ID: 1061714187

View in Genome Browser
Species Human (GRCh38)
Location 9:132508724-132508746
Sequence GACGCAGCGGTCACTCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061714187 Original CRISPR GACGCAGCGGTCACTCAGTG GGG (reversed) Intronic
900176349 1:1293074-1293096 GATGCTGGGGTCACTAAGTGAGG + Exonic
904367009 1:30018945-30018967 AACTCAGAGGTCACTCACTGGGG - Intergenic
904984275 1:34532055-34532077 TATGCAGCGGTCCCTCACTGTGG - Intergenic
910449981 1:87334957-87334979 GACGCAGCTCTCATTCATTGCGG - Intronic
923093761 1:230758839-230758861 GACACAGCCCACACTCAGTGTGG + Intronic
924875435 1:248097925-248097947 GATGCAGTAGTCACTGAGTGAGG - Intronic
1067550228 10:47229223-47229245 GACCCAGCGGCCACTCCATGTGG - Intergenic
1067762499 10:49058739-49058761 GAGGCTGCGGTCACTGAATGAGG - Intronic
1068462926 10:57350944-57350966 GCAGGAGTGGTCACTCAGTGTGG + Intergenic
1070983330 10:80667343-80667365 CACTCAGCGGTCACACAGCGGGG - Intergenic
1073072933 10:100806178-100806200 GATGGAGCGGTCACACTGTGGGG - Intronic
1076056476 10:127377935-127377957 GACGCAGCAGTCACTCTGCTTGG + Intronic
1076686906 10:132202296-132202318 GATGCAGCGGCCACGCAGCGAGG - Intronic
1083305218 11:61758415-61758437 GACACTGAGTTCACTCAGTGGGG + Intronic
1089390163 11:118096270-118096292 GACACAGAGGCCACGCAGTGGGG - Intronic
1096818828 12:54218166-54218188 GATCCAGCGGTTACTCAGGGAGG - Intergenic
1123951760 15:25285464-25285486 GACTCAGAGCTCACTCAGTAAGG + Intergenic
1130905825 15:88240378-88240400 GACGCAGGGGACATTCTGTGAGG + Intronic
1132679141 16:1132618-1132640 GACGCAGAGGGGACTCAGTGGGG + Intergenic
1141627348 16:85268359-85268381 CTCGGCGCGGTCACTCAGTGGGG - Intergenic
1142477722 17:199477-199499 CACGCCGCGGTCAGGCAGTGTGG + Intergenic
1142848764 17:2694426-2694448 GACGCAGCGGGGACACAGCGGGG + Intronic
1143493451 17:7296871-7296893 GCTGCAGCGGTCACACTGTGAGG - Intergenic
1143585802 17:7849558-7849580 GAAGCTGCGCTCACTTAGTGAGG + Exonic
1148856252 17:50580695-50580717 GACACTGCTGTCACTGAGTGAGG - Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1161767580 19:6215955-6215977 GGGGCAGCGGACACCCAGTGTGG - Intronic
1164683565 19:30151920-30151942 GATGCAGCTGTCCCTGAGTGTGG + Intergenic
1165435712 19:35793580-35793602 CACCCAGCTGTGACTCAGTGTGG + Intergenic
1166528757 19:43529803-43529825 GACCCAGAGGTGACTCAGTCTGG + Intronic
927856438 2:26530520-26530542 GAAGCTGCTGTGACTCAGTGAGG - Intronic
928950356 2:36808302-36808324 CACCCAGCGGCCACTCACTGAGG - Intronic
937871240 2:126787819-126787841 GATGCAGCTGTCATTCAGAGTGG - Intergenic
942729329 2:179046446-179046468 GTGGCAACGGTCACTGAGTGGGG - Intronic
948920750 2:241064838-241064860 GAAGCAGGGGTCACTCACTGAGG - Exonic
1174282632 20:49450268-49450290 AACTCAGCAGTCACTGAGTGGGG - Intronic
1178229444 21:30764440-30764462 GTGGCAGCAGTCACTGAGTGAGG - Intergenic
1185241530 22:49749982-49750004 GAGGCAGCGCCCACTCCGTGGGG + Intergenic
1185259383 22:49853395-49853417 GGCGCAGAGGCCGCTCAGTGCGG - Intergenic
953061017 3:39428980-39429002 GACGCAGCGGCCCGTCGGTGAGG + Intergenic
954529645 3:51307934-51307956 GACTCAGAGCTCACTCAGTGAGG - Intronic
954865643 3:53727264-53727286 GTCCCAGAGGTCACTCAGTTTGG + Intronic
959557697 3:107740803-107740825 GAGGCAGCCTTCACTCTGTGTGG - Intronic
963762000 3:149293863-149293885 AAGGCAGCTGTCACTCAGGGGGG + Intergenic
966371962 3:179260148-179260170 GAGGCAGCGGTGACTCAGGTTGG - Intronic
972485212 4:39534080-39534102 GCCGCAGCGGGGACTCTGTGTGG - Intergenic
975225286 4:71864536-71864558 GACTCAGTGGTCACACATTGTGG - Intergenic
981595440 4:146416190-146416212 GGCACAGCAGTCACTTAGTGTGG + Intronic
982471329 4:155794036-155794058 GACCTAGTGGTCACTCAGTGTGG + Exonic
984098119 4:175456362-175456384 GACTCAGTGGTGACTCACTGTGG - Intergenic
985422721 4:189800669-189800691 GACGCAGCTGTAACTCAGCTCGG - Intergenic
985640397 5:1060957-1060979 GACGCAGCAGTCCCACACTGTGG - Intronic
997271501 5:132542807-132542829 CACGCACCTCTCACTCAGTGTGG + Intronic
1015852959 6:137593481-137593503 GTCCCAGTGGTGACTCAGTGTGG + Intergenic
1024294336 7:47830713-47830735 GACCCCAGGGTCACTCAGTGTGG - Intronic
1027352092 7:77322338-77322360 GACTCAGCAGTCACTGATTGAGG - Intronic
1034894556 7:154867943-154867965 GATGCAGTGGTCACTCATGGAGG - Intronic
1038157212 8:25001426-25001448 GACGCTGCGGTCACCCAGTCCGG + Intergenic
1041430697 8:57777909-57777931 GACGCAGTGGAAACTCTGTGTGG - Intergenic
1047099590 8:121661906-121661928 GACACAGCAGTGACTGAGTGTGG - Intergenic
1061544001 9:131293417-131293439 GACCCCGAGGTCACTCTGTGGGG + Intronic
1061714187 9:132508724-132508746 GACGCAGCGGTCACTCAGTGGGG - Intronic
1199287205 X:146066845-146066867 GAGTCAGCTGTGACTCAGTGGGG + Intergenic