ID: 1061716332

View in Genome Browser
Species Human (GRCh38)
Location 9:132520778-132520800
Sequence CTCCTGGGCCAGGGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 727
Summary {0: 1, 1: 0, 2: 10, 3: 90, 4: 626}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061716332_1061716351 29 Left 1061716332 9:132520778-132520800 CCTTCTGCCCCCTGGCCCAGGAG 0: 1
1: 0
2: 10
3: 90
4: 626
Right 1061716351 9:132520830-132520852 CCCTCCATTCCTCTCTCCCTGGG No data
1061716332_1061716339 -5 Left 1061716332 9:132520778-132520800 CCTTCTGCCCCCTGGCCCAGGAG 0: 1
1: 0
2: 10
3: 90
4: 626
Right 1061716339 9:132520796-132520818 AGGAGCCCCTCCCCAGACACTGG No data
1061716332_1061716342 1 Left 1061716332 9:132520778-132520800 CCTTCTGCCCCCTGGCCCAGGAG 0: 1
1: 0
2: 10
3: 90
4: 626
Right 1061716342 9:132520802-132520824 CCCTCCCCAGACACTGGCGCAGG No data
1061716332_1061716349 28 Left 1061716332 9:132520778-132520800 CCTTCTGCCCCCTGGCCCAGGAG 0: 1
1: 0
2: 10
3: 90
4: 626
Right 1061716349 9:132520829-132520851 GCCCTCCATTCCTCTCTCCCTGG No data
1061716332_1061716344 2 Left 1061716332 9:132520778-132520800 CCTTCTGCCCCCTGGCCCAGGAG 0: 1
1: 0
2: 10
3: 90
4: 626
Right 1061716344 9:132520803-132520825 CCTCCCCAGACACTGGCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061716332 Original CRISPR CTCCTGGGCCAGGGGGCAGA AGG (reversed) Intronic
900645467 1:3706858-3706880 ACCCCGGGCCAGGGGGCAGCAGG + Intronic
900685944 1:3947717-3947739 GCCCTGGGGCAGGGGGAAGAAGG - Intergenic
900787198 1:4656162-4656184 CTCCAGGGCCAGATGGAAGAGGG + Intronic
901181739 1:7346779-7346801 CTCCTGGGTCTGAGGGCAGGTGG + Intronic
901216743 1:7559346-7559368 GTCCAGGGCCAGGAGGCAGGAGG - Intronic
901512217 1:9723105-9723127 ATCCTAGGCAAGGGGGAAGAGGG - Exonic
901666774 1:10830631-10830653 CTCCTGGGGCAGGGGGCGCTGGG + Intergenic
901738909 1:11329714-11329736 CTCCTGGCCCAGGAGAAAGACGG + Intergenic
902041064 1:13492903-13492925 GGCCTGGGTCAGGGGGGAGAGGG - Intronic
902331851 1:15734701-15734723 CTCCTGGGGAAGGGGTCAGGTGG + Exonic
902385319 1:16072844-16072866 ATCCTTGGACAGGGGACAGAAGG - Intronic
903009236 1:20318631-20318653 CTCTTGGCCGAGCGGGCAGATGG - Exonic
904116181 1:28163706-28163728 CAGCTGGGCCAGTGGGGAGAGGG - Intronic
904208086 1:28867952-28867974 CTCCTGGGCCAGGAAGCAAGGGG - Intergenic
904319476 1:29687143-29687165 CTCCAGGGGCTGGGGGCAGTGGG + Intergenic
904377397 1:30090444-30090466 CTCCTGGGAGAGTGGACAGAGGG + Intergenic
904495184 1:30882501-30882523 CCCCTGGGCCAGGGGCAAGGAGG + Intronic
904612366 1:31732604-31732626 ATCCTGGACCTGGGGACAGAGGG + Exonic
904858043 1:33514753-33514775 CCCCTGGGCCTGGAGGGAGAGGG - Exonic
904988483 1:34572577-34572599 CTTGTGGGCCAGGAGGAAGAAGG + Intergenic
905005755 1:34709068-34709090 TTTCTGGGACAGGTGGCAGAAGG - Intergenic
905897392 1:41557669-41557691 CTCCAGGGGTGGGGGGCAGAGGG + Intronic
905983747 1:42256697-42256719 TTACTGGGTCAGAGGGCAGATGG - Intronic
906196167 1:43931966-43931988 CTCCTGGGCTAGGGGGGTAAGGG + Intergenic
906667453 1:47631812-47631834 GTCCTGGGCCAGGGGGATGGGGG + Intergenic
907399514 1:54216355-54216377 CTCCTGGGTCAGGCAGGAGATGG - Intronic
910334283 1:86110500-86110522 CTCCTGGGCCAGCACGGAGAGGG - Intronic
910735100 1:90444991-90445013 ATCTTGGGCCAAGTGGCAGAAGG + Intergenic
912429673 1:109622435-109622457 CTCCTGGTCGAGAGGGGAGATGG + Intronic
913517501 1:119616984-119617006 CTCCTGGGGCAGGGTGATGAGGG - Intergenic
914814233 1:151051704-151051726 CTCTTCAGCCAGGGGGCAGTGGG + Exonic
915290401 1:154879306-154879328 CTCCTGGGAAAGGTGGCAGCCGG + Intergenic
915917846 1:159951811-159951833 TCCCTTGGCCAGGAGGCAGAAGG + Exonic
916213598 1:162377684-162377706 CACATGGGGCAGGGGGCAGGAGG - Intronic
916666581 1:166973211-166973233 CTCCAGGTGCAGGTGGCAGAAGG + Intronic
918193371 1:182198134-182198156 CTCCTTGTCCTGAGGGCAGAGGG + Intergenic
918320793 1:183362422-183362444 CTGCAGGGCCAGGGGGCGGTGGG - Intronic
918377368 1:183922628-183922650 TCCCTGTGCCAGGAGGCAGAGGG + Intronic
919653059 1:200169381-200169403 CTGCTGAGCCAGGGGGCTGGGGG - Intronic
919782423 1:201229449-201229471 CTCCTGTGACATGGGGCAGTGGG - Intergenic
919828097 1:201518350-201518372 CTACTGGGCAAGGGGGTAGAGGG - Intergenic
922779878 1:228243412-228243434 CTGCGAGGCCAGGGGCCAGAGGG + Exonic
922800869 1:228364257-228364279 CCGCAGGGCCAGGGGGCATAGGG + Intronic
922931968 1:229396975-229396997 CACGTGGGTCAGGAGGCAGAGGG - Intergenic
922951130 1:229558948-229558970 CTCCTCCGCCAGCGGGCAGTTGG - Intergenic
923525595 1:234770209-234770231 CTGCTGGCGCAGGGGGCAGGCGG - Intergenic
923549955 1:234955598-234955620 CCCTGGGGGCAGGGGGCAGAGGG + Intergenic
923625029 1:235606783-235606805 CTCATGGGCCAGGGGGAGCATGG + Intronic
924064259 1:240207608-240207630 CTCCGGGTAGAGGGGGCAGAGGG - Exonic
924941409 1:248814602-248814624 CTGCTGAGCCTGGGGGGAGAGGG + Exonic
1062811831 10:472386-472408 GTCCTGGCACAGGTGGCAGATGG + Intronic
1062890495 10:1056524-1056546 CTGCCGGGCTACGGGGCAGATGG + Intronic
1063436606 10:6037059-6037081 GTCCTCACCCAGGGGGCAGATGG - Intronic
1064129389 10:12695470-12695492 CTACAGGGCCAGGGAGGAGAAGG - Intronic
1064418086 10:15168199-15168221 CTCCTGGGCCAGGCCGCCGGCGG + Intronic
1064874487 10:19977447-19977469 CCACTGGGGGAGGGGGCAGAGGG + Intronic
1064886433 10:20118362-20118384 CTCCTGGGCTGGGGGAGAGAAGG + Intronic
1065055369 10:21837751-21837773 CTCCTGGACCAGGCGGCTGCCGG - Intronic
1066026607 10:31364382-31364404 CACCTGGGCCAGGCGCCAGGTGG - Intronic
1066689309 10:38010831-38010853 CTCCTGGGGCGGGCGGCAGGGGG + Intronic
1069143868 10:64863915-64863937 CCCAAGGGCCAGGGTGCAGATGG + Intergenic
1069282944 10:66678227-66678249 CTACTAGGTCAGGGAGCAGATGG - Intronic
1069775998 10:70927554-70927576 CTCCTGGTCCTGGCAGCAGAGGG - Intergenic
1069839464 10:71330159-71330181 TTGCTGGGCCAGGGGGCCAAGGG + Intronic
1069892248 10:71659176-71659198 CCCCTGGGCCAGGGGACAATGGG + Intronic
1069956249 10:72053787-72053809 CCCCTGGGCCAGGGCTGAGAGGG - Intergenic
1069960177 10:72074918-72074940 CTCCTGGGCCCAGGGGCTGCGGG - Intronic
1070112196 10:73496678-73496700 CTCATGGGAAAGGGGGTAGAGGG + Intergenic
1070558069 10:77545571-77545593 CTCCTGTGCCAGGAGCCACAAGG + Intronic
1070662337 10:78316319-78316341 CTGCTGGATCAGGGGCCAGAGGG + Intergenic
1070751532 10:78966879-78966901 CTCATGGGCAGGAGGGCAGATGG - Intergenic
1071601248 10:86959683-86959705 CCCCAGGGCCAGGGGACACATGG + Intronic
1072309849 10:94144408-94144430 CTCTAGGGCAAGGGGGCAGCAGG - Intronic
1073072359 10:100802731-100802753 CTGCTGGGCCTGGGGGCAAAGGG + Intronic
1073196233 10:101694479-101694501 CACCTGGGCCAGGCGGCCGAGGG + Exonic
1073290868 10:102412636-102412658 CTTCTGGGCCTGGAGGCAGAAGG - Intronic
1073491181 10:103854708-103854730 GGCCTGGGGCTGGGGGCAGAAGG - Intronic
1074535339 10:114324909-114324931 CTCCTGGCCCAGGAGACAGTGGG + Intronic
1074809588 10:117090389-117090411 GTCAGGGGCCAGGGGACAGAAGG + Intronic
1074824149 10:117202511-117202533 CTTGTGGCCCAGTGGGCAGAAGG - Intronic
1075521480 10:123146232-123146254 CTCCTGGGCCACGTCGCAGCGGG - Intergenic
1075661420 10:124199580-124199602 CCCCTGGGTCAGTGGGCAGTGGG + Intergenic
1076036468 10:127202435-127202457 CTCCTGTGCACCGGGGCAGAAGG - Intronic
1076109586 10:127850657-127850679 CACCTGGGCCTGCGCGCAGATGG + Intergenic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1076748147 10:132524698-132524720 CTCCTGGGCCAGAGGAGAGAAGG - Intergenic
1076872038 10:133199023-133199045 CGCCCGGGCCAGGAGCCAGAGGG + Exonic
1077049105 11:558805-558827 CTCCTGGGCCAGGTGGCCAGGGG - Intronic
1077137544 11:1008491-1008513 CCCCCAGGCCAGGGGGCCGAAGG - Intronic
1077164355 11:1128597-1128619 GACCTGGGCCGGGGGGCAGGAGG - Intergenic
1077247914 11:1548132-1548154 CTCCTGGGCCAGGGGCTTGACGG + Intergenic
1077304948 11:1864826-1864848 CCCCTGTGCCAGGTGCCAGAGGG + Intronic
1077304969 11:1864884-1864906 CTCCTGTGCCAGGGGCCAGAGGG + Intronic
1078645595 11:13139071-13139093 CTGTTGGGGCAGGGGGCAGAGGG - Intergenic
1079111228 11:17606249-17606271 CTCCTGGCACAGGGGCCACATGG + Intronic
1079140482 11:17806002-17806024 GTCCTGGGCCACAGGGCAGCTGG + Intronic
1080313424 11:30921625-30921647 CTCCTGGGCCAGAGGGGATCTGG + Intronic
1081617278 11:44598300-44598322 CACCTGGGCCCTGGGGCAAAAGG + Intronic
1081645355 11:44786356-44786378 CTTCTGGGGCTGGGGACAGAGGG + Intronic
1081995295 11:47359820-47359842 CTCCTGGGGGACGGGGCAGGCGG + Intronic
1082911642 11:58383075-58383097 CCCCAGGGTCAGGGGGCTGAGGG + Intergenic
1083471222 11:62885370-62885392 CTGGTGGGAAAGGGGGCAGATGG + Intronic
1083507723 11:63174796-63174818 TTCCTGGGGCAGAGGGCAGAGGG - Intronic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083654025 11:64220416-64220438 CTCCTGGGCGAGAGGGGTGAGGG - Exonic
1083731991 11:64657254-64657276 CACGTGGGCCAGGAGGCTGAAGG + Intronic
1083752160 11:64766741-64766763 CTCCTGGTCCAGGGGGTGGAGGG - Intronic
1083887063 11:65578039-65578061 TGGCTGGGCCTGGGGGCAGAGGG - Intronic
1084267327 11:68011781-68011803 CCCCTGGGGCAGGGGCCTGAAGG - Intronic
1084422295 11:69066432-69066454 CTGCTGGGGGAGGGGGCACAGGG - Intronic
1084651311 11:70491006-70491028 CTCCTGGGACAGGCTGAAGAGGG - Intronic
1085203950 11:74718976-74718998 CTCCTAGGCAAGGGGCCAGAAGG + Intronic
1085296582 11:75434926-75434948 CTCCTGGGGCAGGGGGTTGGCGG + Exonic
1085417260 11:76327761-76327783 CTCCTGAGCCAGGGTGCATGGGG - Intergenic
1085465751 11:76722196-76722218 CTCAGGAGCCAGGAGGCAGAGGG - Intergenic
1086253094 11:84840836-84840858 GTCCTGGGGTAGGGGGCAGGGGG + Intronic
1086911031 11:92472874-92472896 TTCCTGGGCAAGGGGGCAGAGGG - Intronic
1088536354 11:110866370-110866392 CACCTGGGCCAGTGGGCACAGGG + Intergenic
1088627669 11:111742969-111742991 AACCTTGGGCAGGGGGCAGAGGG - Intronic
1088912550 11:114202750-114202772 CCCCGGGGTGAGGGGGCAGAGGG + Intronic
1089566665 11:119375413-119375435 CCCCTGGGCCAGGTGGCAAAAGG - Intronic
1089634004 11:119800821-119800843 CCCCAGGGCCAGGTGGCACAGGG + Intergenic
1089836681 11:121376517-121376539 ATCTGGGGCCAGGTGGCAGAAGG - Intergenic
1091214403 11:133891795-133891817 ATCTTGGGCTAGGAGGCAGAGGG - Intergenic
1092636311 12:10454422-10454444 CTCCTGGGCCCCTGGGCAAATGG - Exonic
1092754872 12:11753745-11753767 CTTCTGCCCCAGAGGGCAGACGG + Intronic
1095947078 12:47759402-47759424 GTGCTGGGGCAGGGGGCAGTGGG - Intronic
1096417296 12:51425108-51425130 AGCCTGGGCTCGGGGGCAGAAGG - Intronic
1096498587 12:52052454-52052476 CTACTGGGGGAGGGGGCATAGGG - Intronic
1096503423 12:52079266-52079288 CTGCTGAGCCAGGAGGCACACGG - Intergenic
1096586211 12:52621809-52621831 CTGCTGGGGGAGGGGGCAGTTGG - Intergenic
1096623286 12:52877926-52877948 CTCCTGGGCCAGCAGGCTCAAGG - Intergenic
1097244695 12:57601011-57601033 CTCCTGGGCCCAGGGGCCGATGG - Exonic
1099141388 12:78980905-78980927 CTCCTGAGCCAGGGGGGAGAGGG + Intronic
1102025271 12:109711133-109711155 CTGAGGGGGCAGGGGGCAGAGGG - Intergenic
1102152759 12:110699957-110699979 CTCTTGGACCAGGAGGAAGAAGG - Intronic
1102453666 12:113058120-113058142 CTCCTGGGCCTGGCAGCAGGCGG - Exonic
1102691957 12:114768416-114768438 CTGCTGGGGCAGGGGGGAGAGGG - Intergenic
1102843158 12:116147966-116147988 CTCCTGGCCCGGGAGGCAGGAGG + Intronic
1103063101 12:117874936-117874958 CCCCTGGGCCTGGGGTTAGAGGG + Intronic
1103206828 12:119136294-119136316 CACCTGGACTAGGGGTCAGAAGG - Intronic
1104155355 12:126126110-126126132 CTGCTGGACCAGGCGGCACAGGG + Intergenic
1104847292 12:131852872-131852894 CTCCTGCTCCAGGGAGCAGATGG - Intergenic
1104924279 12:132305965-132305987 CACCTGGGCCGGGGGGCTCACGG + Intronic
1105620897 13:22065135-22065157 CTCCTTCCCCAGGGGGCACATGG - Intergenic
1105859418 13:24395602-24395624 GGCCTGGGGCAGGGGGCAGGAGG - Intergenic
1106036741 13:26051102-26051124 CTCCTGGGCGTCGCGGCAGAGGG - Intergenic
1107991373 13:45821511-45821533 CTACTGGGCCATGGGGCAGTAGG - Intronic
1110254460 13:73417419-73417441 CCCCTGGGCGAGGGGGGAGGCGG - Intergenic
1112051839 13:95650373-95650395 CTCCTGGCCCAGGAGCCAGTGGG - Intergenic
1112325558 13:98440900-98440922 CTTCTGGGCCAGGGGCTTGAGGG + Intronic
1112389018 13:98965567-98965589 ATCCTGGGCCAGGGCTCAGGAGG - Intronic
1112948680 13:104962571-104962593 CTTCTGGCCCTGGTGGCAGATGG - Intergenic
1113932447 13:113975504-113975526 CTCCTCAGCCAGGGGGAAGCAGG + Intergenic
1114332559 14:21652128-21652150 CTGCTGGGCCAGCTGGGAGAGGG + Intergenic
1114491060 14:23102264-23102286 CTCCTGGAGGAGGTGGCAGATGG + Intergenic
1114613055 14:24054577-24054599 CCCCTGGGCCAGGGCTGAGAAGG + Intronic
1114639086 14:24207062-24207084 CTGAAGGGCCAGGGGTCAGAGGG - Intronic
1117574651 14:57085901-57085923 CTCCAGGGGGAGGTGGCAGATGG + Intergenic
1118482429 14:66180657-66180679 GTCCTGGTCAAGGGGTCAGAGGG - Intergenic
1118773972 14:68961980-68962002 CTTGTGGTCCAGGGGGTAGATGG - Intronic
1118807641 14:69251621-69251643 CTCCAGGCCCATGGGGCAGCCGG + Intergenic
1118982873 14:70730474-70730496 CTCCTGGACCTGGATGCAGAGGG - Exonic
1119344242 14:73909089-73909111 CTCTTGGGCCAGGAGGGAGAAGG + Intronic
1119433563 14:74583832-74583854 CTCCTGGTCCAGTGAGCAAATGG + Intronic
1119466535 14:74863035-74863057 TTCCAGGGGCAGGTGGCAGAGGG - Intronic
1119480801 14:74956350-74956372 CTCCTCGGCCAGGGACCAGGAGG - Intergenic
1119538534 14:75423018-75423040 CTCCAGGGCCACAGGGAAGAGGG + Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121221336 14:92288018-92288040 CTCCTGTGCCAGCGAGCAGGAGG - Intergenic
1121583887 14:95049750-95049772 CTCTTGAACCTGGGGGCAGATGG - Intergenic
1121679085 14:95777553-95777575 CTCCAGGCCCAGGGGGAGGAAGG - Intergenic
1122031551 14:98916031-98916053 CTCCAAGGCCAGTGGGCACAAGG - Intergenic
1122208971 14:100162729-100162751 CCCCTGGGCCAGGCAGCAGCAGG + Intergenic
1122470419 14:101962339-101962361 GTCCTGTGCCAGGAGGCAGAAGG + Intergenic
1122579865 14:102764730-102764752 CACCTGGGCCGGGGGCCACAGGG + Intergenic
1122694067 14:103544382-103544404 CTCCTGGGGGAGGGGGCATAGGG - Intergenic
1122802419 14:104238296-104238318 TCACTGGGTCAGGGGGCAGATGG + Intergenic
1122847241 14:104506619-104506641 GGCCTGGGGCAGGGGGCAGGAGG - Intronic
1123179806 14:106459320-106459342 CGCCAGGCCCAGGGGGCACAGGG - Intergenic
1124363433 15:29054850-29054872 GTCCTGGGGAAGGGAGCAGAGGG + Intronic
1124662680 15:31563168-31563190 CTCCTGGTACAGGGGCTAGAAGG - Intronic
1125766620 15:42140791-42140813 CCCCTGGGACAGGGGGCAGAAGG + Exonic
1126685717 15:51247169-51247191 CTCATGGGCATGGGGGCTGACGG - Intronic
1126895605 15:53254105-53254127 CTCCTGGCCAAGGGGGAAAAGGG + Intergenic
1127932943 15:63609427-63609449 CTCGAGGGCCACGGGGCAGTAGG - Intronic
1128052058 15:64673246-64673268 CTCTTGTTCCAGGGGGCAGCTGG - Intronic
1128639212 15:69323461-69323483 CTCCTGGGCCAGAGGCAGGATGG + Intronic
1128811083 15:70573254-70573276 CGCCTGGGCAAGAGGGCAGCTGG - Intergenic
1128818390 15:70630545-70630567 CTTCTGGGGCAGGGGAAAGATGG - Intergenic
1128939583 15:71777456-71777478 CGCCTGGGCCAGGGGGCCCGTGG - Exonic
1128980567 15:72182775-72182797 TGCCAGGGCCTGGGGGCAGAGGG + Intronic
1129104419 15:73296313-73296335 ATCCTGGGCCAGGGAGAAGCTGG - Intronic
1129153518 15:73703639-73703661 CTCCTGGGGGCGGGGTCAGAGGG - Exonic
1129177778 15:73852494-73852516 CTATTGGGGCAGGGAGCAGAGGG + Intergenic
1129296318 15:74602242-74602264 AACCTGGGGCAGGGGGCAGGGGG - Intronic
1129745531 15:78017061-78017083 CTCATGGGCCATGTGCCAGATGG - Intronic
1130684090 15:86022008-86022030 CTCCCGGGCCTGGAGCCAGAAGG + Intergenic
1131594393 15:93781984-93782006 CTCCTGAGCCAGGGGGCAGCTGG + Intergenic
1132545235 16:529976-529998 CTGCTGTGCCAGGGGTCAGAGGG - Intronic
1132590114 16:722910-722932 CACCTGGGCAGGTGGGCAGAGGG - Exonic
1132656524 16:1043917-1043939 CTCCCAGGCCTGGGGGCAGTGGG + Intergenic
1132762978 16:1519943-1519965 CTCCTGGTCCAGGGGGCTCTTGG + Exonic
1132851760 16:2027983-2028005 CTCCTTAGCCAGGAGGCAGGAGG - Intronic
1132986097 16:2768407-2768429 ATGCTGGGGCAGGGGGCGGAGGG + Intronic
1134066200 16:11230047-11230069 ATCCTGGGCCAGATGCCAGAGGG + Intergenic
1134168326 16:11948169-11948191 TTCCTGGGCCATGGGACTGAAGG + Intronic
1134901570 16:17942829-17942851 CTCCTGGTCCTGTGGGAAGAAGG - Intergenic
1135752309 16:25067046-25067068 CTCCGGGGCCAGCGGGCACCAGG + Intergenic
1136280392 16:29205321-29205343 CTCCTGGAACAGGTGGCAGATGG - Intergenic
1136577993 16:31135486-31135508 GTCCTGGGCCATGGCCCAGAAGG - Exonic
1137421080 16:48334591-48334613 TTTCTGGGCAAGGTGGCAGAGGG + Intronic
1137458577 16:48637318-48637340 GTCCAGGGTCAGGGAGCAGAGGG - Intergenic
1137732207 16:50697386-50697408 CTCCCAGGCCTGGGGTCAGATGG + Intronic
1138099969 16:54244523-54244545 CTCCTGGGCCACGGAGCAGGGGG + Intergenic
1138262550 16:55635622-55635644 CTCCTTGGCCAAGAGGCAGGGGG + Intergenic
1138551850 16:57752758-57752780 CTCCTGGGCCAGGCGAGAGATGG - Exonic
1138829627 16:60360034-60360056 CACCTGGGCCAGGCGCCAGGCGG - Intergenic
1139446557 16:67001777-67001799 AGCCTTGCCCAGGGGGCAGATGG - Intronic
1139544745 16:67644987-67645009 CTCCTGGGCGACGGGGCGGGCGG + Exonic
1139672217 16:68499641-68499663 CTGTTGGGGCAGGGGGCAGGGGG - Intergenic
1141412337 16:83844038-83844060 CTCCAGGGTCAGGGGGAAGCAGG + Intergenic
1141438684 16:84015393-84015415 CTCCAGGGCCTGGAGGCAGGAGG + Intronic
1141481965 16:84312947-84312969 CTCCTCGGCCTGCGGGGAGAGGG - Exonic
1141627369 16:85268430-85268452 CACCTGGGGCAGGGGCCAGACGG - Intergenic
1141644351 16:85359258-85359280 CTCCTGGGCCTGGCGGCTCACGG + Intronic
1141673883 16:85507386-85507408 CTCCTGGGCCGGGGTGGGGAGGG + Intergenic
1141700725 16:85640891-85640913 CTCCTGGCCCGGGGGCCAGAGGG + Intronic
1141720635 16:85753387-85753409 CTCCTGGGGGAGGAGGCAGCCGG - Intergenic
1141859416 16:86706376-86706398 CTCCTGGCCCAGGGAGCACCAGG + Intergenic
1142084761 16:88171279-88171301 CTCCTGGAACAGGTGGCAGATGG - Intergenic
1142232561 16:88906681-88906703 CTCATGGGGCAGCGGGTAGACGG - Intronic
1142429758 16:90019592-90019614 CCGCTGGGCCAGGGGCCAGCAGG - Intronic
1142645629 17:1312393-1312415 CTCCTGAGCCAGGGAGAAGAAGG + Intergenic
1142899624 17:3004044-3004066 CACCTGGGACAGAGGCCAGAGGG - Intronic
1143090265 17:4445838-4445860 CCCCTGGGCAGGGGGGCAGGTGG + Intronic
1143109283 17:4544433-4544455 CTCCTGCGCCTGGGGGCTGCCGG + Intronic
1143204797 17:5134113-5134135 CTCCTGGCCCAGGGAGCAGCCGG + Intronic
1143205233 17:5136414-5136436 CTCCTGGGCCAGGGTGCAAAAGG - Intronic
1143577882 17:7805238-7805260 CTCCAGGGCCTGGGGGAAAAGGG - Exonic
1143864974 17:9917114-9917136 CTCCTGGGCCACTGAGGAGAGGG - Exonic
1144018715 17:11221383-11221405 AGCCTGGGCCAGGGGGCAGATGG - Intergenic
1144494723 17:15738949-15738971 CTCCTGGCCCAGGGAGCAGCCGG + Intronic
1144834609 17:18150415-18150437 CTCCAGGTCCTGGGGGCAGTGGG - Exonic
1144875844 17:18396791-18396813 CTCCTAGCCCAGGGAGCAGCCGG + Intergenic
1144905533 17:18637723-18637745 CTCCTGGCCCAGGGAGCAGCCGG - Intronic
1144967472 17:19087078-19087100 CACCTGGGCCCGGGGGCTCAAGG + Intergenic
1144968184 17:19090785-19090807 CTTCTGGGGCAGGGGCCAGCAGG - Intergenic
1144979733 17:19161278-19161300 CTTCTGGGGCAGGGGCCAGCAGG + Intergenic
1144980447 17:19164989-19165011 CACCTGGGCCCGGGGGCTCAAGG - Intergenic
1144987775 17:19213244-19213266 CACCTGGGCCCGGGGGCTCAAGG + Intergenic
1144988489 17:19216954-19216976 CTTCTGGGGCAGGGGCCAGCAGG - Intronic
1145156385 17:20547629-20547651 CTCCTAGCCCAGGGAGCAGCCGG - Intergenic
1145760498 17:27422783-27422805 CCCCTGGCCCAGGGAGCAGCCGG + Intergenic
1145798550 17:27669515-27669537 CTCCTGTACCAGGGAGCAGCTGG - Intergenic
1146160524 17:30557099-30557121 CTCCTGGTCCAGGGAGCAGGCGG + Exonic
1146285937 17:31574172-31574194 CACCTGGGCCTCGGGACAGAAGG + Intronic
1146352972 17:32111457-32111479 CTCCTGGGCCACGGGCTGGAGGG - Intergenic
1146535582 17:33647809-33647831 CTGCTGAGCCAGAGGGCTGAGGG + Intronic
1146793122 17:35764199-35764221 CTCCTGGCGCAGCGGGCAGTAGG - Exonic
1146843873 17:36171716-36171738 CTCCCGGCCCAGGGAGCAGCCGG - Intronic
1146856179 17:36259651-36259673 CTCCCGGCCCAGGGAGCAGCCGG - Intronic
1146864440 17:36328724-36328746 CTCCCGGCCCAGGGAGCAGCCGG + Intronic
1146872086 17:36383562-36383584 CTCCCGGCCCAGGGAGCAGCCGG - Intronic
1146879448 17:36434647-36434669 CTCCCGGCCCAGGGAGCAGCCGG - Intronic
1146907577 17:36627593-36627615 CACCAGGGCAAGGAGGCAGAAGG - Intergenic
1146937948 17:36824203-36824225 GGCCTGGGGCAGGGAGCAGAGGG - Intergenic
1147067298 17:37929312-37929334 CTCCCGGCCCAGGGAGCAGCCGG + Intronic
1147074972 17:37984186-37984208 CTCCCGGCCCAGGGAGCAGCCGG - Intronic
1147078831 17:38008873-38008895 CTCCCGGCCCAGGGAGCAGCCGG + Intronic
1147086497 17:38063732-38063754 CTCCCGGCCCAGGGAGCAGCCGG - Intronic
1147094768 17:38132808-38132830 CTCCCGGCCCAGGGAGCAGCCGG + Intergenic
1147102440 17:38187695-38187717 CTCCCGGCCCAGGGAGCAGCCGG - Intergenic
1147320603 17:39643590-39643612 CTCCTGGGCCAGCCAGCAGCAGG + Intronic
1147606267 17:41775510-41775532 CTCCAGGTCCAGGGTGGAGAGGG - Intronic
1147615521 17:41825115-41825137 CTCTTGGCCCTGGGGGCACATGG - Intergenic
1147661304 17:42118451-42118473 AGCCTGGGCCAGGCAGCAGAGGG + Intronic
1147883710 17:43670361-43670383 CTCCCAGGCCAGTGGACAGAGGG - Intergenic
1148101695 17:45096043-45096065 CTACCATGCCAGGGGGCAGAAGG + Intronic
1148283753 17:46370063-46370085 CTCCTGGGCCAGGGGGAGGCAGG + Intergenic
1148305971 17:46587980-46588002 CTCCTGGGCCAGGGGGAGGCAGG + Intergenic
1148758225 17:49985760-49985782 CTAGTGGGGCTGGGGGCAGAGGG - Intergenic
1149460896 17:56829494-56829516 CTCCTGGGGAAGGGAGCAGCAGG - Intronic
1149755644 17:59183232-59183254 CTGCTGGGACAGGGAACAGATGG - Intronic
1149847015 17:60014171-60014193 CTCCTGGCCCAGGGAGCAGCCGG - Intergenic
1150069465 17:62139154-62139176 CTCCCGGGCCAGGGTGGTGAAGG + Intergenic
1150085371 17:62270778-62270800 CTCCTGGCCCAGGGAGCAGCCGG - Intergenic
1150123144 17:62619754-62619776 CTCCTGGGACAGGGTGGAGGTGG + Intergenic
1150247978 17:63690299-63690321 CTCCTGGGCCAGGGTGCCTTCGG + Exonic
1150301994 17:64054753-64054775 GTCCTGGGCCATGGAGCTGAGGG - Exonic
1151425348 17:74027664-74027686 CTCCTGGAGCAGGGAGCATAAGG + Intergenic
1151448101 17:74180522-74180544 CTCCTGGGCCTGGGGGCTGATGG - Intergenic
1151529631 17:74696044-74696066 CTGCAGGGCCTGGGGGCTGAGGG - Intronic
1151569270 17:74917966-74917988 CTCCTGGGGAAGGGGGCTGCAGG + Exonic
1151611904 17:75182245-75182267 GTCCTGGGCCTGGGGGTAGGGGG - Intergenic
1151717724 17:75839987-75840009 CTCCTGGGGCTGGGCGCAGCCGG - Intronic
1151724970 17:75878372-75878394 CTCCTGGCACAGCGGGCAGCGGG + Exonic
1151894793 17:76972768-76972790 TTTCAGGGCCAGGGGGCGGAGGG - Intergenic
1152235219 17:79135111-79135133 ACCCTGGCCCAGGGGGCAGCAGG + Intronic
1152243119 17:79170413-79170435 CTCCAGGGCCAGGGGAGGGAAGG + Intronic
1152250687 17:79211150-79211172 GTCCTGGGCCACGGAGCAGACGG + Intronic
1152314797 17:79573878-79573900 GTCCTGAGCCAGGGAGGAGAAGG - Intergenic
1152318777 17:79596363-79596385 CCCCAGGGCCTGGGGGCAGAGGG - Intergenic
1152542267 17:80982275-80982297 CTCCTGGGCCAGGCAGCCGTGGG + Intergenic
1152581541 17:81167549-81167571 TGCTTGGGCCACGGGGCAGATGG + Intergenic
1152768515 17:82153767-82153789 GTCCTAGGCGTGGGGGCAGATGG - Intronic
1152774685 17:82193660-82193682 CTGATGGCCCAGGGAGCAGAGGG - Intronic
1152791485 17:82282711-82282733 CTCATGGGCTAGGTGGGAGAAGG - Intergenic
1152848253 17:82615820-82615842 CTCCTGGGCCACGGGCTGGAGGG - Exonic
1153222956 18:2878028-2878050 TTCCAGGGACTGGGGGCAGAGGG + Intronic
1155730740 18:29154771-29154793 TTCCTGGGCAAGTGGCCAGAGGG + Intergenic
1156902642 18:42319452-42319474 CTGATGGGGCAGGGGGCAGGGGG - Intergenic
1157257637 18:46153006-46153028 CCCCTGGGGCAGGCGGCAGCGGG - Intergenic
1157576404 18:48746737-48746759 CTCCTGGGTCAGGGGCCAGGGGG - Intronic
1158125024 18:54091765-54091787 CCCCTGGGCTCTGGGGCAGATGG + Intergenic
1160340607 18:78085726-78085748 CTCATGGCCCAGGGGGCAGCTGG + Intergenic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1160555341 18:79721010-79721032 CGCCTGGGGCAGGGTCCAGAAGG + Intronic
1160659794 19:292539-292561 TTGCTGGGGCAGGGGGCTGATGG - Intergenic
1160727223 19:622699-622721 CTCCCGGGCCAGGGTGGTGAAGG + Exonic
1160820351 19:1054929-1054951 CTCCCTGGCCAGGGACCAGATGG - Intronic
1160824817 19:1074633-1074655 CTCCAGGGCCAGCGAGTAGATGG - Exonic
1160951097 19:1667769-1667791 CTCCTGGCCCAGGGCGCCGTGGG + Intergenic
1161137685 19:2629741-2629763 CTCGTGGGCATGGGGTCAGAGGG - Intronic
1161304031 19:3557195-3557217 CTGCTGGGCCAGGTGGCCGACGG - Exonic
1161566516 19:5005751-5005773 CTACAGGGCCACGGGGGAGAAGG + Intronic
1161569676 19:5023631-5023653 CTCCTGGGACAGGGACCAGTGGG + Intronic
1161855661 19:6763557-6763579 CTATTGGGACAGGTGGCAGAGGG - Intronic
1161994395 19:7703624-7703646 CACCTGGTCCAGGGGGAAGAGGG - Intergenic
1162327068 19:10005816-10005838 CTGCTGGGGGAGGGGGCGGAAGG + Exonic
1162520729 19:11178026-11178048 CTCCTGGTCCAGTGGGGAGCTGG - Intronic
1162958353 19:14112299-14112321 CTCCCTGGCCAGGGGGCAGAAGG - Intronic
1163664558 19:18597165-18597187 GTCCTGGGGGTGGGGGCAGAGGG - Intronic
1164722734 19:30444269-30444291 CTGCAGGGCCAGGGTGCAGGCGG - Exonic
1164779475 19:30880853-30880875 GCCCTGGGGCAGGGGGCACAGGG + Intergenic
1164907233 19:31977414-31977436 GACCAGGGCCAGAGGGCAGAGGG - Intergenic
1165175905 19:33929556-33929578 CACCTGGGCCAGGGGCCGCACGG + Intergenic
1165889132 19:39100207-39100229 CTCCTGGGGGAGGGGGCGGAAGG - Exonic
1165924454 19:39318628-39318650 CTCTTGGGTCAGAGGGAAGAGGG - Intergenic
1166048809 19:40245880-40245902 CCCCAGGGCCAGGGCGCAGCAGG + Intronic
1166081057 19:40444330-40444352 CTGGTGGGCCAGAGGCCAGACGG - Exonic
1166257742 19:41618574-41618596 CTCCAGGGCCTGGGTGAAGAGGG + Intronic
1166309917 19:41957111-41957133 CCTCTCGGCCTGGGGGCAGATGG + Exonic
1166313323 19:41975505-41975527 CTCCAGGGCCAGGGGGCCTGTGG + Intronic
1166373674 19:42315607-42315629 CTCCTGGGTCCTGGGGGAGAAGG + Intronic
1166388645 19:42396693-42396715 CTCCTGGGTCAGAGGGAGGAGGG - Intergenic
1166407516 19:42531613-42531635 CACCTGGGCCTGGGTGAAGAGGG + Intronic
1166502675 19:43353403-43353425 CTCCTGGGTCTGAGGGCGGAGGG + Intergenic
1166523938 19:43499327-43499349 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1166525347 19:43507098-43507120 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1166532712 19:43552476-43552498 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1166566234 19:43767214-43767236 CCCCGAGGCCAGGGGGCAGGAGG + Intronic
1166567805 19:43775771-43775793 CTCCTGGGTCTGGGGCAAGAGGG + Intronic
1166662148 19:44654170-44654192 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1166685463 19:44793728-44793750 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1166695831 19:44851098-44851120 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1166794862 19:45420067-45420089 CTCCTGGGTCCGGGGGAGGAGGG - Intronic
1167043889 19:47039057-47039079 CTCCTGGACCAGGGAGGAGGGGG - Exonic
1167265799 19:48482732-48482754 CTCCTGGGTCTGAGGGAAGAAGG - Intergenic
1167292706 19:48633280-48633302 CTCCTTGGCCACGGGGCACAAGG - Intronic
1167298285 19:48664397-48664419 CTCCTGGGTCTGAGGGAAGAGGG - Intronic
1167314796 19:48756991-48757013 TTCCTGTGCCAGCGGCCAGATGG + Exonic
1167327632 19:48835456-48835478 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1167327682 19:48835603-48835625 CTCCTGGGTCTGAGGGCAGAGGG + Intronic
1167495899 19:49818630-49818652 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1167592045 19:50409384-50409406 CTTCTGGCCAAGGGGGCAAAAGG - Intronic
1167618387 19:50548517-50548539 ATGCGGGGCCAGCGGGCAGAGGG - Intronic
1167678850 19:50906834-50906856 CTCCTGGGCCTGAGGGAGGAGGG + Exonic
1167689143 19:50974956-50974978 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167690877 19:50983181-50983203 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1167738300 19:51310675-51310697 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1167743382 19:51337717-51337739 CTCCTGGGTCTGAGGGAAGAGGG + Intronic
1167752196 19:51387868-51387890 CTCCTGGGACTTGGGGAAGAGGG + Intronic
1167785025 19:51629485-51629507 CTCGGGGTCCAGGGGGCTGAGGG + Exonic
1167787126 19:51645909-51645931 CTCGGGGTCCAGGGGGCTGAGGG + Exonic
1168107245 19:54172611-54172633 CTCCTGGGCCTGAGGGAGGAGGG - Intronic
1168107710 19:54174480-54174502 CTCCTGGATCTGGGGGCAGTGGG - Intronic
1168238167 19:55076292-55076314 CTCCTGGGCCTGAGGGAGGAGGG + Intronic
1168238521 19:55078266-55078288 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238559 19:55078377-55078399 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238573 19:55078414-55078436 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238587 19:55078451-55078473 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238601 19:55078488-55078510 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238615 19:55078525-55078547 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238629 19:55078562-55078584 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238640 19:55078599-55078621 CTCCTGAGTCAGAGGGAAGAGGG + Intronic
1168238654 19:55078636-55078658 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238668 19:55078673-55078695 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238682 19:55078710-55078732 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238696 19:55078747-55078769 CTCCTGGGTCAGAGGGAGGAGGG + Intronic
1168238710 19:55078784-55078806 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168238739 19:55078858-55078880 CTCCTGGGTCAGAGGGAAGAGGG + Intronic
1168254592 19:55158430-55158452 CTCCTGGGTCTGAGGGGAGAGGG - Intronic
1168277433 19:55285372-55285394 CTCCAGGGCCAGGGAGGGGATGG + Intronic
1168311686 19:55463907-55463929 CTCCTGGGACAGGATGGAGAGGG + Intergenic
1168325927 19:55538181-55538203 CTCCTGGGCCTGAGGGTGGAGGG + Intergenic
1168325941 19:55538219-55538241 CTCCTGGGCCTGAGGGAGGAGGG + Intergenic
1168343932 19:55641370-55641392 CCCCAGGGCCAGGGGACAGGCGG + Intronic
1168703170 19:58453500-58453522 CTCCTGGTCCAGGCCCCAGATGG - Intronic
925680476 2:6415806-6415828 CTCCAGGGCCAGGTGGAAGGAGG + Intergenic
925969001 2:9093989-9094011 CTCATGTGGCAGGGTGCAGACGG - Intergenic
927427107 2:22993851-22993873 ACACTGGGCCAGGGGTCAGAAGG + Intergenic
927936144 2:27078012-27078034 CTGCTGGGCCAGGGAGGAAAAGG - Intergenic
928083366 2:28329189-28329211 TTCCTGAGCTAGAGGGCAGAGGG + Intronic
928172486 2:29012422-29012444 CTCCCGGGCCAGGCTGCAGCAGG + Intronic
928362840 2:30679564-30679586 ATCCTGGGCTAGGAGGCACAGGG + Intergenic
929561624 2:42959949-42959971 CTCCTGGGCCAGAGGCCAGATGG - Intergenic
930024164 2:47020332-47020354 CTCCTAGGCCACGTGGCAGCAGG - Intronic
930103570 2:47621214-47621236 CTCCTGGGCCAGTGGCAAGATGG - Intergenic
932308668 2:70722493-70722515 CTACTGGGTCAGGGAGCTGAAGG + Intronic
932573146 2:72948750-72948772 CTCCTGGGGGAGGTGGCTGAGGG + Intronic
932767921 2:74482826-74482848 CGCCTGGGCCATGGGGCGGCGGG + Exonic
933724816 2:85420772-85420794 TTCCTGGGCCCGGAGGCTGACGG - Intronic
934117602 2:88811759-88811781 CTCCTGGGCAGCGGGGCTGAGGG - Intergenic
934654892 2:96112333-96112355 CCCATGGGCAGGGGGGCAGATGG - Intergenic
934706580 2:96485693-96485715 CTCCTAAGCCTGGAGGCAGAGGG - Intergenic
935482697 2:103613117-103613139 AGGCTGGGCCATGGGGCAGAGGG + Intergenic
936161260 2:110085822-110085844 CTCCTGGGCAGTGGGGCTGAGGG - Intronic
936183403 2:110285532-110285554 CTCCTGGGCAGTGGGGCTGAGGG + Intergenic
938240772 2:129741022-129741044 ACCCTGGGCCAGGGAGCAGCTGG + Intergenic
941463022 2:165793819-165793841 GCCCTGGGCCAAGGGGCAGGTGG - Intronic
942292495 2:174486742-174486764 CCGCGGGGCCAGGGCGCAGAGGG + Intronic
942354861 2:175099510-175099532 TTCCAGGGCCAGGGAGTAGAAGG - Intronic
942792775 2:179779714-179779736 TAGCTGGGCCTGGGGGCAGAGGG + Intronic
944540147 2:200746773-200746795 TGCCTGGGCCAGGGGCAAGATGG - Intergenic
946167991 2:217877125-217877147 CTCCTGGGCCAGGAGGAGGGGGG - Intronic
946176898 2:217927809-217927831 TTCCTGGGGCAGGGCCCAGAGGG - Intronic
946396203 2:219444904-219444926 CTGGTGGGGCAGCGGGCAGACGG + Exonic
946418413 2:219551969-219551991 CTCCTGGGCCGGGTCACAGAGGG - Intronic
946639225 2:221765529-221765551 GTTCTGGGAGAGGGGGCAGAAGG + Intergenic
946756530 2:222953132-222953154 GTCCAGGGCCAGGGGCCAGGAGG - Intergenic
947543760 2:230996141-230996163 CTCCTAGGGCAGAGGGCAAACGG + Exonic
947752662 2:232540884-232540906 CTGCTGGCCCTGGGGTCAGAGGG - Intronic
948341193 2:237253655-237253677 GTCTTGGGGCAGGGGGCAGAGGG - Intergenic
948398338 2:237663852-237663874 CGCCTGGGCCATAGGGGAGAGGG + Intronic
948705479 2:239789718-239789740 CTCCAGGGCCAGGGGCCTGCAGG - Intronic
949017460 2:241721438-241721460 CCCCTGTGCCAGAGGGCAGCGGG + Intronic
1169117007 20:3072296-3072318 CTCCGGGGCCAGGGGGAGGCGGG + Intronic
1169391006 20:5191082-5191104 CTCATCGGGCAGGGAGCAGAGGG + Exonic
1169500746 20:6158159-6158181 CTCCTGGACCAGTGGTCAGCTGG + Intergenic
1169801480 20:9516136-9516158 CTCCGAGCCCAGCGGGCAGAGGG + Intronic
1170339088 20:15303313-15303335 CTGCTGGGGCAGGGAGTAGATGG - Intronic
1170408906 20:16067433-16067455 CTGCAGGGCCAAGGGGCAAATGG - Intergenic
1171181774 20:23096265-23096287 CTCCTGAGCCAGGTGTCAGCTGG - Intergenic
1172121892 20:32603385-32603407 CTCCTTGGCCTGGGGACAGTTGG + Intronic
1172701594 20:36856549-36856571 CTCCTGGGCCCAGGGCCAGTGGG - Intronic
1172742502 20:37179681-37179703 CTTCTGGGCCAGGCGGCCTAAGG + Intronic
1173483578 20:43423309-43423331 CTCCTGGGATATCGGGCAGATGG + Intergenic
1173642675 20:44614934-44614956 GACCTGGGCTAGGGGGCAGGGGG - Intronic
1174159182 20:48538565-48538587 CTCCTGGGCATGGGGCCAGAGGG + Intergenic
1174172168 20:48624525-48624547 CTCCCAGGCCTGGGGGCAGCAGG + Exonic
1174214196 20:48903774-48903796 CCCCTGGGCCCAGCGGCAGAGGG - Intergenic
1174271665 20:49373828-49373850 CTTCTGTGCGAGTGGGCAGAGGG + Exonic
1174397872 20:50259101-50259123 TGGCTGGGCAAGGGGGCAGAGGG - Intergenic
1174686925 20:52465148-52465170 CTCCAGGCTCATGGGGCAGACGG - Intergenic
1175349868 20:58309967-58309989 CTCCCGGGCCATGGCGCTGAGGG + Exonic
1175722010 20:61293297-61293319 CTCCTGGGACGGGTGGCAGGAGG + Intronic
1175873415 20:62218870-62218892 CCCCTGGGCCTGGGGGCAGGAGG + Intronic
1176115514 20:63430291-63430313 CTCCTGGCCCCAGGGGCAGCAGG + Intronic
1176214043 20:63939920-63939942 GTCCTGGGTCAGGAGGCAGGAGG + Exonic
1176297898 21:5084013-5084035 TTCCAGGGCCTGAGGGCAGAGGG - Intergenic
1176361397 21:5999739-5999761 CTCCTGGGGCATGGTGCAGATGG + Intergenic
1177120596 21:17132821-17132843 CTCCTGGGGCAGACAGCAGAGGG + Intergenic
1178065085 21:28895737-28895759 TTCCATGGCCAGGAGGCAGAGGG - Intergenic
1178538728 21:33431652-33431674 CACTTGGACCAGGAGGCAGAGGG - Intronic
1178915067 21:36701447-36701469 CTCCTGGGCCGGGGAGCCGCGGG - Intronic
1179191982 21:39131108-39131130 CTTCTGGGCCAGGGGTTTGAAGG - Intergenic
1179505800 21:41839538-41839560 CTGGCGGGGCAGGGGGCAGAGGG - Intronic
1179716255 21:43290278-43290300 CTCCAGGGCCAAGGGCCAGCAGG - Intergenic
1179762121 21:43538811-43538833 CTCCTGGGGCATGGTGCAGATGG - Intronic
1179791064 21:43756297-43756319 CTCCTGGGCCTCCGGGAAGACGG + Exonic
1179859131 21:44177936-44177958 TTCCAGGGCCTGAGGGCAGAGGG + Intergenic
1179888671 21:44325314-44325336 CCCCTGGGGCCGGGGACAGATGG - Intronic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1180062480 21:45392787-45392809 CTGCTGGGCCTGTGGGCAGAGGG + Intergenic
1180193862 21:46182228-46182250 CTCCTGGGTCAGGGGCGAGGGGG - Intronic
1180949756 22:19715695-19715717 GTCCTGGCCCAGGGTGCAGCAGG + Intronic
1180950714 22:19719280-19719302 CTCCTCGGGCAGAGGGCAGCAGG - Intronic
1181403983 22:22668865-22668887 CTCCTGGGGCTGGAGGAAGAAGG - Intergenic
1181406828 22:22690786-22690808 CCCCTGGGACATGGAGCAGAGGG - Intergenic
1181491529 22:23263269-23263291 CACCTGGGCCAGGCGGCCGAGGG - Intronic
1181514565 22:23403338-23403360 CTCATGGGGCAGGGGGGAGGGGG + Intergenic
1181601422 22:23954019-23954041 CTGCTGGGCCATGTGGCAGACGG + Intergenic
1181607085 22:23987318-23987340 CTGCTGGGCCATGTGGCAGAAGG - Intergenic
1181627200 22:24130087-24130109 CTCCTGTGACAGAGGGCAGATGG - Intronic
1181629635 22:24143822-24143844 CTGATGGCCCAGGGGGCAGAGGG - Intronic
1181689030 22:24548133-24548155 CTCTTGGGCCAGTGGGTGGAGGG - Intronic
1181695944 22:24592852-24592874 CTCCTGCGCCAGGCGAGAGAAGG - Exonic
1181951830 22:26559556-26559578 CTCCTGGGGCTGGGAGGAGAAGG - Intronic
1182315147 22:29440982-29441004 CTCCAAGGCCAGGAGGAAGAGGG - Intronic
1184108344 22:42381499-42381521 GTCAGGGGCCAGTGGGCAGAGGG + Exonic
1184466601 22:44672175-44672197 CCTCTGGGGCAGGGGACAGAAGG - Intronic
1184597978 22:45525810-45525832 TTCCTGGGCCAGGAGGGAGGTGG + Intronic
1184691729 22:46120335-46120357 CTCCTGGCCCAGGCAGCAGGGGG - Intergenic
1184880581 22:47301991-47302013 CAGCAGGGCCAGGGGGCATAGGG + Intergenic
1185173194 22:49305237-49305259 CCCCTGGCTGAGGGGGCAGAGGG - Intergenic
1185279959 22:49965802-49965824 CTCCTGAGTCAGGGGGTGGAGGG - Intergenic
949217047 3:1583082-1583104 CTCCTGGCCCAGGAGTCAGCAGG - Intergenic
949281490 3:2352529-2352551 CACCTGGGCCAACGGGCGGAGGG + Intronic
950422419 3:12906747-12906769 CTGCTGGGCCCTGGGGCGGATGG + Intronic
950423243 3:12910892-12910914 CTCCTGGGCTGGGGAGCAGGGGG - Intronic
950475362 3:13211427-13211449 GACCTGGGGCAGGGGGCAGAGGG - Intergenic
950662436 3:14474851-14474873 GTCCTGGGCAAGGGAGCAGGGGG + Intronic
953576396 3:44116217-44116239 GCCCTGGGGCAGGGGCCAGAGGG - Intergenic
953609979 3:44439474-44439496 ATGCTGGGGCAGGGAGCAGAAGG - Intergenic
954033494 3:47837233-47837255 CTGCTGGGCCATGCGGTAGACGG + Intronic
954108719 3:48422661-48422683 CTCCTGGCCCAGGGGTCACAGGG + Intronic
954289285 3:49640877-49640899 AAGCTGGGCCAGGGGGCAGAGGG + Intronic
954440601 3:50519808-50519830 CTGCTGGACCAGGGGGCTGGAGG - Intergenic
954610918 3:51944069-51944091 CACCTGGGCCAGAGGGGAGGTGG - Exonic
954660548 3:52224656-52224678 CTCCTGAGCAAGGTGGCAGCTGG + Intronic
954679978 3:52339952-52339974 CTTATGGGACAGGAGGCAGAAGG - Intronic
954806744 3:53225042-53225064 CTCCTGGGCCAGTTGTCACATGG + Intronic
954885462 3:53869621-53869643 CATCTGGTCCAGGGAGCAGAAGG + Intronic
955080035 3:55649930-55649952 CAGGTGGGCCAGGAGGCAGAGGG + Intronic
955779735 3:62471690-62471712 GTGCTAGGCCAGGGTGCAGAAGG - Intronic
960246301 3:115404059-115404081 CTTCTGGGGCAGGGGGCCTATGG + Intergenic
960689090 3:120324690-120324712 GTCCTGGGGGAGGGGGAAGAAGG + Exonic
960702430 3:120451197-120451219 CTCCACGTCCAGGGGGCCGAAGG - Exonic
960965357 3:123100617-123100639 CCCCTGGGCCTGGGGGTGGAAGG + Intronic
961128761 3:124446080-124446102 CACCTGGGCCGTGGGGCTGAAGG + Intronic
961317658 3:126051490-126051512 TCCCTGGACCTGGGGGCAGAGGG - Intronic
961360837 3:126366141-126366163 CTCCCAAGCCAGGGGGCAGCAGG - Intergenic
961482716 3:127194619-127194641 CTCCTGGAAAAGGGGGCAGGAGG - Intronic
961563784 3:127749004-127749026 TCCCTGGGGAAGGGGGCAGAGGG - Intronic
961788097 3:129359431-129359453 GACCTGGGGCAGGGGGCAGAGGG + Intergenic
961808998 3:129510649-129510671 CACCTGGGGCATGGGGCTGAGGG + Intronic
962274572 3:134002291-134002313 CCCCTGGGCCAGGAGGCAGGAGG - Intronic
962729260 3:138264979-138265001 CACTTGGGCCGGGGGGCACAAGG - Intronic
964469740 3:157040064-157040086 GCCTTGGGCCATGGGGCAGAAGG + Intronic
966903060 3:184500946-184500968 CTGCTGTGCCAGCTGGCAGATGG - Intronic
967098139 3:186194055-186194077 CTCCCGGGCCTGGGTTCAGACGG - Intronic
968107147 3:196009291-196009313 TGCCGGGGGCAGGGGGCAGAGGG - Intergenic
968286717 3:197513201-197513223 CTCCTGGCCCTGGGAACAGAGGG + Intronic
968573418 4:1354093-1354115 CACCAGGGCCAGGAGGCAGCCGG + Intronic
968742703 4:2339584-2339606 CTCCTTGGCCAGCGGGCGCATGG + Exonic
968843999 4:3029647-3029669 CTGCTGGGCCAGGAGACAGGTGG - Intronic
968844011 4:3029700-3029722 CTGCTGGGCCAGGAGGCAGGTGG - Intronic
969121685 4:4915587-4915609 CTGCTGGGTCGGGGGGCAGGTGG + Intergenic
969584758 4:8085250-8085272 TTGCTGGGCCGGGGGGCAGCAGG - Intronic
969617236 4:8261003-8261025 CTGCTGGGCCTGGGTGCACAGGG + Intergenic
970725669 4:19041587-19041609 CACCTGGTCTAGGAGGCAGAGGG - Intergenic
971028366 4:22610407-22610429 CTACTGAGCTAGGGGGCAAACGG + Intergenic
971442479 4:26702866-26702888 CTGCTGGGCCCGGGGGCAGGGGG - Intronic
971834590 4:31747670-31747692 CTGCTGGCCAAGTGGGCAGAAGG - Intergenic
972590436 4:40481000-40481022 CTCCTGAGCCAGGAGGAACAAGG + Intronic
973889751 4:55357147-55357169 ATGCTGGGTCAGGGGACAGAGGG - Intronic
981716562 4:147757916-147757938 CACCAGGGCCAGGGAGAAGAGGG + Intronic
982471988 4:155803694-155803716 GTCCAAGGCCAGGTGGCAGATGG - Exonic
984688377 4:182697276-182697298 TTCATGTGCCAGGAGGCAGAGGG - Intronic
985071676 4:186171623-186171645 GTCCTGGCCCAGGAGGCTGAGGG - Intronic
985639943 5:1058916-1058938 CTCCTGGGCCAGGTGGGGGTTGG - Intronic
985778707 5:1858551-1858573 CTCCTGGCCCAGGGAGGAGTGGG - Intergenic
986272526 5:6246313-6246335 ATCATGGGCCAGTTGGCAGAGGG - Intergenic
986517801 5:8581661-8581683 AACCTGGGCAAAGGGGCAGATGG - Intergenic
988415461 5:30941483-30941505 TTCGTGGGGAAGGGGGCAGAAGG + Intergenic
990926972 5:61036925-61036947 TTTCTGGGGCAGGGGTCAGAAGG + Intronic
991003206 5:61803517-61803539 CTCCTTGGCTCGGGGGCAGGAGG + Intergenic
991298130 5:65102842-65102864 CTCCTGTGCCTGGGTGTAGATGG + Intergenic
992765094 5:79991125-79991147 CTCGCGGGCCAGGGCGCAGGAGG - Intronic
992894637 5:81235475-81235497 CTCCTCAGCCAGAGGGCAGGTGG - Intronic
993324754 5:86519876-86519898 ATCCTGGGGGAGGGGGAAGAAGG - Intergenic
993605637 5:89987557-89987579 CACCTTGGGCAGAGGGCAGAGGG + Intergenic
994773664 5:104016147-104016169 CTCCTAGGCTTGGAGGCAGATGG - Intergenic
996117335 5:119633201-119633223 CTCCTTGGGTAGGGGGCAGGAGG + Intronic
996790608 5:127290091-127290113 CTCCTCGGCGAGTCGGCAGAGGG + Intergenic
997337456 5:133118309-133118331 CCCCTGGGGCAGGAGGGAGAGGG + Intergenic
997790112 5:136751491-136751513 GTCCTGGGGTAGGGGGCAGAGGG - Intergenic
997848360 5:137308614-137308636 CCCCTGGGCTAGGGGTCACACGG - Intronic
998157921 5:139796612-139796634 CTGCTGGGGCTGGGTGCAGAGGG + Intronic
998193108 5:140043339-140043361 CTACTCGGTCCGGGGGCAGAGGG - Intergenic
999329574 5:150663193-150663215 CTCCTGGGTCTGTGGACAGATGG - Intronic
999368454 5:151038255-151038277 CACCAGGGTCAGGAGGCAGAGGG + Intronic
999961816 5:156764041-156764063 TTCTTGGGACAGGGGGAAGAGGG - Intronic
1001306689 5:170579776-170579798 CTGCTGGGCCAGGGCTTAGAGGG + Intronic
1002199218 5:177517637-177517659 GTCCTGGGCCAGGGCGCTGCAGG + Intergenic
1002199312 5:177518360-177518382 GTCCTGGGCCAGGGCGCTGCAGG + Intergenic
1004309798 6:14535131-14535153 CCCTTGGGCCAGGCGGGAGAAGG + Intergenic
1005243017 6:23853857-23853879 CACCTGGGCCAGGCGCCAGGTGG + Intergenic
1005799963 6:29410590-29410612 CTCCAGGGCCTGGGGACACAAGG - Intronic
1006630520 6:35427098-35427120 CTACTGGGCAGGGGGGCAGTGGG - Exonic
1006940343 6:37747936-37747958 CTTCTGGGCCATGTGGTAGAGGG - Intergenic
1006950958 6:37820272-37820294 CTCCTGGGCCACGGGTGAGGGGG + Intronic
1006974885 6:38090476-38090498 TTCCTGGGGCAGGGGACAAAAGG + Intronic
1006987463 6:38185409-38185431 GTTCTGGGCCAGGGTGCAGCTGG + Intronic
1007423480 6:41733574-41733596 CCCCGCGGCCAGGAGGCAGACGG + Intronic
1007574393 6:42915869-42915891 CTCACGGGCCAGGGAGCACAGGG - Intergenic
1007575917 6:42925204-42925226 CTCCTGGGGTAGGGGGCTGCGGG + Intronic
1008215416 6:48782460-48782482 CGCCGGGGCCAGGGGGTGGAGGG + Intergenic
1008680269 6:53864492-53864514 TTCCTCGGCCACGAGGCAGATGG + Intronic
1010252887 6:73726891-73726913 CTCCTTGACCAGAGGGCACAGGG - Intronic
1013174275 6:107663966-107663988 TTCCTGGGGTAGGGAGCAGACGG + Intergenic
1014047686 6:116912179-116912201 CTGCTGGGGAAGGGGGAAGAGGG + Intronic
1015244487 6:131062396-131062418 CTCCTGCGCCTGGGGGCCGAGGG - Intronic
1015512253 6:134049435-134049457 CTCCTGGGCCAGAGGCCACCAGG + Intronic
1016710314 6:147164020-147164042 CACCTGAGCCAGGGGGATGATGG + Intergenic
1016907832 6:149169140-149169162 CACCTGGGCCAGGGGGGATTAGG + Intergenic
1017615242 6:156240368-156240390 CTCCTGGGCCAGGGACCCAAAGG - Intergenic
1017823007 6:158062248-158062270 CTGCTGGGTGAGGCGGCAGAGGG + Intronic
1017840912 6:158222312-158222334 CTGCTGGGCCAGGGACCACATGG + Intergenic
1018294261 6:162328836-162328858 TTCCTGGGCCAGAGAGCAGGGGG + Intronic
1018483962 6:164221096-164221118 CTCCTGGGGCATGTGGCATAAGG + Intergenic
1018892064 6:167989653-167989675 CTCCTGGGCCGGGACGCAGGCGG + Intergenic
1019051833 6:169189496-169189518 CTCCTGGGCTAGGGAGCGCAGGG + Intergenic
1019153750 6:170025535-170025557 TTCCTGGGACAGGGGTCAGAAGG + Intergenic
1019232922 6:170584160-170584182 CTCCTGGGGCAGCGCGGAGAGGG + Intronic
1019436424 7:1024629-1024651 CTTGTGGGCCAGGTGGCAGCGGG - Intronic
1019511834 7:1421616-1421638 CCCGAGGGCCAGGGGGCAGATGG + Intergenic
1020045644 7:5038194-5038216 CTGCTGGGACAGGGAACAGAGGG - Intronic
1020052203 7:5089101-5089123 CTCCCAGGCCTGAGGGCAGAAGG - Intergenic
1020220505 7:6232955-6232977 CAACTGAGCCAAGGGGCAGAGGG - Intronic
1020291044 7:6722393-6722415 CTGCTGGGACAGGGAACAGAGGG - Intergenic
1022445024 7:30463017-30463039 TTCCTGAGGCAGGGGGCAGATGG + Intronic
1022529393 7:31057589-31057611 CTCCTGGGCCAGGGGCCTCCCGG - Intronic
1023274036 7:38498933-38498955 CAACTGGGCCAGGAAGCAGAAGG - Intronic
1023622902 7:42091045-42091067 CCCCTGGGCCTGTGGTCAGAAGG + Intronic
1023824435 7:43999607-43999629 CTGCTGGGACAGGGAACAGAGGG + Intergenic
1023989459 7:45119421-45119443 CTGCTGGGCCAGGTGCCACAAGG + Intergenic
1024693296 7:51826627-51826649 CTGCTGGGGCAGGGGGACGAGGG + Intergenic
1025790062 7:64680662-64680684 CTGAAGGGCCAGGGGCCAGAAGG + Intronic
1026087984 7:67278371-67278393 CTGCTGGGACAGGGAACAGAGGG + Intergenic
1026450705 7:70526722-70526744 ATCACAGGCCAGGGGGCAGAGGG - Intronic
1026726257 7:72871902-72871924 CTGCTGGGACAGGGAACAGAGGG - Intergenic
1026748111 7:73028318-73028340 CTGCTGGGACAGGGAACAGAGGG - Intergenic
1026751759 7:73056463-73056485 CTGCTGGGACAGGGAACAGAGGG - Intergenic
1026755408 7:73084590-73084612 CTGCTGGGACAGGGAACAGAGGG - Intergenic
1026759058 7:73112604-73112626 CTGCTGGGACAGGGAACAGAGGG - Intergenic
1027034314 7:74913632-74913654 CTGCTGGGACAGGGAACAGAGGG - Intergenic
1027088350 7:75280869-75280891 CTGCTGGGACAGGGAACAGAGGG + Intergenic
1027091992 7:75308797-75308819 CTGCTGGGACAGGGAACAGAGGG + Intergenic
1027095635 7:75336764-75336786 CTGCTGGGACAGGGAACAGAGGG + Intergenic
1027117587 7:75493706-75493728 CTGCTGGGACAGGGAACAGAGGG + Intergenic
1027274217 7:76541779-76541801 CTGCTGGGACAGGGAACAGAGGG - Intergenic
1027323706 7:77030922-77030944 CTGCTGGGACAGGGAACAGAGGG - Intergenic
1029259650 7:99293106-99293128 ACCCTGGGCCAGGCAGCAGAGGG + Intergenic
1029395740 7:100307488-100307510 CTGCTGGGACAGGGAACAGAGGG + Intergenic
1029596029 7:101538056-101538078 CTCCTGGGGCTGGGGGCAGGAGG - Intronic
1029692201 7:102189962-102189984 CTGCTGAGCCAGAGGGCAGGGGG - Intronic
1029715510 7:102323315-102323337 CACCAGGGCACGGGGGCAGAAGG - Intergenic
1030371819 7:108708842-108708864 CTCCTGGGCGGGGAGGGAGAGGG - Intergenic
1030675863 7:112384775-112384797 CTCCTGGGCCAGGAAGCTGAAGG + Intergenic
1031012643 7:116539746-116539768 CTCCTGGGTCATGGGGGATAAGG + Intronic
1031206432 7:118764079-118764101 CTCCTGGGGAAGTGAGCAGAGGG + Intergenic
1031688717 7:124764206-124764228 CTCCTGGGTCAGCGGGTAGAAGG + Exonic
1031754236 7:125618168-125618190 TTCTTGGGCCACTGGGCAGATGG + Intergenic
1032195280 7:129785058-129785080 CTCTTGGGTCTGGGTGCAGAGGG - Intergenic
1032493915 7:132346654-132346676 CTCCTGCTACAGTGGGCAGATGG - Intronic
1034256185 7:149725813-149725835 CTCCTGGGCCATGGGGTGCACGG - Intronic
1034285351 7:149880207-149880229 GCCCAGGGCCAGGGGGCAGAGGG - Exonic
1035374103 7:158395939-158395961 CTCTGTGACCAGGGGGCAGAGGG - Intronic
1035625972 8:1070909-1070931 CTCCAGGATCAGGAGGCAGAGGG + Intergenic
1036165726 8:6431020-6431042 CACCTGGGCCTTGGGGCTGATGG + Intronic
1036616853 8:10394706-10394728 CTGCTGGGGCAGAGTGCAGAAGG - Intronic
1036705271 8:11041744-11041766 GGCCTGGGCCAGATGGCAGAGGG - Intronic
1036719708 8:11162309-11162331 CTTCAGGGCCAAGGGGGAGAAGG - Intronic
1037316994 8:17608494-17608516 ATCCTGGGGAAGGAGGCAGAGGG + Intronic
1037802409 8:22042879-22042901 CTCCTGAGCTTGGGGGCAGGGGG + Exonic
1038443022 8:27584810-27584832 CTCTAGGGGCAGGGGACAGAGGG - Intergenic
1038485852 8:27934733-27934755 CCCCTGGAGCAGGGGGCAGGAGG + Intronic
1040725755 8:50379438-50379460 CTCCTGGGCCCTGGAGCAGGAGG - Intronic
1044430497 8:92102200-92102222 CTCCTGGGTGAGCGGGCGGACGG - Intronic
1044692439 8:94894608-94894630 CTCCTGGACCAGCGGGGAGAGGG + Intronic
1045112502 8:98948240-98948262 CTCCTGGGCCAGAGGGCCCTGGG - Exonic
1046819506 8:118620689-118620711 CTCCTGGGGCAGGGAGGAGAGGG + Intronic
1048453047 8:134550972-134550994 CTACTGAACCAAGGGGCAGAGGG - Intronic
1048867120 8:138769418-138769440 CTCCTTGGGAAGGGGGAAGATGG + Intronic
1048996018 8:139794158-139794180 CTCCTGGGGCAGGTGGCACGGGG - Intronic
1049191837 8:141292566-141292588 CTCCAGGCCCAAGGGGCACACGG - Intronic
1049480343 8:142819586-142819608 CTCCTGGCCCAGGAGGCAGCTGG - Intergenic
1049536864 8:143186492-143186514 CACCTGGGCAGGGGGGAAGACGG - Intergenic
1049586579 8:143435231-143435253 CTTCTGGGCTAGGGGGCTGCTGG + Intergenic
1049820886 8:144632564-144632586 CCCCTGGGGCAGGGGACTGACGG - Intergenic
1052854424 9:33398292-33398314 GGCCAGGGCCAGGTGGCAGAAGG + Intronic
1053166383 9:35846659-35846681 CTGCTGGGCCTGTGGGCAGGCGG + Intronic
1053309197 9:37005161-37005183 CTGCTGGGCTAGGGTGAAGAGGG - Intronic
1053449324 9:38180004-38180026 CTGCTGGGCCAGCAGGGAGATGG + Intergenic
1053682429 9:40494453-40494475 GGCCAGGGCCAGGTGGCAGAAGG + Intergenic
1053932412 9:43122779-43122801 GGCCAGGGCCAGGTGGCAGAAGG + Intergenic
1054281285 9:63130476-63130498 GGCCAGGGCCAGGTGGCAGAAGG - Intergenic
1054295528 9:63329953-63329975 GGCCAGGGCCAGGTGGCAGAAGG + Intergenic
1054393548 9:64634457-64634479 GGCCAGGGCCAGGTGGCAGAAGG + Intergenic
1054428197 9:65139671-65139693 GGCCAGGGCCAGGTGGCAGAAGG + Intergenic
1054502183 9:65881873-65881895 GGCCAGGGCCAGGTGGCAGAAGG - Intronic
1055564998 9:77559422-77559444 CTTCTGGGCCAGAGGACATAGGG + Intronic
1055605051 9:77960451-77960473 CTCCAGGGCCAGGGGTAACAGGG - Intronic
1056253369 9:84773323-84773345 CTCCATTGCCATGGGGCAGATGG + Intronic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057180407 9:93026780-93026802 CCCATGGGGCAGGGGGCAGCAGG - Intronic
1057726562 9:97572438-97572460 CTCCAGGACCAGGGGGCTGTGGG + Intronic
1058650922 9:107175105-107175127 CTCCTAGGAAAGGTGGCAGATGG + Intergenic
1059311104 9:113389619-113389641 CTCGTGCTCCAGGGGGCAGCTGG + Exonic
1059744747 9:117189025-117189047 CACCTGGGACAGTGGGTAGAAGG + Intronic
1059750820 9:117245585-117245607 GTGCAGGGCCAGGAGGCAGAAGG + Intronic
1060106961 9:120878564-120878586 CTCCAAGGCCAGGAGGCAGAGGG - Intronic
1060209310 9:121700165-121700187 CTCCTGGGCCAGCCGGGAGCAGG + Intronic
1060553371 9:124496074-124496096 CTGCTTGGCCAAGGGGCAGGTGG - Intronic
1060727573 9:126016469-126016491 CAGCTGGGCCAGGGGGCCAAGGG + Intergenic
1061095451 9:128454468-128454490 CTCCTGGGGCAGGCAGGAGATGG - Intergenic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1061416494 9:130450099-130450121 CTTCTGGAGCAGGGGGCAGGAGG + Intronic
1061505951 9:131032025-131032047 CTCCTGGGGCAGAGGGGAGAGGG - Exonic
1061716332 9:132520778-132520800 CTCCTGGGCCAGGGGGCAGAAGG - Intronic
1061752780 9:132792466-132792488 CTCCTAGTCCACCGGGCAGATGG + Intronic
1061860317 9:133464586-133464608 CTCCCAGGCCTGGGGACAGAAGG + Intronic
1061918652 9:133770189-133770211 CTCCTGGGCCATGTGACAGGCGG - Intronic
1061920402 9:133779401-133779423 CTGCTGGGCCAGGCGGGAGCTGG - Intronic
1062035791 9:134382009-134382031 CTCCTGGGTCCAGGGACAGAAGG - Intronic
1062073674 9:134572786-134572808 GTCCTGGGCTAGGAGTCAGAGGG + Intergenic
1062313721 9:135954565-135954587 CTCCTGGGCCATGGGTCACCTGG - Intronic
1185508196 X:644217-644239 ATTCTGGGCCAGGGGGAAGGAGG + Intronic
1185852798 X:3504846-3504868 ATCTTGGGCCAGGGAGCAGGGGG + Intergenic
1186408673 X:9326588-9326610 TTCCTGAGCCTGGGGGCTGAGGG - Intergenic
1187056276 X:15744074-15744096 CTCTAGGGCTAGGGGGCAGGAGG - Intronic
1187412306 X:19062079-19062101 AGCCTAGGCCAGGGGTCAGATGG - Intronic
1189556823 X:42153575-42153597 CTCAGGGGGCAGGGGGCAGGGGG + Intergenic
1190066069 X:47242552-47242574 TTCCAGGGCAAGGAGGCAGAAGG + Intronic
1191714725 X:64186523-64186545 CAACTGGGCCTGGGGGCTGAGGG + Exonic
1191803348 X:65105514-65105536 GTCCTGGGCCATGGGAAAGATGG - Intergenic
1193601007 X:83508539-83508561 CTGCTGGTCCAGGGGGCTGGTGG - Exonic
1194467864 X:94255522-94255544 TTCCTGAGCCTGGAGGCAGATGG - Intergenic
1194571568 X:95559750-95559772 CTTCTGGGGCGGGGGGCAGCTGG + Intergenic
1195498657 X:105567995-105568017 CTCTGGGGCCTGGTGGCAGAAGG - Intronic
1198215308 X:134549737-134549759 CTCCGGGGCCCGGGGGCGGAAGG + Intergenic
1200114591 X:153764629-153764651 CTCCAGGGCAAGGTGGCAGTGGG - Intronic
1200115793 X:153769208-153769230 GTCCTGGGCCTGGAGGCAGCTGG - Exonic
1200118325 X:153778876-153778898 GCCCTGGGCCAGCAGGCAGAGGG + Intronic
1200138171 X:153884987-153885009 CTTCTGGAGAAGGGGGCAGATGG + Intronic