ID: 1061716593

View in Genome Browser
Species Human (GRCh38)
Location 9:132522113-132522135
Sequence CAGGGGATGGGGGCTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061716573_1061716593 30 Left 1061716573 9:132522060-132522082 CCCCAGACTTGCATTTTTTTAAA 0: 1
1: 0
2: 7
3: 84
4: 683
Right 1061716593 9:132522113-132522135 CAGGGGATGGGGGCTGTTGCAGG No data
1061716575_1061716593 28 Left 1061716575 9:132522062-132522084 CCAGACTTGCATTTTTTTAAAAA 0: 1
1: 1
2: 16
3: 171
4: 1217
Right 1061716593 9:132522113-132522135 CAGGGGATGGGGGCTGTTGCAGG No data
1061716584_1061716593 -4 Left 1061716584 9:132522094-132522116 CCTATGAGGAGCAGGGGGCCAGG 0: 1
1: 0
2: 3
3: 47
4: 383
Right 1061716593 9:132522113-132522135 CAGGGGATGGGGGCTGTTGCAGG No data
1061716580_1061716593 3 Left 1061716580 9:132522087-132522109 CCTGGCTCCTATGAGGAGCAGGG 0: 1
1: 0
2: 1
3: 18
4: 217
Right 1061716593 9:132522113-132522135 CAGGGGATGGGGGCTGTTGCAGG No data
1061716574_1061716593 29 Left 1061716574 9:132522061-132522083 CCCAGACTTGCATTTTTTTAAAA 0: 1
1: 0
2: 18
3: 144
4: 1106
Right 1061716593 9:132522113-132522135 CAGGGGATGGGGGCTGTTGCAGG No data
1061716578_1061716593 4 Left 1061716578 9:132522086-132522108 CCCTGGCTCCTATGAGGAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 194
Right 1061716593 9:132522113-132522135 CAGGGGATGGGGGCTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061716593 Original CRISPR CAGGGGATGGGGGCTGTTGC AGG Intronic
No off target data available for this crispr