ID: 1061713120

View in Genome Browser
Species Human (GRCh38)
Location 9:132501265-132501287
Sequence GCTTCTTCCTCACCTGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061713119_1061713120 -9 Left 1061713119 9:132501251-132501273 CCATTCTCTGAGAAGCTTCTTCC 0: 1
1: 0
2: 3
3: 29
4: 348
Right 1061713120 9:132501265-132501287 GCTTCTTCCTCACCTGCAAATGG No data
1061713118_1061713120 4 Left 1061713118 9:132501238-132501260 CCTGATTTTGGCTCCATTCTCTG 0: 1
1: 0
2: 1
3: 19
4: 229
Right 1061713120 9:132501265-132501287 GCTTCTTCCTCACCTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061713120 Original CRISPR GCTTCTTCCTCACCTGCAAA TGG Intronic
No off target data available for this crispr