ID: 1061714232

View in Genome Browser
Species Human (GRCh38)
Location 9:132508996-132509018
Sequence GCCACTGGCACCAACGTGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061714232_1061714238 11 Left 1061714232 9:132508996-132509018 CCGTTCACGTTGGTGCCAGTGGC 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1061714238 9:132509030-132509052 GTGAGTCCTCAGCAGCGAGATGG No data
1061714232_1061714239 14 Left 1061714232 9:132508996-132509018 CCGTTCACGTTGGTGCCAGTGGC 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1061714239 9:132509033-132509055 AGTCCTCAGCAGCGAGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061714232 Original CRISPR GCCACTGGCACCAACGTGAA CGG (reversed) Intronic
900824208 1:4913361-4913383 GCTGCTGGCTCCAAGGTGAATGG - Intergenic
902699383 1:18161225-18161247 TCCACTGGCATGAACGAGAAGGG + Intronic
904534154 1:31188209-31188231 GCCACTGTCACCCCCCTGAAAGG + Intronic
905284071 1:36868010-36868032 GCCAATGGCATTAACGTGGAAGG - Intronic
909743895 1:79068319-79068341 CCCACTGGCACCAAAGAAAAAGG - Intergenic
910246282 1:85142018-85142040 GCCACTTGCATCAACATGGATGG + Intergenic
915512253 1:156392732-156392754 GCCACTGACACCAGTGTGCAGGG + Intergenic
920568638 1:206998511-206998533 GTCACAGGCATCCACGTGAATGG + Intergenic
920766922 1:208842299-208842321 GCCACTGGCACCAATGCCAATGG + Intergenic
922549847 1:226485989-226486011 GTCATTGGCAGCAACATGAATGG - Intergenic
922771619 1:228187367-228187389 GTCACTAGCAGCAACATGAATGG - Intergenic
924858344 1:247896565-247896587 GCCACTGGCAGCATCTGGAACGG + Intergenic
1064838555 10:19562755-19562777 GCCACTGCCACCAATCTGACAGG - Intronic
1065853440 10:29810705-29810727 GACACAGACACCAACATGAAAGG - Intergenic
1068295515 10:55067381-55067403 GTCACTTGCAGCAACGTGAATGG - Intronic
1074541406 10:114368147-114368169 GCCATTGGCAACAACATGGATGG + Intronic
1081912241 11:46707176-46707198 GCTACTGGGACCAACATGGATGG + Intergenic
1082245458 11:49916846-49916868 GCCATTTGCAGCAACGTGGATGG - Intergenic
1084169129 11:67392057-67392079 GTCACGGGCGGCAACGTGAAGGG + Exonic
1086616917 11:88831916-88831938 TTCACTGGCACCAATGTTAACGG - Intronic
1088037385 11:105334175-105334197 GCCACTGGCTGCAACATGAGTGG - Intergenic
1092325534 12:7527609-7527631 GCCACTGGCACCAGTGAGATGGG - Intergenic
1096036010 12:48471248-48471270 GTCACTTGCAACAACATGAATGG - Intergenic
1096291761 12:50349614-50349636 GCCATTTGCAACAACATGAATGG - Intronic
1098556136 12:71821049-71821071 GCCATTTGCAACAACATGAATGG - Intergenic
1099115620 12:78620657-78620679 GCCACTTGCAGCAACATGGATGG + Intergenic
1099808616 12:87551960-87551982 GTCACTGGCAACAACGTGGATGG + Intergenic
1100253528 12:92858066-92858088 GCCACCAACACCAACATGAACGG + Intronic
1100560139 12:95740108-95740130 GCCACAGACACAAAAGTGAACGG + Intronic
1103905017 12:124322660-124322682 GCCACTGGCACCAAGGGACAAGG + Intergenic
1104848829 12:131861353-131861375 CCTACTGGCACATACGTGAATGG + Intergenic
1105688500 13:22811236-22811258 GGCACAGGCACCAGCTTGAAGGG + Intergenic
1106138430 13:26991552-26991574 GGAACTGGCACAAAAGTGAATGG + Intergenic
1107953683 13:45488065-45488087 GTCATTTGCAGCAACGTGAATGG + Intronic
1110625890 13:77655104-77655126 GTCACTTGCAACAACATGAATGG - Intergenic
1113208986 13:107952700-107952722 GTCATTTGCACCAACATGAATGG + Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1122928205 14:104919698-104919720 GTCATTTGCAGCAACGTGAATGG - Intergenic
1202842093 14_GL000009v2_random:131282-131304 GTCACTTGCAACAACGTGGATGG + Intergenic
1202911482 14_GL000194v1_random:121515-121537 GTCACTTGCAACAACGTGGATGG + Intergenic
1126222301 15:46228414-46228436 GCCATTTGCAACAACATGAATGG + Intergenic
1127155270 15:56117777-56117799 GTCACTTGCAGCAACATGAATGG - Intronic
1130920834 15:88343196-88343218 GCCACTGGGACCAAGGAGGATGG + Intergenic
1132230419 15:100179362-100179384 GTCACTTGCAACAACGTGGATGG - Intronic
1132997316 16:2830028-2830050 AGCACTGGCACCGACTTGAATGG - Intergenic
1135168138 16:20158410-20158432 GCCACTGTCTCCAACGCGGATGG + Intergenic
1137693161 16:50443439-50443461 GTCACTTGCAACAACGTGGATGG - Intergenic
1139044755 16:63043087-63043109 GCCATTTGCATCAACATGAATGG - Intergenic
1140543331 16:75780714-75780736 GTCACTTGCAGCAACATGAATGG + Intergenic
1140846350 16:78892419-78892441 GTCTCTTGCACCAACATGAAAGG - Intronic
1141837633 16:86553246-86553268 GCAACTAGCACCACCTTGAAAGG + Intronic
1145358535 17:22187630-22187652 GTCATTTGCAACAACGTGAATGG - Intergenic
1146649225 17:34596490-34596512 GGCACTGGGACCAAGCTGAATGG - Intronic
1148723010 17:49768331-49768353 GCCACAGGAACCAACAAGAATGG + Intronic
1152152910 17:78614072-78614094 GCCACTGCCAGCAACCTGCATGG - Intergenic
1154411822 18:14145830-14145852 GCCACTGTCACCAAGGTTGATGG - Intergenic
1155328781 18:24693031-24693053 CCCAATGGCAACAACATGAATGG + Intergenic
1157725027 18:49957757-49957779 GCCACTGGCACCAACCTTCCTGG + Intronic
1158152731 18:54390572-54390594 GCCACTGGGCCCAGCCTGAAGGG + Intergenic
1158915418 18:62121670-62121692 GTCACTGGCAGCAACATGAGTGG - Intronic
1162945758 19:14042513-14042535 GCCACTGGCTACAAAGTGTATGG + Exonic
1164051241 19:21586969-21586991 GCCACTGCGGTCAACGTGAAGGG - Intergenic
1164301555 19:23966756-23966778 GCCTCTGGCAGCAAGGTGGAAGG + Intergenic
1164965517 19:32479750-32479772 GGCACTGGTATGAACGTGAAGGG + Intronic
1165507936 19:36246355-36246377 GCCACTTGTAACCACGTGAATGG + Intergenic
1167983024 19:53291534-53291556 GCCACTTGCAACAACGTAGATGG - Exonic
925896874 2:8479031-8479053 GCTAGTGGCACCATCGTGGAGGG - Intergenic
928169910 2:28996842-28996864 GCCACTTGCAGCAACATGGATGG - Intronic
932604106 2:73152605-73152627 GACACAGGAACCAACTTGAAGGG + Intronic
933080960 2:77985331-77985353 GTCAGTGGCAGCAACATGAATGG + Intergenic
933891822 2:86778913-86778935 GCCACTAGCTCCAACCTGACTGG - Intergenic
934555953 2:95287154-95287176 GCCAATGTCACCTACCTGAAAGG + Exonic
935712514 2:105911988-105912010 TCCACTGTCACCAATGTGGATGG + Intergenic
936756376 2:115717742-115717764 GCAACTGGAAGCCACGTGAATGG + Intronic
936988469 2:118335522-118335544 GACATTTGCAACAACGTGAATGG - Intergenic
937815895 2:126250568-126250590 GCCACTGTTACAAAAGTGAAAGG - Intergenic
940379959 2:153002796-153002818 GTCATTTGCACCAACGTGCATGG + Intergenic
1172760825 20:37320360-37320382 GCCATTTGCAACAACATGAATGG - Intergenic
1174189542 20:48730346-48730368 GCCACGAGCTCCAACGTGAAGGG + Intronic
1174784031 20:53416072-53416094 TGCTCTGGCACCCACGTGAAGGG + Intronic
1176630841 21:9136184-9136206 GTCACTTGCAACAACGTGGATGG + Intergenic
1178295725 21:31408636-31408658 GACACTCTCATCAACGTGAATGG + Intronic
1183131888 22:35845084-35845106 GCCTCTGACACCCAAGTGAAAGG + Intronic
1185340627 22:50289338-50289360 GGGACTGGCGCCAGCGTGAATGG + Intronic
950004854 3:9685105-9685127 GTCACTGGCACCAGCGTGGCAGG - Intronic
958516606 3:95124570-95124592 CCCACTGGCACAAAGGTCAAAGG + Intergenic
959347438 3:105216951-105216973 TCCACTGTCACCAATGTGAGTGG + Intergenic
960117009 3:113905219-113905241 GCCAAAGGAACCAACTTGAAGGG - Intronic
963386409 3:144599948-144599970 GCCACTGCACCCAACCTGAATGG - Intergenic
965664140 3:171074204-171074226 GCCCTTGGCAGCAACGTGGATGG + Intronic
965762628 3:172095410-172095432 GCCACTGGGCCCAAAGTGAAGGG + Intronic
970601431 4:17643560-17643582 GCCACTGGTACCAATGGGAGGGG - Intronic
972281509 4:37606307-37606329 GACATGGGCACCAACCTGAAAGG + Intronic
978669739 4:111232483-111232505 TCCACTCTCACCAATGTGAATGG + Intergenic
981441208 4:144784404-144784426 GCCATTTGCAGCAACATGAATGG + Intergenic
981880915 4:149611521-149611543 GTCACTTGCAACAACATGAATGG + Intergenic
988214217 5:28250374-28250396 GTCACTTACAACAACGTGAATGG + Intergenic
990055906 5:51577754-51577776 ACCATTTGCAGCAACGTGAATGG + Intergenic
991316847 5:65318567-65318589 GCCATTTGCAACAACGTGGATGG + Intronic
994842667 5:104946568-104946590 GCCATTTGCAACAACATGAATGG - Intergenic
997290420 5:132728968-132728990 GGCACTGGCAGCAACCTGGATGG + Intronic
998742093 5:145215617-145215639 GGCACTTGCAGCAACCTGAATGG + Intergenic
998880257 5:146638195-146638217 GCCACTGGCCCCAATGTGCTGGG - Intronic
1003346472 6:5272957-5272979 GCCATTTGCAGCAACATGAATGG - Intronic
1010548497 6:77189571-77189593 GTCACTTGCAACAACGTGGATGG + Intergenic
1010561179 6:77352669-77352691 GCCACTTGCAACAACGTAGATGG - Intergenic
1012357057 6:98327633-98327655 GCCATTTGCAGCAACCTGAATGG - Intergenic
1014780858 6:125562973-125562995 GCCACTGACACCAACTTCTATGG - Intergenic
1016799864 6:148157616-148157638 GCCACTGGCTCTCACGTGCATGG + Intergenic
1020500885 7:8918707-8918729 GGCACTGTCACCAAAGTGAGAGG - Intergenic
1022756792 7:33301570-33301592 GCCATTTGCAACAACATGAATGG - Intronic
1027406662 7:77869546-77869568 GCCATTTGCAGCAACGTGGATGG - Intronic
1029270434 7:99374269-99374291 CCCACCGGCATCAGCGTGAAGGG + Intronic
1029605852 7:101599018-101599040 GCCACTGGCACCCTGGTGGAAGG + Intergenic
1030692228 7:112547378-112547400 GCCACTGGCCGCAACCTGAGCGG + Intergenic
1030910974 7:115248482-115248504 GACACAGGAACCAACCTGAAAGG - Intergenic
1031372133 7:120981245-120981267 GTCTTTTGCACCAACGTGAATGG - Intergenic
1032019868 7:128401363-128401385 ACCACTGGCAACAAGGTGACTGG + Intronic
1035392221 7:158512134-158512156 GCCACTGACACCAACGGGGCAGG + Intronic
1037034656 8:14150862-14150884 GTCACTTGCATCAACGTGGATGG + Intronic
1038137511 8:24803973-24803995 GCCACAGCCAGCAATGTGAATGG + Intergenic
1046438794 8:114231105-114231127 CCCACTGGTACCAAAGTGACTGG + Intergenic
1046784063 8:118247096-118247118 GTCACTTGCAACAACGTGGATGG + Intronic
1049694980 8:143978910-143978932 GCCCCTGGCACCCACGTGCCAGG + Intronic
1050950825 9:11590411-11590433 GGCACTGGCAGCAACCTGTATGG + Intergenic
1052759268 9:32573064-32573086 GCCGCTGGTACCAACGCAAAAGG + Exonic
1057241061 9:93409738-93409760 GTCACTTGCAACAACGTGGATGG - Intergenic
1057950630 9:99366513-99366535 GCCACTGGGACCAAGATGCAGGG + Intergenic
1059731833 9:117064491-117064513 GCCTTTGGCAGCAACGTAAATGG + Intronic
1060380470 9:123165450-123165472 CACACTGGCACCAATATGAAGGG + Intronic
1061714232 9:132508996-132509018 GCCACTGGCACCAACGTGAACGG - Intronic
1061995001 9:134178716-134178738 GCCAGTGGCACCAAACTGAAAGG - Intergenic
1203753671 Un_GL000218v1:103886-103908 GTCACTTGCAACAACGTGGATGG + Intergenic
1187744615 X:22394983-22395005 GGCATTTGCAGCAACGTGAATGG + Intergenic
1188220223 X:27532343-27532365 GACACAGGCACCAATCTGAAAGG + Intergenic
1188715327 X:33453075-33453097 GTCATTTGCAGCAACGTGAATGG + Intergenic
1188788254 X:34375685-34375707 GTCATTTGCACCAACGTGGATGG + Intergenic
1190918913 X:54831508-54831530 GCCATTTGCAACAACATGAATGG - Intergenic
1192275146 X:69621704-69621726 GCCACAAGCAACAACCTGAATGG - Intronic
1192589098 X:72345125-72345147 CCCAATGGCACCAACATGAGGGG + Intronic
1193176048 X:78394502-78394524 GCCATTTGCAACAACGTGGATGG + Intergenic
1193327603 X:80198929-80198951 GCCATTTGCGACAACGTGAATGG - Intergenic
1193475653 X:81962156-81962178 GCCATTTGCAGCAATGTGAATGG + Intergenic
1193664993 X:84305306-84305328 GTCATTTGCAACAACGTGAATGG + Intergenic
1194257406 X:91652090-91652112 ACCACTGTCACCACCGTGACTGG + Intergenic
1194449229 X:94022683-94022705 GTCATTTGCAGCAACGTGAATGG + Intergenic
1194514567 X:94835803-94835825 GTCACTTGCAACAACATGAATGG - Intergenic
1195397140 X:104423674-104423696 GCCACATGCATCAACATGAAAGG - Intergenic
1198798864 X:140429401-140429423 GTCACTTGCAACAACGTGGATGG + Intergenic
1199424738 X:147688003-147688025 GGCACTGGCAGCAACCTGGATGG + Intergenic
1201167314 Y:11221445-11221467 GTCACTTGCAACAACGTGGATGG + Intergenic