ID: 1061714983

View in Genome Browser
Species Human (GRCh38)
Location 9:132513442-132513464
Sequence GTCCTCAGGGAAGACGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061714983_1061714991 -9 Left 1061714983 9:132513442-132513464 CCCTCCCCGTCTTCCCTGAGGAC 0: 1
1: 0
2: 1
3: 28
4: 292
Right 1061714991 9:132513456-132513478 CCTGAGGACCCTCCCGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061714983 Original CRISPR GTCCTCAGGGAAGACGGGGA GGG (reversed) Intronic
900585252 1:3429516-3429538 GTCCTCAGAGTGGACAGGGAGGG + Intronic
900960347 1:5915117-5915139 GTCCTGAGGGAGGAGGGAGAGGG + Intronic
901741374 1:11344182-11344204 GTCCTCAGGGAGGCAGGTGAGGG + Intergenic
901773178 1:11541414-11541436 TTACTCAGGGAAGGCAGGGAGGG - Intergenic
904437340 1:30507373-30507395 GTCCGGAGGGAGGACGGTGATGG + Intergenic
904829886 1:33299773-33299795 GTCTTCAGGGCAGCAGGGGAGGG - Exonic
905286193 1:36881996-36882018 GGCCTCAAGGAGGAGGGGGAGGG - Intronic
905394840 1:37660620-37660642 GAGCCCAGGGAAGAAGGGGAGGG + Intergenic
906202101 1:43966874-43966896 GTCCTCAGGGAGAGCTGGGAAGG + Intronic
906274986 1:44508669-44508691 GTTCTCAGGGAAAATGGAGAAGG - Intronic
907736830 1:57121415-57121437 GGCATCAGGGAAGTGGGGGAAGG + Intronic
908794505 1:67817681-67817703 GTCCTTAGGGAAGAAAGGGAAGG + Intronic
910291468 1:85603975-85603997 GCACTCAGGGAAGACCTGGAGGG - Intergenic
912616169 1:111102174-111102196 GTTGTCAGGGAAGTGGGGGAAGG + Intergenic
914000912 1:143693460-143693482 GACTTCAGGGAAGAAGGGCAGGG - Intergenic
914834955 1:151199074-151199096 GTCCTCAGGTAAGCCCGGCAGGG + Exonic
914967947 1:152277893-152277915 GTTGTCAGGAAAGTCGGGGAAGG - Intergenic
917450837 1:175146120-175146142 GCCCCCAGGGAAGCTGGGGAGGG + Intronic
918660353 1:187080561-187080583 GTCTTCATGGAAAACAGGGAAGG - Intergenic
920045310 1:203128758-203128780 GTGGTCAGGGAAGCCTGGGATGG - Intronic
922706982 1:227795228-227795250 CTCCTGAGGGAAGGCGGGGCTGG - Intergenic
922706996 1:227795260-227795282 CTCCTGAGGGAAGCCGGGGGTGG - Intergenic
924595621 1:245442479-245442501 GTCCTCAGGGAAACTGGGAAGGG + Intronic
1063603780 10:7505735-7505757 GTCCGGAGAGAAGAAGGGGAAGG - Intergenic
1063881869 10:10539924-10539946 GTGCTCAGGGAAGACTGCCAGGG + Intergenic
1065655283 10:27941987-27942009 GGCCCCAGGAAAGACGGGGATGG + Intronic
1068468821 10:57433508-57433530 CTCCTCATGGCAGAAGGGGAAGG - Intergenic
1070340700 10:75495597-75495619 GCCCGCAGGCAAGAAGGGGAGGG - Intronic
1070529957 10:77327982-77328004 GTCCTCAGGGTGGAAAGGGAGGG - Intronic
1070565785 10:77602972-77602994 CTTCTCAGGGAAGCCGGGGCTGG + Intronic
1071304713 10:84288585-84288607 GTCCTCAGGGCAGGCTGGGAAGG - Intergenic
1072446212 10:95500980-95501002 GTCCTTAAGGAAGGCGGGGAAGG - Intronic
1074226269 10:111487616-111487638 GTTTGCAGGGAAGATGGGGATGG - Intergenic
1075810740 10:125222890-125222912 TCCCTCAGGGAGGACAGGGATGG - Intergenic
1076364975 10:129915896-129915918 GGCCCCTGGGGAGACGGGGAGGG + Intronic
1076669263 10:132110777-132110799 GTTCCCAGTGAAGAAGGGGAGGG + Intronic
1076752517 10:132550730-132550752 GACCTCATGGAAGACGGTGGAGG + Intronic
1077233618 11:1469557-1469579 GTCCTCAGGCAAGGCCAGGACGG - Intronic
1077266798 11:1654938-1654960 CTCCTCAAGGAAGAAGGGGACGG - Intergenic
1077278966 11:1733394-1733416 GTGCTCAGGGAAGAGGGGAGGGG - Exonic
1077319612 11:1935385-1935407 TTCCTCAGGGCAGACAGAGAGGG + Intronic
1077430197 11:2512495-2512517 GTCTTGAGGGAAGACTGGGAGGG - Intronic
1077459179 11:2700262-2700284 GTGCTCAGGGACGACGGGTGGGG - Intronic
1077793113 11:5462361-5462383 GAACTCAGGGAAGAGGGGAAAGG + Intronic
1078455425 11:11471010-11471032 GTCCTGAGGAAAGGCAGGGAAGG - Intronic
1078552869 11:12292491-12292513 GTCCTCAGGGATGGCTGTGAAGG - Intronic
1080418828 11:32092605-32092627 TTCCTCAGGGGACCCGGGGAGGG - Intronic
1081612086 11:44568777-44568799 GTCCCCAGGGTGGAAGGGGATGG - Intronic
1081806225 11:45892247-45892269 GTCCTCTGGGAAGACGGTGCTGG - Intronic
1083063562 11:59899632-59899654 GCCCTAAGTGAAGACGGGGCAGG + Intergenic
1083295430 11:61712758-61712780 GGCCACTGGGAAGAAGGGGAAGG + Intronic
1083307779 11:61769938-61769960 GGCCTCAGAGGAGATGGGGACGG + Intronic
1083629108 11:64086677-64086699 GTGTTCAGGGAAGACAGAGAGGG + Intronic
1083810078 11:65099249-65099271 GTCCTCAGGAAGGAGGGGGGTGG + Intronic
1084444883 11:69197755-69197777 GGCCTCAGGGAAGATGGAGCTGG + Intergenic
1084642497 11:70434208-70434230 GCCCTGAGGGAACACGGGGCGGG - Intronic
1085403108 11:76246271-76246293 GTCCTCAGGGAGCTCGGTGAAGG - Intergenic
1087081311 11:94173597-94173619 GTCCACACAGAAGAGGGGGACGG - Intronic
1089980216 11:122766047-122766069 GTCCTAAGGGAAGAAGCGAAAGG + Intronic
1092568815 12:9699156-9699178 GTCCTTAGGGGAGAGGGAGATGG - Intronic
1092672736 12:10882366-10882388 TTCCTCGAGGAGGACGGGGATGG + Exonic
1092676958 12:10930909-10930931 TTCCTCGAGGAGGACGGGGATGG - Exonic
1095877617 12:47099059-47099081 GTTCGCAGGGGAGAAGGGGACGG - Intronic
1096585027 12:52614387-52614409 ATCCTCAGGGCAGTCAGGGATGG + Intronic
1100585817 12:95978287-95978309 GTTCTGAGGTAAGACGGAGATGG + Intronic
1101670649 12:106869069-106869091 CTGCTCAGGCAAGAAGGGGATGG - Intronic
1102958360 12:117074518-117074540 GGCCTCAGGCAAGATGGGGGTGG - Intronic
1103632764 12:122275822-122275844 GTCCTCAGGGAAAATGGAGAAGG + Intronic
1104651613 12:130538838-130538860 ATCCCCAGGCAATACGGGGAGGG - Intronic
1105207107 13:18233988-18234010 GACCTCAGGGATGCCGTGGACGG - Intergenic
1105410579 13:20168178-20168200 GTCATCAGGGAAGTGGGGGACGG - Intergenic
1106320341 13:28631817-28631839 GTCAGCAAGGAAGAAGGGGAAGG - Intergenic
1107851528 13:44576940-44576962 GTCCTCGGGGAGGAAGGGGCCGG + Intronic
1108415339 13:50192668-50192690 GTCCACTGGGAAGAAGGGAATGG + Intronic
1111614705 13:90648397-90648419 GGCCTCAAGGCAGAAGGGGAAGG + Intergenic
1112035391 13:95492429-95492451 GTTGTCAGGGAAGTTGGGGAAGG + Intronic
1112585501 13:100715656-100715678 GCCCTCCGGGAAGACTGGTAGGG + Intergenic
1113329624 13:109315812-109315834 ATCCTGAGGGATGACAGGGAGGG - Intergenic
1114563917 14:23614331-23614353 ATCCTCAGGAAAGAAGGGGATGG + Intergenic
1115235759 14:31207537-31207559 GTCCTCGCGGAGGAAGGGGAGGG - Intronic
1118474840 14:66106851-66106873 GTCCTCAGGGACGCCAAGGATGG + Intergenic
1119535057 14:75396117-75396139 GTCCCCAGGGAAGCCCAGGAAGG - Intergenic
1119898675 14:78242371-78242393 GACCTGTGGGAAGAGGGGGAGGG - Intronic
1119920304 14:78440335-78440357 TTCCTCAGGGAAGAAGGTGATGG - Intronic
1121201577 14:92122212-92122234 GTCCTCGGGGGAGACCGGGTCGG - Intronic
1122819127 14:104332503-104332525 TCCCTCTGGGAAGACTGGGACGG - Intergenic
1123020330 14:105395019-105395041 TTCCTCAGGGAGCCCGGGGAAGG + Exonic
1123479264 15:20616043-20616065 GTCCCCAGGGAGCAGGGGGATGG + Intergenic
1123638749 15:22384342-22384364 GTCCCCAGGGAGCAGGGGGATGG - Intergenic
1124609680 15:31200044-31200066 GAGCTCAGGGAAGAGGGAGAGGG + Intergenic
1124629906 15:31330173-31330195 GGCCTCAGGGATGACTGAGAAGG + Intronic
1127259036 15:57314518-57314540 GACCCCAGGGAAGGAGGGGATGG - Intergenic
1127855105 15:62947790-62947812 GTCCTCAAGGAAGACTGAGAAGG - Intergenic
1128255649 15:66194655-66194677 GGACTCAGGGAAGAAGGGGGAGG + Intronic
1128369962 15:67033423-67033445 GTCTTCAGGGAAGACAGGATGGG + Intergenic
1129161857 15:73752069-73752091 GTTCTGAGGGAAGGCGGGGCTGG - Intronic
1130093811 15:80841399-80841421 GTCCACAGGCAAGAAGGGCATGG + Intronic
1130384682 15:83400843-83400865 CTCCTCAGGGAAGATGAGGCTGG - Intergenic
1131075046 15:89490239-89490261 GGCCTCAGGGAAGCCTGGAAGGG - Intronic
1131613023 15:93984879-93984901 GTTCTCAGGGAAGACAAGGTGGG + Intergenic
1132391423 15:101441413-101441435 GTTCTCGGTGAAGATGGGGATGG - Intronic
1133201201 16:4205702-4205724 GTCCTCAGGGCTGACCGGGCAGG + Intronic
1133275543 16:4636238-4636260 GTTCCCAGGGAAGAAGGGGGAGG - Intronic
1134230126 16:12422550-12422572 GAGCCCAGGGAAGACGAGGAGGG - Intronic
1134297914 16:12962952-12962974 GTGCTCAGGAAATACAGGGAGGG + Intronic
1135435871 16:22426237-22426259 GTCCTCAGGGAAGCTGGGGCTGG - Intronic
1136044140 16:27602160-27602182 GTCCTCAGGCAAGGAGGGTAGGG + Intronic
1136054793 16:27680325-27680347 GGCTGCAGGGGAGACGGGGAGGG + Intronic
1137352743 16:47727918-47727940 GTCCTCTGAGAAGAAGTGGATGG + Intergenic
1138498355 16:57422807-57422829 GTCCTCTGGGAGGACAGCGAAGG + Intergenic
1140122525 16:72096024-72096046 GTCTTAAGGGGAGATGGGGAAGG + Intronic
1140410918 16:74739901-74739923 GTGCCCAGGGGAGAAGGGGAAGG - Intronic
1141108106 16:81250104-81250126 CTCCTCAGGAGTGACGGGGAGGG - Intronic
1142024376 16:87804646-87804668 GAGCTCAGGGAGGACAGGGAGGG - Intergenic
1142045081 16:87920067-87920089 GTCCTCAGGGAAGCTGGGGCTGG - Intronic
1142398619 16:89847582-89847604 GTCCCCAGGAAAGACGGCAAAGG + Intronic
1142753451 17:2001887-2001909 CCCCTCAGGGGAGCCGGGGACGG - Intronic
1143036532 17:4002847-4002869 GTCAGCAGGGAAGGAGGGGAGGG + Intergenic
1143504579 17:7356579-7356601 GACCTGAGGGAAGACGAGGGTGG - Exonic
1143564808 17:7715086-7715108 GTCCCCAGGGGAGATGGGGATGG + Intergenic
1143747914 17:9006900-9006922 CTTCTTAGGGAAGACAGGGAAGG - Intergenic
1143972721 17:10807111-10807133 GTCCCCAGGAGAGACAGGGAGGG - Intergenic
1144461949 17:15465789-15465811 GTGGTCAGGGAAGAGGGGGAGGG + Intronic
1145217904 17:21066084-21066106 AGCCTCAGGCAAGACAGGGAGGG + Intergenic
1145795612 17:27653813-27653835 GTCCTCAGGGAAGTGGGGAGAGG + Intergenic
1145972025 17:28961751-28961773 GTCCTCAGGCAAGAGGAGTATGG + Intronic
1146311055 17:31768589-31768611 ATCCTCAGGGAAGGTGGAGAAGG + Intergenic
1147444712 17:40467727-40467749 CTGCTCAGGGAAGTCAGGGAGGG - Intergenic
1147997973 17:44371656-44371678 GGCCTCAGGGAAGACTAGAAGGG - Intergenic
1149785107 17:59428128-59428150 CTTCTCAGGGAAGAGGGGGCGGG - Intergenic
1150218363 17:63482582-63482604 GGCCTCATGGAAGCCGGGGTTGG - Intergenic
1150220543 17:63493552-63493574 GGCCTCATGGAAGCCGGGGTTGG - Exonic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1152352093 17:79789873-79789895 GGCCTCAGGGAGGACGCAGAGGG + Intergenic
1153308939 18:3658896-3658918 ATCATCAGGGAAGACAGGGGTGG + Intronic
1154070225 18:11146941-11146963 GTCCTCAGTGCAGACCGGGGAGG - Intronic
1154383424 18:13872311-13872333 ATCCTCAGGGAACACGGGACGGG + Intergenic
1155841559 18:30651194-30651216 GTCGTCAGGGAAGAAGGAAAAGG + Intergenic
1156506336 18:37597096-37597118 GTCATCAGGGAAGCCAGAGATGG - Intergenic
1157407018 18:47430248-47430270 TTCCTCATGGAAGAAGGGGTGGG + Intergenic
1157770422 18:50340351-50340373 GTCCTCACGGAAGGCAGGGAGGG + Intergenic
1158598126 18:58834225-58834247 GTCCTCAGGGCCGAAGAGGATGG - Intergenic
1158639422 18:59190709-59190731 GCCCTCAGGCAAGACTGTGAGGG + Intergenic
1159511628 18:69402342-69402364 GTCATCAGGGAACACAGGAAAGG - Intronic
1160705303 19:526859-526881 GTCCTCAGGGGAGAGGGACAGGG - Intergenic
1161430466 19:4229412-4229434 GACCTGAAGGAAGTCGGGGAGGG + Intergenic
1162319156 19:9960560-9960582 GTCCCCAGAGAAGACAGAGACGG + Intronic
1162781933 19:13011135-13011157 GTCCGCAGTGGAGAGGGGGAGGG - Intronic
1162799530 19:13103050-13103072 GGCCCCAGGGCAGCCGGGGAGGG + Intronic
1163079342 19:14925776-14925798 GACCTCAAGGAAGACAGGGCGGG - Intergenic
1165144484 19:33722612-33722634 AGCCCCAGGGAAGAGGGGGAAGG - Intronic
1165255619 19:34576049-34576071 GAAATCAGGGAAGACTGGGAAGG - Intergenic
1165561985 19:36687791-36687813 GGCCTCAGAGAAGGCTGGGAGGG + Intronic
1165810307 19:38607961-38607983 GACCCCAGGGAGGATGGGGAGGG - Intronic
1166546051 19:43635477-43635499 GTCCTGAGGGAGGAAGGGGCTGG - Intronic
1166735195 19:45079748-45079770 GGCCCCAGGGGAGAAGGGGAGGG + Intronic
1166868316 19:45854511-45854533 GTCCCCAGGAAAGAAGAGGATGG + Intronic
1167311543 19:48740284-48740306 GCCCTAAGGGAAGGCGGGTAAGG + Exonic
1167638236 19:50667353-50667375 GCCCTCGGGGAGGTCGGGGAGGG + Exonic
1168101711 19:54144898-54144920 GTCCTCAGGGAAGCTGTGGGTGG + Intronic
926109412 2:10172449-10172471 GAGCTGAGGGAAGACGGTGAAGG + Intronic
926167734 2:10532010-10532032 GTCCTGAAGGATGACGGGGAAGG - Intergenic
926198978 2:10780034-10780056 CTCCTCAGTGCAGGCGGGGAAGG - Intronic
927275349 2:21257789-21257811 CTTCTCAGGGAAGTCGGGAAGGG - Intergenic
927518986 2:23688036-23688058 ATGCTCAGGGAAGAGGGTGAAGG - Intronic
927913698 2:26920113-26920135 ATCTTCAGGGAAGAGAGGGATGG + Intronic
929254883 2:39799472-39799494 TTCTTCAGGGAAGATGGGGCTGG - Intergenic
929746770 2:44667322-44667344 GTCCTCAGGGGAGAGCCGGATGG - Intronic
930088728 2:47516756-47516778 TTCCTTAGGGAAGAAGGGGAAGG + Exonic
930109491 2:47666462-47666484 GTCTTCAGGCAAGAAGGGCAGGG - Intergenic
931126938 2:59288709-59288731 GCCCTCTGGGAACACTGGGAAGG + Intergenic
931188467 2:59976544-59976566 GAGCTCAGGGAAGAAGGTGATGG - Intergenic
931449399 2:62355646-62355668 GTCCCCAGGTCAGAAGGGGAAGG + Intergenic
931646731 2:64429474-64429496 GACCTCAGGGAAGACCCTGAAGG - Intergenic
932431098 2:71674042-71674064 GTCCTGTGGGAAGACTGGGAAGG - Intronic
932596524 2:73096986-73097008 GTACTCAGGGAAGACTGAGGAGG - Intronic
932753326 2:74386826-74386848 GTCCTCAGAGGAGAGGGGAAGGG - Intronic
932781644 2:74562247-74562269 GTCCTCAGGTAGCAGGGGGAAGG + Exonic
934614659 2:95763742-95763764 GACCTCAGGGAAAACAGGGGTGG - Intergenic
934646245 2:96060754-96060776 GACCTCAGGGAAAACAGGGGTGG + Intergenic
934839648 2:97616836-97616858 GACCTCAGGGAAAACAGGGGTGG + Intergenic
937420991 2:121755428-121755450 GGCCTGAGGGAGGGCGGGGACGG - Intronic
938072373 2:128315502-128315524 GTCCCCAGAGAACACGGAGATGG + Intronic
938607454 2:132910388-132910410 GTGCTCGGGGGAGATGGGGATGG - Intronic
941133491 2:161684038-161684060 GGCCTGAGGGAAGAAGGGAATGG - Intronic
942066179 2:172273987-172274009 CTCCTCAAAGAAGACGTGGATGG + Intergenic
942286663 2:174424310-174424332 GTCCCCAGGGAAGACAGGCATGG + Intronic
948035805 2:234857532-234857554 GTTCTCAGGGAGCAAGGGGAGGG + Intergenic
948327503 2:237137807-237137829 GACCTCAGGGACAAAGGGGAGGG - Intergenic
948426004 2:237886918-237886940 GTCCACAGGGGAGGCGGGGGTGG - Intronic
948569313 2:238907376-238907398 GTCCTCCAGGAAGCCGGGGTGGG - Intronic
948869010 2:240789065-240789087 GTCCTCAGCGAAGGCAGTGATGG - Intronic
1170938124 20:20827204-20827226 GAACTCAGGGAAGAGGGAGAGGG + Intergenic
1171032479 20:21690183-21690205 GACCTCAGGGAGGACAGGGCAGG + Intergenic
1173802423 20:45902655-45902677 GCCCCCAGGGAAGAAGGGGAAGG + Intronic
1173904176 20:46613790-46613812 GGGCTCAGGGCAGAGGGGGAAGG + Intronic
1176109646 20:63405532-63405554 TTCCTCCGGAAAGGCGGGGAGGG + Intergenic
1178490545 21:33048302-33048324 GTCCTTAGTGAAGCAGGGGATGG + Intergenic
1178676820 21:34638262-34638284 GACCTCAGTGAAGATGAGGAAGG + Intergenic
1179534370 21:42041907-42041929 GTCTTCAGGAAAGACAGGCAGGG - Intergenic
1179798320 21:43798552-43798574 GTCCTCTGGGGAGACGGGCCAGG - Intronic
1180092405 21:45539831-45539853 GGCCGCAGGGAAGAGGGGGAAGG + Intronic
1181438443 22:22923480-22923502 GCTCTCAGGGATGACAGGGAGGG - Intergenic
1183422398 22:37719463-37719485 ATGCTCAGGGAAGCAGGGGATGG + Intronic
1183423535 22:37725666-37725688 GGGCTCTGGGAAGAAGGGGAAGG - Exonic
1184359631 22:44007225-44007247 GTACCCAGGAAAGATGGGGAGGG + Intronic
1184443246 22:44531858-44531880 GTGCTCAGGGGAGAGGGGTATGG - Intergenic
1184592522 22:45494555-45494577 GTCCTCAGGCCAGGCGGTGATGG - Intergenic
1184991260 22:48171507-48171529 GCCCCCAGGGCAGACAGGGAGGG - Intergenic
949266228 3:2159622-2159644 GTCCTCAGGGAAAGCAGTGAAGG - Intronic
949351303 3:3127085-3127107 GTCCTCGAGGAAGACGGGAGCGG + Intronic
949459678 3:4276955-4276977 GTTCTGAGGGAAGATGGGGATGG + Intronic
951096689 3:18640379-18640401 GTCCTCATGGATGACTTGGAGGG - Intergenic
951519687 3:23599718-23599740 GTCCACAGGCAAGAGGAGGATGG + Intergenic
953251118 3:41246540-41246562 CTCCTCAGGGAAGAGCGGAAGGG - Intronic
953449663 3:42995735-42995757 AACCTCAGAGAAGAAGGGGAGGG - Intronic
954107028 3:48414964-48414986 GTCCTCAGGCAGGCCTGGGAGGG + Exonic
954570682 3:51638331-51638353 GGCCTCAGGGAAGATTGAGATGG + Intronic
958860055 3:99435627-99435649 TGCATCATGGAAGACGGGGAAGG - Intergenic
962365315 3:134775235-134775257 GTCCTCAGGGAAGAGGAGACAGG + Intronic
965183900 3:165438351-165438373 ATCTTCAGGGGAGAAGGGGAGGG + Intergenic
966020435 3:175202882-175202904 GTTGTCAGGGAAGTGGGGGAAGG + Intronic
967023122 3:185540192-185540214 GACCTCTGAGAAGATGGGGAGGG - Intronic
967216789 3:187218054-187218076 GTCCACAGGTAAGACGGAGGAGG - Intronic
967951121 3:194841523-194841545 TTCCTCAGGGAAGTGGGTGATGG + Intergenic
968501260 4:951309-951331 ACCCTCAGGGAAGAGGGGAAGGG + Intronic
968953060 4:3704419-3704441 GTCCCCAGGGAAGAGGTTGAGGG - Intergenic
969533269 4:7740991-7741013 CTCCCCAGGGCAGACGGGGTAGG + Exonic
971181784 4:24335335-24335357 GTCCTTAGGGAAGTAGGTGAGGG + Intergenic
972359860 4:38316668-38316690 GTTCCCAGGTAAGAGGGGGATGG + Intergenic
972656161 4:41065647-41065669 GTCCTCAGGAAAGACTGAGATGG + Exonic
978132835 4:105220538-105220560 GTGCTCACGGTAGAGGGGGAGGG - Intronic
978423571 4:108559632-108559654 GTCCTGAGATAAGACTGGGAGGG + Intergenic
985624476 5:977775-977797 GTCCTCTGGGAAGGATGGGAAGG - Intergenic
986013317 5:3736661-3736683 GGCATCAGGGAAGCCCGGGAGGG + Intergenic
986206303 5:5628298-5628320 GTCCTCGGGCACGCCGGGGAAGG - Intergenic
986497988 5:8366117-8366139 GTCTTCAGGGAAAATCGGGATGG - Intergenic
988617192 5:32785991-32786013 GCACCCAGGGAAGAAGGGGAAGG + Intronic
989270824 5:39530920-39530942 CTCCTCAGAGGAGACTGGGAAGG + Intergenic
992429174 5:76691095-76691117 GTGCTTAAGGACGACGGGGACGG - Intronic
992818597 5:80470755-80470777 GTGCTTAGGGAAGACAAGGAGGG - Intronic
997238269 5:132288118-132288140 GTCGGCAGGGAGGATGGGGAAGG + Intronic
997389248 5:133500164-133500186 GACTTCAGGGAAGAGGAGGATGG - Intronic
997481042 5:134184745-134184767 GTCCTCTGGGCAGAGGGGTAGGG - Intronic
998713328 5:144850753-144850775 GTCCTCAGGGAAGATCCAGAAGG - Intergenic
1002081782 5:176741694-176741716 GGCCTCACAGAAGACTGGGAGGG + Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002810889 6:627458-627480 AGCATCAGGGAACACGGGGAGGG - Intronic
1004376141 6:15092333-15092355 GTCTTCAGGGATGCCAGGGAAGG + Intergenic
1004395386 6:15243458-15243480 GGCCTCAGGGCAGAGGGGAAAGG - Intergenic
1004531915 6:16461806-16461828 ATCCTCAGGGAAGGCTGAGAAGG + Intronic
1006408379 6:33857969-33857991 GTGCTCCAGGAAGACAGGGATGG - Intergenic
1007364646 6:41382850-41382872 GTCCACAGGGAAGGCAGGGGAGG + Intergenic
1007384544 6:41511871-41511893 GTCCCCAGGGAACAAGAGGATGG + Intergenic
1016988646 6:149913551-149913573 GTCAGGAGGGAAGACAGGGAAGG + Intergenic
1016989973 6:149922234-149922256 GTCCTCAGGCAAGAGGCAGAAGG + Intronic
1016993080 6:149942829-149942851 GTCCTCAGGCAAGAGGCAGAAGG - Intronic
1017005256 6:150024695-150024717 GTCCTCAGGCAAGAGGCAGAAGG + Intronic
1017599962 6:156069701-156069723 GGCCTCTAGAAAGACGGGGATGG + Intergenic
1018987532 6:168649119-168649141 GGCCACGGGGAAGGCGGGGAAGG + Intronic
1019172801 6:170143681-170143703 GCCTTCAGTGAGGACGGGGAAGG + Intergenic
1019546635 7:1580658-1580680 GTCCTCTGGGGAGACGGGCCAGG + Intergenic
1019864822 7:3698107-3698129 GTCCTTTGGGAGGAAGGGGAGGG - Intronic
1020596925 7:10218317-10218339 GTCCTAAAAGAAGAGGGGGAGGG + Intergenic
1022040141 7:26573362-26573384 GTCCTCAGAGAGGAAGGGGTTGG + Intergenic
1022264555 7:28741382-28741404 GTCCTCAGGGATGGCAGGGTGGG - Intronic
1023133831 7:37031177-37031199 CTCCTCATGGAAGACAGTGAGGG - Intronic
1023159083 7:37279867-37279889 GTTGTCAGGGAAGTGGGGGAAGG - Intronic
1026824512 7:73573124-73573146 GTCCCTAGGGAAGGTGGGGAAGG - Intronic
1027791555 7:82642585-82642607 GTCCTCAGGGAAGGTGGAGAAGG + Intergenic
1028415789 7:90579205-90579227 GTCATGAGGGAATACAGGGAGGG + Intronic
1029298123 7:99558109-99558131 GTCCTTGGGGAAAGCGGGGACGG - Intronic
1029304758 7:99610847-99610869 GTCCGCAGGGCAGGAGGGGAGGG + Intergenic
1029611737 7:101630261-101630283 GTAGTCAGGGATGACTGGGAGGG - Intergenic
1034266210 7:149782252-149782274 GTCCTCCAGGGAGACGGAGATGG - Intergenic
1035392870 7:158517163-158517185 GTCCTCACTGAAGACAGGGCGGG + Intronic
1036937405 8:13016753-13016775 GTCCTCTGGGGAAAGGGGGAAGG - Intronic
1037755935 8:21710053-21710075 CTCCTCAGGGAAGAGGGGAGGGG + Intronic
1038219278 8:25592268-25592290 GTCCCCAGGACAGACAGGGAAGG + Intergenic
1038644202 8:29349640-29349662 GTCCTCAGGGAAAGTGCGGACGG - Intronic
1039095568 8:33880989-33881011 GTTCTCAGGGAAGTCGGGGAAGG + Intergenic
1039376665 8:37041432-37041454 TCCATCAGGGAAGAAGGGGAAGG + Intergenic
1039516713 8:38139928-38139950 GTTCCAAGGGAAGACCGGGAGGG - Exonic
1039692657 8:39879370-39879392 ATCCTCAGGGAAGATTGAGAAGG - Intergenic
1039892752 8:41695926-41695948 GTCCTCAGGGGAAACGGCCAGGG + Intronic
1042088153 8:65131324-65131346 GTCTTCAGGGTAAAAGGGGAAGG - Intergenic
1042681644 8:71392203-71392225 GTCCTCAGGGGAGGAAGGGACGG + Intergenic
1044093273 8:88028951-88028973 GAGGTCAGGGAAGATGGGGAAGG + Intergenic
1045688413 8:104735526-104735548 GTGCTCAGGGAAGACAGTGCAGG + Intronic
1046344403 8:112903531-112903553 GACCTCAGGGAGTATGGGGAAGG + Intronic
1047488957 8:125358532-125358554 GTGGTCATGGAAGAAGGGGAAGG - Intronic
1048428259 8:134342656-134342678 GTCCCCAGGGAACTCGGGCAGGG - Intergenic
1049572564 8:143376120-143376142 GTCCCCAGGGAAGGCCAGGATGG - Intronic
1049777457 8:144413282-144413304 GTCCTCCTGGAAGACCGGGCTGG - Exonic
1050600329 9:7243834-7243856 GTCATCAGGGATGAGGTGGAGGG + Intergenic
1051359014 9:16265531-16265553 GTTCTCAGGGGAGAGGGTGATGG - Intronic
1051552484 9:18345703-18345725 ATCCTCAGGGCAGATGGGAAAGG + Intergenic
1053061907 9:35038446-35038468 GTCCTGATGGAAGACAGAGAAGG - Intergenic
1054808339 9:69413454-69413476 CTCCTCAGGGAAGAGGGGATGGG + Intergenic
1057490064 9:95513703-95513725 GGTTTCAGGGAAGTCGGGGACGG + Intronic
1059165507 9:112073060-112073082 GTCCTCAGGGAAGACTGTGCAGG - Intronic
1059421364 9:114194478-114194500 GTTCTCAGGGAAGAGGGGAGTGG + Intronic
1060177248 9:121506086-121506108 GTCGTCAGGGATGCTGGGGATGG - Intergenic
1060389546 9:123267441-123267463 GTGCTCAGGGAAGAGGAGTATGG - Intronic
1060404806 9:123367939-123367961 GTCTTCAGGGAAGACGGAGGTGG + Intronic
1060716410 9:125934018-125934040 GTGGTAAGGGAAGACAGGGAAGG - Intronic
1060779608 9:126401757-126401779 GTCCAGAGGGAAGGCGGGGTTGG - Intronic
1061714983 9:132513442-132513464 GTCCTCAGGGAAGACGGGGAGGG - Intronic
1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG + Exonic
1061764808 9:132875040-132875062 GGAGTCAGGGAAGAAGGGGAAGG + Intronic
1062699584 9:137891952-137891974 GCTCTCAGGGGAGACAGGGAGGG - Intronic
1203563159 Un_KI270744v1:74297-74319 GTTCTCAGGGAAGAGGAGGCCGG + Intergenic
1189867942 X:45351096-45351118 GTGCTCCTGGAAGAAGGGGAAGG - Intergenic
1189946100 X:46180400-46180422 GTTGTCAGGGAAGTGGGGGAAGG + Intergenic
1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG + Intergenic
1192727098 X:73765128-73765150 GTCTTCAGGGCAGTAGGGGATGG + Intergenic
1195806514 X:108776986-108777008 ATAATCAGGGAAAACGGGGAGGG - Intergenic
1198130180 X:133686251-133686273 GTGCTCAAGGATGATGGGGATGG + Intronic
1198580583 X:138060017-138060039 GTCCAAAGGGAAAATGGGGAGGG - Intergenic
1201407082 Y:13660325-13660347 ATCCTCAGGGAAGGTGGAGAAGG - Intergenic
1201907819 Y:19103439-19103461 ATCCTCAGGGAAGGTGGAGAAGG - Intergenic
1201911481 Y:19137559-19137581 ATCCTCAGGGAAGGTGGAGAAGG + Intergenic