + Intergenic
1130722238 15:86399794-86399816 CAGTGTCACTAAGGAGAAGCTGG - Intronic
1131093997 15:89644853-89644875 CAGGGTCACACAGCTGGAAGAGG + Intronic
1131770202 15:95728948-95728970 CCAGGTCACACGGCAGTAGCAGG - Intergenic
1131831642 15:96358700-96358722 GAGGGTCACACTGCAGGCGCAGG - Intergenic
1132200986 15:99954596-99954618 CAAGGTCACACAGCACATGAGGG - Intergenic
1133035924 16:3034246-3034268 CAGGGTCACACAGCTGGACGAGG + Intronic
1133430964 16:5736455-5736477 GAGGGAAACGCAGCAGAAGCTGG - Intergenic
1133461303 16:5988946-5988968 CAAGGTCACACAGCAGATGCAGG - Intergenic
1133578997 16:7124821-7124843 CAGAGTCATACAGTAGAAACAGG - Intronic
1133921824 16:10160325-10160347 CAGGAGCACACAGCACAAGTGGG + Intronic
1133975882 16:10599608-10599630 CAGGGTCACACAGCAGCTAGTGG + Intergenic
1133983923 16:10653478-10653500 CAAGGTCACACAGCAGGAAGTGG - Intronic
1134026414 16:10957260-10957282 CTGGGTCCCACAGCAGTTGCTGG - Intronic
1134788517 16:16966649-16966671 CAGGGTCACACAGCAAATCAGGG + Intergenic
1135591334 16:23706957-23706979 CAGGTTCAGCCAGCAGAGGCAGG - Intronic
1135771891 16:25224183-25224205 CAGGGTCGCACAGTAAAATCTGG + Intronic
1136004498 16:27319367-27319389 CAGGGTCACACACCTGAAGGTGG + Intronic
1136008925 16:27349712-27349734 CAGGGTCACACAGCTGGAAATGG + Intronic
1136545065 16:30949931-30949953 AAGGGTCACCCAGCTGAAGGTGG + Intronic
1136609402 16:31357092-31357114 CAGGGCCACTCACCAGCAGCTGG - Exonic
1136682478 16:31976286-31976308 CAGGGCCTCACCGCAGAACCTGG - Intergenic
1136716559 16:32287502-32287524 CAGGTTCACCCAGAAGCAGCAGG - Intergenic
1136782738 16:32917454-32917476 CAGGGCCTCACCGCAGAACCTGG - Intergenic
1136834947 16:33493780-33493802 CAGGTTCACCCAGAAGCAGCAGG - Intergenic
1136887059 16:33936396-33936418 CAGGGCCTCACCGCAGAACCTGG + Intergenic
1136929715 16:34408189-34408211 CAAGGTCACACCGCGAAAGCAGG - Intergenic
1136974859 16:35003616-35003638 CAAGGTCACACCGCGAAAGCAGG + Intergenic
1137010319 16:35314543-35314565 CAGGGTCCCACAAGAGAGGCTGG - Intergenic
1137325502 16:47431257-47431279 CTGGGCCACACAGCAGGAGGTGG + Intronic
1137580911 16:49632931-49632953 GAGGGGCACCCAGGAGAAGCGGG + Intronic
1137720510 16:50625020-50625042 CAGGGTCACACAGCTGTGGAGGG + Intronic
1138598554 16:58042022-58042044 CAGGGTCACACAGCAAGCCCTGG + Intronic
1139342006 16:66273540-66273562 CAGGGTCAGAAGGCAGAAGAGGG - Intergenic
1139375588 16:66494519-66494541 CAGGGTCACACAACTGAACTGGG - Intronic
1140112661 16:72017069-72017091 ACGGGCCAGACAGCAGAAGCAGG + Exonic
1140485915 16:75293074-75293096 CAGGCACACACACCAGAAGCAGG + Intergenic
1141598826 16:85113326-85113348 CAAGGTCACACAGCAGAGCGGGG - Intergenic
1141607631 16:85163810-85163832 CAGATTCACAGAGCAGAATCGGG - Intergenic
1141873766 16:86807266-86807288 GAGGCGCACACAGCAGGAGCTGG + Intergenic
1142189331 16:88710503-88710525 CAGGTGCACAAATCAGAAGCTGG + Intronic
1142189338 16:88710570-88710592 CAGGTGCACAAATCAGAAGCTGG + Intronic
1142193032 16:88726587-88726609 CTGGATGACCCAGCAGAAGCCGG + Exonic
1142355773 16:89601122-89601144 CAGGGTCACACAGCGGGAGCTGG - Intergenic
1203009856 16_KI270728v1_random:230252-230274 CAGGTTCACCCAGAAGCAGCAGG + Intergenic
1203145109 16_KI270728v1_random:1794068-1794090 CAGGTTCACCCAGAAGCAGCAGG - Intergenic
1143118171 17:4592193-4592215 CCAAGTCACACAGCAAAAGCTGG - Intronic
1143270982 17:5674140-5674162 CAGGATCACACAGCAGAGGAAGG - Intergenic
1144172115 17:12667917-12667939 CATGATATCACAGCAGAAGCAGG + Intronic
1144670672 17:17131004-17131026 CAAGGGAACACAGCAAAAGCAGG - Intronic
1144738013 17:17565641-17565663 CAGGGCCACACAGTGGCAGCTGG - Intronic
1144753731 17:17667401-17667423 CAAGGTCACACAGCAACAGGTGG + Intergenic
1144764902 17:17727307-17727329 CAAGGTCACACAGCAGTTGCTGG + Intronic
1144832795 17:18140871-18140893 CAAGGTCACACAGCATGGGCAGG - Intronic
1144959374 17:19036238-19036260 CACAATCACACAGCAGAGGCAGG + Intronic
1144975785 17:19138286-19138308 CACAATCACACAGCAGAGGCAGG - Intronic
1145245794 17:21268541-21268563 CAAGGTCACACAGCAAAACTGGG - Intergenic
1145411682 17:22671141-22671163 TAGGGTCCCACAGGAGAAGGAGG - Intergenic
1145815816 17:27794167-27794189 CAGGGCCACACAGCAGCCCCAGG + Intronic
1146632940 17:34483821-34483843 CAGGGTCACACAGCAATCACTGG - Intergenic
1146788783 17:35739862-35739884 CAGGAGCTCACAGCAGAAGTGGG + Intronic
1147143002 17:38469624-38469646 CAGGGCCTCACCGCAGAACCCGG - Exonic
1147612105 17:41807921-41807943 CAGCGTCATGCAGCAGAACCTGG - Exonic
1147640095 17:41992096-41992118 CAGTGTCACACAGCAGTGACAGG + Intronic
1147717851 17:42520157-42520179 CAGGGTCACACAGCACCATGTGG + Intronic
1147911280 17:43857714-43857736 CATGGTCACACAGCAGGTGGTGG + Intronic
1148931846 17:51133279-51133301 CAGCCTCACACATCAGAAGCAGG + Intergenic
1150130978 17:62668839-62668861 CAGGGCCACACAGCAGTAAGGGG - Intronic
1150609671 17:66723836-66723858 CAGAGTCACACAGCAAAAATGGG + Intronic
1150636723 17:66918406-66918428 GAGGGTCACATAGCAGAGCCAGG - Intergenic
1150647765 17:66990453-66990475 CAGGGGCACACAGCAGCGGGTGG + Intronic
1151172967 17:72263583-72263605 CAGGGTCTCACAAAGGAAGCAGG + Intergenic
1151960483 17:77402995-77403017 CAGGGACACACAGCAGACAGAGG - Intronic
1152301325 17:79496634-79496656 CAGGGACAGACAGCAGCAGAGGG + Intronic
1152363194 17:79841775-79841797 CGGGGCCACACAGCAGGACCCGG + Intergenic
1152377666 17:79927103-79927125 CAAGGTCACACAGCAAAAGAGGG + Intergenic
1152430193 17:80244510-80244532 CCTGGTCACACAGGAGAGGCTGG + Intronic
1152580007 17:81161715-81161737 CATGGTCACACAGCAGGGCCCGG + Intronic
1153655833 18:7281362-7281384 AAGGGTCTCACAGCAGAAAAGGG - Intergenic
1154025002 18:10698737-10698759 TGGGGTCACACAGCTGAGGCAGG + Intronic
1154326489 18:13395083-13395105 CAGTGTCACAGAGCAGGAACTGG - Intronic
1154353096 18:13603482-13603504 CAAAGTCACACAGCAGTAACTGG - Intronic
1154443620 18:14414769-14414791 CAAGGCCACAGAGCAGCAGCAGG + Intergenic
1155159672 18:23185445-23185467 CAGGAACACACAGCTGAACCAGG - Intronic
1157340479 18:46773411-46773433 GATTGTAACACAGCAGAAGCAGG + Intergenic
1157367581 18:47079937-47079959 CAGGGTGACACACCTGAACCCGG - Intronic
1157900149 18:51507157-51507179 TAGAGAGACACAGCAGAAGCTGG - Intergenic
1158295596 18:55993745-55993767 CAGGCCCACTCAGGAGAAGCAGG - Intergenic
1159729257 18:72004613-72004635 GAGAGACACAAAGCAGAAGCAGG + Intergenic
1160859790 19:1232957-1232979 CAAGGTCACACAGCAGCTGATGG + Intronic
1160887253 19:1355573-1355595 AAGGGGGTCACAGCAGAAGCGGG - Intronic
1161070130 19:2255836-2255858 CAGGGTCACGCAGCAGGATGTGG - Intronic
1161262143 19:3343999-3344021 CAGGGTCACACAGCACAGTGGGG + Intergenic
1161280962 19:3445553-3445575 CTGGGACACACCCCAGAAGCAGG - Intronic
1161348360 19:3778928-3778950 CAGGGTCATACAGCAGAGCTGGG + Intronic
1161443182 19:4304100-4304122 CAGGGTCCCTCAGCAGACGGTGG - Intergenic
1161663197 19:5559877-5559899 CAGGGACACACAGCAGGGGGAGG - Intergenic
1162337137 19:10068858-10068880 CAAAGTCACACAGCAGAGTCAGG + Intergenic
1162450692 19:10752657-10752679 CAGGGTCACACAGCATCTGGGGG - Intronic
1163454568 19:17399015-17399037 CAGGGACACTCAGCAGTGGCTGG + Intergenic
1164677622 19:30112310-30112332 CAGGGCCACACAGCACAGGAGGG - Intergenic
1164803991 19:31102152-31102174 CAGGGCCTCACAGAGGAAGCTGG + Intergenic
1166070458 19:40384230-40384252 CAGAGTCAAATAGCAGATGCAGG - Intronic
1166325269 19:42046107-42046129 CAAGGCCACCCAGCTGAAGCAGG + Intronic
1166862468 19:45818210-45818232 CATGGGCAGACAGCAGAGGCCGG - Intronic
1167086597 19:47314112-47314134 AAGGGGCAGAGAGCAGAAGCTGG - Intronic
1167747750 19:51362723-51362745 CAAGGTCACACAGCAGGAAGTGG + Intronic
925043465 2:752300-752322 GAGGGTAACATAGCAGATGCCGG + Intergenic
925103824 2:1272412-1272434 CTGGGCCTCACAGCAGGAGCTGG - Intronic
925198340 2:1945982-1946004 CTGGGCCACACAGCAGGAGGGGG + Intronic
927206149 2:20611781-20611803 CACGGTGAGGCAGCAGAAGCAGG + Intronic
927494436 2:23543093-23543115 CAGGGACACACTGCACAAGGAGG - Intronic
927855054 2:26522750-26522772 CAGGGTCACACAGCAGGTTCAGG - Intronic
928693060 2:33820700-33820722 CAGGGTGTCACAGCCCAAGCAGG - Intergenic
928705021 2:33940341-33940363 CACGATGAGACAGCAGAAGCAGG - Intergenic
929146735 2:38712953-38712975 CAGGGTCAGAGAACAGAACCAGG - Intronic
929920463 2:46167762-46167784 CATGGTCACAGAGTAAAAGCAGG - Intronic
929953080 2:46431741-46431763 CAGAGTCACACAGGAGACGTGGG - Intronic
930774552 2:55159304-55159326 CAGGGCCACACATGGGAAGCAGG - Intergenic
932738931 2:74276907-74276929 CAGGGACAAGCAGAAGAAGCTGG + Intronic
933315027 2:80705116-80705138 CACGGTCACACAGGACAAGAGGG + Intergenic
933704923 2:85282631-85282653 CAGGGTCACACAGCCTATGTTGG + Intronic
935375180 2:102388353-102388375 CAGGGTCACACGGCAGGTGAAGG + Intronic
935649032 2:105366384-105366406 AAGGGCAAAACAGCAGAAGCTGG + Intronic
936395876 2:112129350-112129372 CAGGGTAACACAACAGAATAAGG + Intergenic
937014415 2:118591164-118591186 CAGGCTCAGGGAGCAGAAGCTGG - Intergenic
937247300 2:120501951-120501973 CAGGGTCACACAGCAAATCAGGG + Intergenic
937983645 2:127628935-127628957 CAGGGTCACACAGCTCAAGGGGG + Intronic
938370157 2:130763551-130763573 CAGTGTCACACAGCTTCAGCAGG - Exonic
938729008 2:134131361-134131383 CAGGGTCACACAGCCAGAACTGG + Intronic
938767739 2:134471826-134471848 CAGGGTCACTCTGCAGTGGCAGG + Intronic
938969092 2:136415897-136415919 CAGAGTCACACAGGAGAAGAGGG + Intergenic
940867301 2:158830022-158830044 CAGGGAAACACAGCAGAAGGAGG + Intronic
942472008 2:176269855-176269877 CAAGGTCACCCCGCAGGAGCAGG + Intronic
944551091 2:200845343-200845365 CATGGTCATCCTGCAGAAGCTGG + Intergenic
944638192 2:201695158-201695180 TAGGGTGACAGAGCAGTAGCCGG - Intronic
946397447 2:219450049-219450071 CAGGGTCTCCCAGGAGCAGCAGG - Intronic
946641935 2:221793231-221793253 GAGGTTCACAAAGCAGAAGAAGG - Intergenic
947712074 2:232321981-232322003 CAGGGTCACCCATCTGAACCTGG - Intronic
947731003 2:232431623-232431645 CAGGGTCACTCAGCAGGTGTTGG - Intergenic
947731315 2:232433100-232433122 CAGGGTCACCCATCTGAACCTGG - Intergenic
948118108 2:235508882-235508904 CAGGGTTACACAGAGGAAGGTGG + Intronic
948312099 2:236994997-236995019 CAGGGTCATTCAGGAGATGCTGG + Intergenic
948631725 2:239306957-239306979 CAGGGTAACCCAGAAGCAGCAGG + Intronic
1168850443 20:973059-973081 CAGGGTCACACAGAATTGGCAGG + Intronic
1169155077 20:3322849-3322871 CAGGGTCCCACACCACCAGCAGG + Intronic
1169759308 20:9074140-9074162 CAGGGTCACACAGCTAAAAGAGG - Intronic
1171062693 20:21981803-21981825 CAAGGTCACACAGCAAATCCAGG + Intergenic
1171407051 20:24918418-24918440 CAAGGTCTCACAGCTGAAGAGGG + Intergenic
1171542950 20:25978441-25978463 TAGGGTCCCACAGGAGAAGGAGG - Intergenic
1171845989 20:30275086-30275108 TAGGGTCCCACAGGAGAAGGAGG - Intergenic
1172372321 20:34404360-34404382 AAGGGTCACACTGCAAAACCTGG - Intronic
1172636650 20:36414563-36414585 CAAGGTCACACAGCAGGTGGAGG - Intronic
1173659914 20:44726019-44726041 CAGAGTCACACAGCAAAAAGGGG - Intronic
1173667110 20:44771031-44771053 CAAGGTCACACAGCAGGAAGGGG + Intronic
1173895193 20:46545749-46545771 CAGGGTCACTCAGCAGGTCCTGG - Exonic
1173975384 20:47183053-47183075 CAGGGCAACACAGCAGGAGGAGG - Intronic
1174295881 20:49544751-49544773 CAAGGTCACACAGCCAAAGCGGG + Intronic
1174300836 20:49580989-49581011 CATGGACACAGAGCAGTAGCAGG - Intergenic
1175165799 20:57043592-57043614 CAGGGTCACACAGTAGAACCTGG - Intergenic
1175472265 20:59238887-59238909 CAGTCACACACAGCAGACGCAGG + Intronic
1175767112 20:61599305-61599327 CAGAGTCCCCCAGCAGAAGGAGG - Intronic
1175937152 20:62519115-62519137 CTGAGTCACCCAGCAGGAGCGGG + Intergenic
1176211787 20:63927419-63927441 CAGCCTCACACAGGAGTAGCTGG - Intronic
1176244621 20:64091483-64091505 CAGGAGCACACAGCAGGTGCTGG + Intronic
1176452468 21:6876469-6876491 CAAGGCCACAGAGCAGCAGCAGG - Intergenic
1176830641 21:13741518-13741540 CAAGGCCACAGAGCAGCAGCAGG - Intergenic
1176873061 21:14099474-14099496 CAGGGTCAGAGAACAGAACCAGG - Intergenic
1177625993 21:23660549-23660571 CAGTGTCAGACAGGAGAAGATGG + Intergenic
1178297349 21:31421407-31421429 CTGGGCCACACAGCAGGAGGTGG + Intronic
1178499012 21:33110460-33110482 CAGGGTCACACAGCAAGGGCTGG - Intergenic
1178673067 21:34608872-34608894 CAGAGTCACACTGCATAAGTGGG + Intronic
1179397621 21:41056111-41056133 CAGGGGCACAGCTCAGAAGCAGG + Intergenic
1179886878 21:44318010-44318032 CAGGGACACACTGCAAAGGCAGG - Intronic
1180229212 21:46416525-46416547 CAGAGCCACACTGCAGAGGCTGG + Exonic
1180232918 21:46438244-46438266 CACGGTGACCCAGGAGAAGCTGG + Exonic
1181037025 22:20174667-20174689 CAGGGTCTCAGTGCTGAAGCAGG - Intergenic
1181457172 22:23066410-23066432 TAAGGTCACACAGCAGATGGTGG + Intronic
1181534012 22:23532512-23532534 CAAGGTCACACAGCCCCAGCTGG - Intergenic
1181564519 22:23726811-23726833 CTGGGTCATACAGCAGGGGCTGG - Intergenic
1181759995 22:25051696-25051718 CAGGGTGACCCAGCAGAGGAGGG + Intronic
1181802939 22:25359015-25359037 CAGGGTCACACAGCAGGAGGTGG - Intronic
1182639399 22:31754250-31754272 CAAGGTCACACAGCGGAATGGGG - Intronic
1183242093 22:36665279-36665301 CAGGGTCACACAACATAGGAAGG - Intronic
1183328352 22:37206396-37206418 CAAGGTCACACAGCAAGACCTGG + Exonic
1183468871 22:37995083-37995105 CAAGATCACACAGCAGGAGCTGG - Intronic
1183669731 22:39265345-39265367 CAAGGTCACACAGCAGCAAGTGG - Intergenic
1183834036 22:40437240-40437262 TAGCGTTACACAGTAGAAGCAGG - Intronic
1183922604 22:41181440-41181462 CGGGGTCACTGAGCTGAAGCAGG - Intergenic
1184266648 22:43350626-43350648 AGAGGTCACACAGCAGAACCAGG + Intergenic
1184475641 22:44719894-44719916 CAGGGCCAGAAAGCAGAGGCTGG - Intronic
1184532741 22:45066725-45066747 CAGGGTTACAGAGGAGAATCAGG + Intergenic
949355737 3:3179076-3179098 CAAGGTCACACAGCAGAGTCAGG - Intronic
949757352 3:7427813-7427835 CAAGGTCACACAGCACAAAATGG + Intronic
950116762 3:10455801-10455823 CAGGGTCACACCACTGGAGCTGG - Intronic
950160601 3:10757921-10757943 CAGGGTCACACAGCTGGGTCTGG + Intergenic
950180791 3:10911793-10911815 CAGGGTCACACAGCTGAGGCCGG + Intronic
950219055 3:11180524-11180546 CCGGGCCACACAGCAGAAGATGG - Intronic
950481928 3:13249634-13249656 TAGGGTCACACAGCAAGAGCTGG - Intergenic
950525522 3:13520686-13520708 CAGGGCCACACAGCATGTGCAGG - Intergenic
950885134 3:16356281-16356303 CAGGGTCACACAGGAGTAACTGG + Intronic
952071374 3:29640839-29640861 CAGGGTCACACAGGAGTAAGGGG - Intronic
952421186 3:33132616-33132638 CAAGGTCATGCAGCAGAACCTGG + Exonic
952694440 3:36249351-36249373 CAGGGGCACACATCAGAAGGAGG + Intergenic
953686145 3:45079798-45079820 CAGGGTCACAGAGCAGCAAGAGG - Intergenic
954622984 3:52006223-52006245 CAGTGTCACACAGAAGGAACAGG - Intergenic
954626022 3:52022293-52022315 CAGGGTCACACAGCCATAGTGGG - Intergenic
954627891 3:52032698-52032720 CACGGTCACACAGCTGTAGGTGG + Intergenic
954724630 3:52597144-52597166 CTGTGTCACACAGCTGATGCTGG + Intronic
954751126 3:52814242-52814264 CAGTGTCACGCAGAAGGAGCCGG + Exonic
955409847 3:58648474-58648496 CAGGGTCACACAGCTGTAAGTGG - Intronic
955750465 3:62181213-62181235 CAGGGTCCCACATCGGAAGAAGG + Intronic
955904134 3:63789074-63789096 CTGGGCCTCACAGCAGAAGATGG + Intergenic
955905567 3:63804164-63804186 CTGGGCCACACAACAGAAGGTGG - Intergenic
956020574 3:64929226-64929248 TAAGGTCACACAGCCAAAGCTGG - Intergenic
956564431 3:70619712-70619734 CAAGGTCACATAGCAAAAGATGG + Intergenic
960591342 3:119368828-119368850 CAAGGTCACACAGCAGAGGCAGG + Intronic
961614078 3:128164907-128164929 CTGGGTCAGAAAGCTGAAGCTGG - Intronic
961660906 3:128468356-128468378 GAAGGTCACACAGCAGTACCAGG + Intergenic
961823746 3:129588177-129588199 CAGAGTCGCACAGCAGGAGCTGG - Intronic
962058650 3:131901707-131901729 CTGGGCCATCCAGCAGAAGCTGG - Intronic
962934015 3:140062754-140062776 CAAGGTCACACAGCAGAGCTGGG - Intronic
963003371 3:140704018-140704040 CAGAATCAAACAGCAGCAGCTGG + Intergenic
963245321 3:143053287-143053309 CATGGTCACACAGGAGAGTCAGG - Intronic
963377724 3:144491517-144491539 TATGCTCACACAGTAGAAGCTGG + Intergenic
964012827 3:151911517-151911539 CATAGTCTTACAGCAGAAGCTGG + Intergenic
964369822 3:155988269-155988291 CAGGGTGACAGAGCACAAGAGGG - Intergenic
967610438 3:191499684-191499706 CTGCCTCATACAGCAGAAGCTGG - Intergenic
967636225 3:191805456-191805478 CAGGGCCACACAGTAGACCCTGG + Intergenic
969139698 4:5057692-5057714 CAGGATCAAACAGCATAATCTGG + Intronic
969254726 4:5994164-5994186 CAGGGTCACACAGCTGCTGCAGG - Intergenic
969413492 4:7044048-7044070 CAAGGTCACACAGCCGAGACGGG + Intronic
969456185 4:7300975-7300997 CTGGGCCACACAGAAGAGGCAGG - Intronic
969559088 4:7934567-7934589 CAGGGGCACTCAGGAGAAGTTGG + Intronic
969579783 4:8058032-8058054 CAGAACCTCACAGCAGAAGCGGG + Intronic
969580763 4:8063547-8063569 CAAGGTCACACAGCAGCAGGTGG + Intronic
969663749 4:8545228-8545250 CTGGGAGACACAGCAGATGCGGG - Intergenic
969930429 4:10625789-10625811 CAGAGTCAGAAAGCAGAAACTGG + Intronic
971280498 4:25239323-25239345 CAGGATCCCACAGCAGCAGGGGG + Intronic
971391542 4:26190702-26190724 AAGGGTCAAACAGCAAAAGAGGG - Intronic
973017779 4:45163300-45163322 CTAGGCCACACAGCAGAAGTTGG - Intergenic
975551478 4:75617454-75617476 CAAGGTCACACAGCAATAACTGG + Intronic
976887839 4:90007792-90007814 CTGTGTGACACAGCAGGAGCAGG + Intergenic
979602850 4:122605109-122605131 AAATGACACACAGCAGAAGCTGG - Intergenic
981106893 4:140891760-140891782 CTGGGCCACACAGCAGGAGGTGG + Intronic
981150062 4:141369996-141370018 CAGGGACCCACTGCAGTAGCTGG + Intergenic
982118805 4:152119397-152119419 CAGGGTCACACAGCAGAAACTGG + Intergenic
982842460 4:160208116-160208138 AAGGGTCACACAGCCATAGCTGG + Intergenic
983213018 4:164977692-164977714 CAGGGTCACAGAGCATGCGCAGG - Intergenic
983987195 4:174073698-174073720 CAGGCTCAGCCAGCAGAAGGAGG - Intergenic
984706499 4:182851015-182851037 CAGGGCCACTGAGGAGAAGCCGG + Intergenic
984769091 4:183422167-183422189 CAGGGGCCCACAGCGCAAGCAGG + Intergenic
985903438 5:2814540-2814562 CAGGGTCATGCAGCAGGGGCTGG + Intergenic
986107607 5:4674921-4674943 CAGGGTAACCCAGCATAAACTGG - Intergenic
987017853 5:13838328-13838350 CCGGGCCACACAGCAGGAGGTGG + Intronic
987557504 5:19473356-19473378 GAGGGTCAGAGATCAGAAGCTGG - Exonic
988633004 5:32951277-32951299 GAGGGTCACACAGCAATAGCAGG + Intergenic
990264244 5:54058648-54058670 CAGGTTCAAGGAGCAGAAGCGGG + Intronic
991311281 5:65245428-65245450 TAGAATCACACAGCAGAAGCTGG - Intronic
991684150 5:69166593-69166615 CAGGGTCACACATTAGCAACGGG - Intergenic
991972345 5:72153221-72153243 CTGGGTTACACAGCAGCAGATGG + Intronic
994117165 5:96073769-96073791 CAGGGTCGCACAGCAGAAGGTGG - Intergenic
994172078 5:96668917-96668939 AAGGGTCACCTTGCAGAAGCTGG + Intronic
994921234 5:106046671-106046693 CAAGGTCACACTGCAGCAGGAGG + Intergenic
994935573 5:106249004-106249026 CAAGATCACACAGCAGAGCCAGG - Intergenic
997030381 5:130120812-130120834 CAGGGACACACCGTAAAAGCTGG + Intronic
997445178 5:133935158-133935180 CATGGTCTCAGAGAAGAAGCTGG + Intergenic
997908684 5:137846633-137846655 CAGTGGGCCACAGCAGAAGCTGG + Intergenic
998179017 5:139923418-139923440 GAGGGTCACAGGGCAGAAGTAGG + Intronic
998351049 5:141501594-141501616 CAGAGTCACACAGCTGGAACTGG - Intronic
999055460 5:148570652-148570674 AAGGGTCACACATCAGGAGGGGG + Intronic
999186540 5:149714863-149714885 CAGGGTTACACTTCAGAAGGAGG - Intergenic
999279045 5:150352725-150352747 CAAGGTCACACAGCTGAGCCAGG + Intergenic
999309029 5:150539504-150539526 CAAGGTCACACAGCCGAGGCAGG - Intronic
1000243818 5:159432656-159432678 CAAGGTCACACAGTAGCAGGTGG + Intergenic
1000409612 5:160924301-160924323 CAGGGGCACCCAGCTGAAGGTGG - Intergenic
1001253743 5:170168039-170168061 CAAGGTCACACCGCTGAAGGTGG + Intergenic
1001447692 5:171798540-171798562 CAGGGTCACACAGTAAGTGCTGG + Intergenic
1001966922 5:175916516-175916538 CAGGGTCACATACCTGAGGCAGG - Intergenic
1002070072 5:176673947-176673969 CAGGGTGTCAGAGCAGAAGTGGG + Intergenic
1002250023 5:177922690-177922712 CAGGGTCACATAGCTGAGGCAGG + Intergenic
1002328343 5:178424711-178424733 CAGGGTCTGACAGCACTAGCTGG + Intronic
1003850781 6:10220451-10220473 CCGGGCCACACAGCAGGAGGCGG - Intergenic
1004342065 6:14816679-14816701 CAAGGTCACCCAGCAGATGGAGG + Intergenic
1006802157 6:36766139-36766161 CAGGGTCCCACAGCAGGGTCAGG + Intronic
1007096096 6:39214218-39214240 CAGGCTCCCACAGCCGAGGCAGG - Intronic
1007097074 6:39219948-39219970 CAGGGGCACACAGCATAAACCGG + Intronic
1007241424 6:40428635-40428657 CAAGATCACACAGCAGAAAGAGG - Intronic
1007383782 6:41506953-41506975 CTGGGTCACACAGTAGAGGCTGG - Intergenic
1007420991 6:41719592-41719614 CAGGGTCACACGGCAGTTACTGG + Intronic
1007724720 6:43908257-43908279 CAAGGCCACACAGCAGAGCCAGG - Intergenic
1008252280 6:49254594-49254616 CAGGGTCACACAGGCAGAGCTGG - Intergenic
1008568475 6:52792452-52792474 CAATGTCAGACAGCAGGAGCCGG + Intronic
1008962222 6:57277562-57277584 CTTGGGAACACAGCAGAAGCCGG + Intergenic
1009426411 6:63518615-63518637 CAAGGTCACACAGCCCAACCAGG + Intergenic
1010090823 6:71979392-71979414 CAGGGTCACCCAGCAGGACAGGG + Intronic
1010436969 6:75842940-75842962 CTGGTTCACACTGCAGAAACAGG - Intronic
1011472216 6:87719063-87719085 CAGAATCAGACAGCAGAAACTGG + Intergenic
1011835582 6:91427223-91427245 CTAGGTCAGACAGCAGAAGTTGG + Intergenic
1012100767 6:95083741-95083763 CCAGGTCACACAGCAGCACCTGG - Intergenic
1014272115 6:119348016-119348038 AAGGGCCACACAGCTGAACCCGG + Intronic
1015758868 6:136635862-136635884 CCGGGTAACACAGCAAGAGCCGG + Intronic
1017014163 6:150086402-150086424 CAGGGTCACCCAGCAATAGTGGG - Intergenic
1017162025 6:151374204-151374226 CAGGAGCACACAGCAGGAGCTGG - Intronic
1017622057 6:156309219-156309241 GAGGAGCACAGAGCAGAAGCTGG + Intergenic
1017951321 6:159137393-159137415 CAGGGTGACATAGAAGATGCTGG + Intergenic
1018561748 6:165107203-165107225 CCGGGCCACACAGCAGGAGATGG - Intergenic
1018905911 6:168075817-168075839 CAGGGACACGCACCAGACGCTGG - Intronic
1019358788 7:594447-594469 GGGGGTGACACAGCAGAACCTGG - Intronic
1019567706 7:1692741-1692763 CTAGGTCACACAGCAGAGTCAGG - Intronic
1019639896 7:2097709-2097731 AAGAGACACACAGCAGCAGCAGG + Intronic
1020034483 7:4956741-4956763 CAAGGTCACACAGCAGGTGTGGG + Intronic
1020213780 7:6173490-6173512 CAGTGTCACACAGCATTAGCTGG + Intronic
1020945345 7:14599117-14599139 GAGGATAACACAGCAAAAGCTGG + Intronic
1021502440 7:21345799-21345821 CATGGACAGTCAGCAGAAGCAGG - Intergenic
1021971212 7:25967584-25967606 CCAGGTCACCCTGCAGAAGCTGG + Intergenic
1022429477 7:30302104-30302126 CATGGACACAGAGCAAAAGCAGG - Intronic
1022646093 7:32229729-32229751 CAAGGTCACACAGCTGGAGGTGG + Intronic
1022826066 7:34015224-34015246 CAAGGTCACACAGGAAAAGAGGG - Intronic
1023777838 7:43626350-43626372 CAGGTTCACACAGCAGGACTGGG - Exonic
1024063505 7:45715635-45715657 CATGGCCACACAGCTGAGGCAGG - Exonic
1025142763 7:56479346-56479368 CAGGGCCTCACAGGAGAGGCTGG - Intergenic
1025273540 7:57550960-57550982 CAGTGTCTCTCAGCAGATGCGGG - Intergenic
1025294331 7:57763549-57763571 TAGGGTCTCACAGGAGAAGGAGG - Intergenic
1025708817 7:63889946-63889968 CAGGGCCTCACAGGAGAGGCTGG - Intergenic
1026104751 7:67411920-67411942 AGGGGTCACACAGCAGCAGGGGG - Intergenic
1026444635 7:70473621-70473643 CAGGGCCACACAGACGTAGCAGG + Intronic
1026826771 7:73587372-73587394 GAGGCTCACACAGCAGGACCTGG + Intergenic
1026828808 7:73599589-73599611 CAGGGTCCCACTGCTGAAGAGGG + Exonic
1026946750 7:74321059-74321081 CAGGGTCACACAGCAGGAGCAGG - Intronic
1027853059 7:83473450-83473472 CAGGCTGACAGAGCATAAGCTGG - Intronic
1029598877 7:101552282-101552304 CAAGGCCACACAGTAGTAGCTGG + Intronic
1029616984 7:101665251-101665273 CAAGGCCACACAGCAGAGCCAGG + Intergenic
1030209381 7:106981256-106981278 GTGTGTCACACAGCAAAAGCAGG - Intergenic
1030536324 7:110771490-110771512 CAAGGTCACACAGCTGAAAGTGG - Intronic
1031215932 7:118891354-118891376 CAGGATAAAACAGCAGCAGCTGG - Intergenic
1031402639 7:121343972-121343994 CAAGGTCACACAGAAGGAACTGG + Intergenic
1031882081 7:127209245-127209267 CAGGGATACACAGCAGTGGCTGG + Intronic
1031970485 7:128061483-128061505 CTGGGTCCCACAGCAGAATGAGG + Intronic
1034160150 7:148987876-148987898 CAGGGACAAAAGGCAGAAGCAGG + Intergenic
1034291417 7:149935298-149935320 AAATGTCACACAGCAGAAGAGGG + Intergenic
1034479517 7:151308655-151308677 CTGGGTCACAGAGCCAAAGCAGG - Intergenic
1034814681 7:154161596-154161618 AAATGTCACACAGCAGAAGAGGG - Intronic
1035071525 7:156148383-156148405 CACGGTGACTCAGCAGATGCAGG - Intergenic
1035565404 8:637554-637576 CAGAGCCAGACAGCAGGAGCTGG - Intronic
1036487763 8:9195104-9195126 CAGGCCCCCACAGCAGAGGCGGG - Intergenic
1037685721 8:21137911-21137933 GAGGCTCACAATGCAGAAGCTGG - Intergenic
1037723447 8:21464301-21464323 CAGGATCACAGAGCAGAGGAGGG - Intergenic
1037912918 8:22754839-22754861 CAGGGCCACACAGCAGAGATGGG - Intronic
1038223199 8:25630346-25630368 CAGGGTCACACAGCTGATGGGGG - Intergenic
1038239899 8:25798719-25798741 CAGGGTCTCACAGGAAGAGCAGG - Intergenic
1039081883 8:33741560-33741582 CAGGGGCACAGAGCTGAACCAGG + Intergenic
1039231298 8:35451541-35451563 CAAGGTCACAGAGCAGTAGGTGG + Intronic
1039366287 8:36931664-36931686 CAGGGTCAAACTGCTGTAGCTGG - Intronic
1040609637 8:48970493-48970515 CAAGGTCACAAAGCAGAATTGGG + Intergenic
1042208598 8:66354107-66354129 CAGCCACACACAGCAGAAACTGG - Intergenic
1042384254 8:68154437-68154459 CAAAGTCACACAGCAGAAACTGG + Intronic
1045086088 8:98687467-98687489 CCGGGTCACACAGCTGGAGGTGG - Intronic
1045706891 8:104934317-104934339 CTGTGTGATACAGCAGAAGCTGG + Intronic
1046403731 8:113743734-113743756 CAGGGTCACACAGCCAAAAACGG - Intergenic
1047753432 8:127899771-127899793 CAGGCACACACAGCACAAGAGGG - Intergenic
1048057816 8:130885435-130885457 CAGGGTTACACAGCACGAGACGG + Intronic
1049070372 8:140351019-140351041 CAGGGCGAGAAAGCAGAAGCAGG + Intronic
1049142393 8:140967143-140967165 CAGGGTCACACAGCAAAGAAGGG + Intronic
1049337512 8:142094290-142094312 CAAGGTCACACAGCTGCAGGTGG - Intergenic
1049550219 8:143254081-143254103 GTGGGTCACACAGCAGGAGGTGG - Intronic
1049664732 8:143837855-143837877 CAGGGACACACAGGACATGCAGG + Intronic
1049850042 8:144826243-144826265 CAGGGTAACACAGGAGCAGGAGG - Intergenic
1049994751 9:1024565-1024587 CAAGGTCACACAGGGAAAGCTGG + Intergenic
1050241016 9:3635331-3635353 CAGAGTGGCACAGCAGAAGCAGG - Intergenic
1051193851 9:14542275-14542297 CAGCACCACACAGCAGGAGCAGG - Intergenic
1051295481 9:15590621-15590643 AAGGGTCACAAAGCTGAGGCTGG - Intronic
1051876975 9:21803239-21803261 CAGAGTCAGAGAGCGGAAGCTGG - Intronic
1052205550 9:25835368-25835390 CTGAGGCACACAGCAGAACCTGG - Intergenic
1052234912 9:26199545-26199567 GAGGTCCACACAGCAGATGCAGG - Intergenic
1052423028 9:28268370-28268392 CAGGGTCATGCAGAAGAACCTGG + Intronic
1053050088 9:34954214-34954236 CAGGGACCCACAGCAGCAGTGGG + Intergenic
1053303283 9:36966626-36966648 CTTGTTCACACAGCAGCAGCTGG - Exonic
1054162089 9:61680756-61680778 TAGGGTCCCACAGGAGAAGGAGG + Intergenic
1054455040 9:65426138-65426160 CAGGGACACACAGCAGGATGTGG - Intergenic
1055601623 9:77925038-77925060 GAGGGCCACCCAGCAGGAGCTGG - Intronic
1055963392 9:81842253-81842275 CAAGGTCACACAGCTAGAGCTGG + Intergenic
1056430936 9:86526967-86526989 CAGGTGCCCACAGCAGTAGCCGG + Intergenic
1056708793 9:88973272-88973294 CAGTGGCACCTAGCAGAAGCAGG - Intergenic
1057138958 9:92715351-92715373 CATGGCCATCCAGCAGAAGCTGG - Exonic
1057208933 9:93189126-93189148 AAGGGAGACACAGCAGAAACAGG - Intronic
1057892925 9:98882721-98882743 CAAGGTCACACAGCAGATGAGGG + Intergenic
1058680026 9:107432546-107432568 CAAGGTCACACAGCAGTAAGTGG - Intergenic
1059235855 9:112760253-112760275 CAGGGTCATTGAGCAGGAGCTGG + Intronic
1059301984 9:113321239-113321261 CACCTTCACACAGCAGGAGCTGG + Intronic
1059350526 9:113661303-113661325 CAATGTCACACAGCAGATGGCGG + Intergenic
1059422136 9:114198830-114198852 CAAGCTCACACAGCAGGAGAGGG - Intronic
1059499255 9:114737222-114737244 CCAGGTCACACAGCAGGAGCTGG - Intergenic
1059703682 9:116800177-116800199 CAGAGACAGACAGCAGAAGGCGG - Intronic
1059712234 9:116879136-116879158 CAGGTACACACAGCAGAGGGAGG - Intronic
1060348609 9:122838119-122838141 CAGTGTCACTCAGCTGCAGCTGG + Intergenic
1060409637 9:123391471-123391493 CAGGGTCACACAGCAGCTAAAGG + Intronic
1060722725 9:125989439-125989461 CGAGGCCACACAGCAGAAGGTGG - Intergenic
1060803736 9:126562103-126562125 CAGGGTCCCACAGCAGAGAAAGG + Intergenic
1060932268 9:127496675-127496697 CAAGGTCACACAGCAGAGTGAGG + Intronic
1061054728 9:128216320-128216342 CAAGGTCACACAGCAGAGTGGGG - Intronic
1061149240 9:128819512-128819534 CAGTGTCACACAGCAGAAGAAGG + Intronic
1061411166 9:130422511-130422533 CCGGGGCCCACAGCACAAGCAGG - Intronic
1061487754 9:130928934-130928956 CATGGTCTCAGAGCCGAAGCTGG + Intronic
1061712615 9:132498491-132498513 CAGGGTCACACAGCAGAAGCGGG - Intronic
1061895092 9:133643036-133643058 CAGAGTCACACAGCAGGAAGAGG + Intronic
1061898424 9:133660590-133660612 CAGGGTCACACAGCAGGGGCAGG - Intergenic
1062114854 9:134802885-134802907 CAGGGTCCCACGGGAGAAACGGG + Exonic
1203516713 Un_GL000213v1:8046-8068 CAAGGCCACAGAGCAGCAGCAGG + Intergenic
1186332428 X:8548992-8549014 CTGGGCCACAAAGGAGAAGCTGG - Intronic
1188378822 X:29466710-29466732 CAGAGTTACACAGCAGTTGCTGG + Intronic
1189375454 X:40463017-40463039 CAGGCAGACACAGCAGGAGCTGG + Intergenic
1190797272 X:53757479-53757501 CAGGGACACACAGCAGCAGCTGG - Intergenic
1190913070 X:54789617-54789639 CAGGGACACACAGCAGCAGCTGG - Intronic
1190917874 X:54823692-54823714 CAGGGACACACAGCAGCAGCGGG + Intergenic
1193660660 X:84253585-84253607 CAAGGTCACACAGCAGGAATGGG + Intergenic
1195705438 X:107734958-107734980 CAAGGTCACACAGCTAGAGCTGG + Intronic
1196799671 X:119531320-119531342 AAGGACCACCCAGCAGAAGCAGG - Intergenic
1198206329 X:134468500-134468522 CAGCCTCACAAAGCAGTAGCTGG - Intronic
1199430126 X:147749337-147749359 GAGGAAAACACAGCAGAAGCTGG - Intergenic