ID: 1061713245

View in Genome Browser
Species Human (GRCh38)
Location 9:132502052-132502074
Sequence GCAAGAAGTCCGCTACTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061713245_1061713246 -1 Left 1061713245 9:132502052-132502074 CCAGACAGTAGCGGACTTCTTGC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1061713246 9:132502074-132502096 CAATCCGAAGCCCCGTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061713245 Original CRISPR GCAAGAAGTCCGCTACTGTC TGG (reversed) Intronic
902360901 1:15942118-15942140 GATAGAAGTCCGCGTCTGTCTGG + Exonic
923618199 1:235555214-235555236 CCAAGGTGTCCTCTACTGTCTGG - Intronic
1063999854 10:11654356-11654378 GAAAGAAGTCCTCTCGTGTCAGG + Intergenic
1073651647 10:105366797-105366819 AGCAGAAGTCTGCTACTGTCGGG - Intergenic
1080012250 11:27471708-27471730 GCAGGAGTTCCGCTACTGGCGGG - Intronic
1086218764 11:84415739-84415761 GCCAGAAGTCCATTTCTGTCTGG - Intronic
1086903336 11:92391946-92391968 CCAAGAGGTGCACTACTGTCTGG + Intronic
1091134531 11:133176871-133176893 GCAAGAACTCTGCAGCTGTCCGG + Intronic
1093858916 12:24139369-24139391 ACAAGAAGCCCATTACTGTCTGG + Intergenic
1096357308 12:50952240-50952262 GGCATAAGTCTGCTACTGTCAGG + Intergenic
1122663202 14:103311559-103311581 CCAAGAAGTCCCCCGCTGTCTGG + Intergenic
1128768032 15:70262956-70262978 GCAGGATGTCCACTTCTGTCAGG + Intergenic
1143421493 17:6796587-6796609 GCAAACAGTCCTCTACTGGCGGG - Intronic
1167979205 19:53258765-53258787 CCAAGGAGTCAGCTACAGTCAGG - Exonic
927231785 2:20831044-20831066 GCATGAAGTCTGCTACTCTTTGG + Intergenic
929789482 2:45012848-45012870 GCCAGAAGGCACCTACTGTCCGG + Intergenic
939095688 2:137830856-137830878 GCAAGAAAACAGCTACTGTCTGG - Intergenic
947873778 2:233454929-233454951 TCCAGAAATCTGCTACTGTCTGG - Intronic
948730194 2:239958267-239958289 GCAAGCAGGCGGCTACTTTCTGG - Exonic
1169351887 20:4874556-4874578 GGAAGAAGTCAGCTACTCACAGG + Exonic
1180228260 21:46411353-46411375 GCACGAAGTCAGCGACAGTCAGG + Exonic
1184123636 22:42471337-42471359 GCAAGAAGTCTCCTGTTGTCTGG + Intergenic
952929364 3:38347278-38347300 GAAGGAAGTCAGCTACTGTAAGG + Intronic
956992585 3:74784451-74784473 GCAAGAAGTCAGCACCTGTTTGG + Intergenic
961770183 3:129243856-129243878 GCAAGAAGTCACCTGCAGTCAGG - Intergenic
965310503 3:167121590-167121612 GCAACAATTCTGCTATTGTCAGG + Intergenic
984223005 4:177001115-177001137 GCAAAATGTCCGATACAGTCGGG + Intergenic
989371710 5:40717448-40717470 ACAAGAACTCCACTACAGTCTGG + Intronic
991275310 5:64840217-64840239 GCAGTAATTCCTCTACTGTCTGG - Intronic
1006449270 6:34096642-34096664 GCAAAAAGTGCTCCACTGTCTGG + Intronic
1008927751 6:56905132-56905154 GATAGAAGTCCACTACTGACAGG - Intronic
1023856740 7:44188751-44188773 GCAGGAAGGCCCCTACTGCCTGG - Intronic
1030886554 7:114945396-114945418 GCAGGTAGTCCGCTAAGGTCAGG - Intronic
1034753913 7:153596499-153596521 GCAAGGAGTAAGCTTCTGTCTGG + Intergenic
1034852206 7:154504297-154504319 GCATGAAGACAGTTACTGTCTGG + Intronic
1042357667 8:67846815-67846837 GCAACAAGTCCTCTCCTGTAGGG + Intergenic
1046275120 8:111949042-111949064 GCAAGAAGTAGGCTACTAACAGG + Intergenic
1046758085 8:117991942-117991964 GCAAGAAGTCTACTACCATCAGG + Intronic
1048986923 8:139739654-139739676 GCAGGAAGCCCTCTACTGTGTGG - Intronic
1049088601 8:140496462-140496484 GCAGGAAGTGCGCTTCTGTCTGG + Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1060035667 9:120253414-120253436 GGAAGATGTCAGCTACTCTCAGG - Intergenic
1061713245 9:132502052-132502074 GCAAGAAGTCCGCTACTGTCTGG - Intronic
1185755311 X:2648703-2648725 GCAAGAAGTCAGATAAAGTCTGG - Intergenic
1186051253 X:5598159-5598181 GCAAGGAGTCTGCAATTGTCCGG + Intergenic
1186720850 X:12301965-12301987 GCAAGAAGTACTCTGCTGTGTGG - Intronic
1199922317 X:152420633-152420655 CCAAGAGGTCCTTTACTGTCTGG + Intronic