ID: 1061718252

View in Genome Browser
Species Human (GRCh38)
Location 9:132534741-132534763
Sequence AACCTCCTTGTGCAGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061718252 Original CRISPR AACCTCCTTGTGCAGTTTGG AGG (reversed) Intronic
903725127 1:25436343-25436365 TACCATCTTGTGGAGTTTGGAGG + Intronic
908179760 1:61592103-61592125 AGGCTCCGTGTGCAGTTTGATGG + Intergenic
912412023 1:109486183-109486205 CACCTCCTTCTGTAGTGTGGTGG - Intronic
913698346 1:121349646-121349668 AACCTCCTTTTTCTGTTTGATGG + Intronic
914139206 1:144930396-144930418 AACCTCCTTTTTCTGTTTGATGG - Intronic
915100088 1:153492934-153492956 AACCCCCATGAGAAGTTTGGGGG + Intergenic
915265157 1:154711616-154711638 AACATCCTGGGGCAGTTTGTTGG + Intronic
916008242 1:160681098-160681120 AGCCTCCTTGCACAGTGTGGTGG - Intronic
916321505 1:163509839-163509861 ACCCTCCTTATGCAGGCTGGAGG + Intergenic
920485745 1:206368302-206368324 AACCTCCTTTTTCTGTTTGATGG + Intronic
921511786 1:216040428-216040450 AACCTCCTTGCCGGGTTTGGTGG + Intronic
923125792 1:231033412-231033434 AACTTCCATCTGCAGCTTGGTGG + Intronic
1063069692 10:2648852-2648874 TCCCTCCTTGTGCATTTTTGTGG - Intergenic
1063683895 10:8217482-8217504 ACTCTCCTAATGCAGTTTGGTGG - Intergenic
1066495694 10:35939611-35939633 AACATGGTTGTGCAGTTTAGTGG - Intergenic
1067836639 10:49645591-49645613 AACCTCCCTGTGCCCTGTGGAGG + Intronic
1072308739 10:94133644-94133666 AACCTCCTTGTGTACTATGTTGG + Intronic
1075687889 10:124376792-124376814 AGCCTCCTTCTGCAGGTGGGCGG + Intergenic
1086846318 11:91754351-91754373 AACCTGAATGAGCAGTTTGGGGG - Intergenic
1087905916 11:103697355-103697377 AAAACCCTTGTGCATTTTGGGGG - Intergenic
1089304488 11:117517976-117517998 TACCTCCTGGAGCATTTTGGGGG + Intronic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089802892 11:121051452-121051474 AACCTCTTTGTGGAGGTTGGAGG - Intronic
1092002340 12:5043344-5043366 AACCCCCTTGTACATTTTTGTGG + Intergenic
1092380646 12:7994117-7994139 AACTTCGTTGTGCAGTTTTGTGG + Intergenic
1093905748 12:24690163-24690185 AGCCTCCCTCTGCAGTTTGGTGG - Intergenic
1098076351 12:66736103-66736125 AAGCTCTTAGTGAAGTTTGGTGG - Intronic
1100199596 12:92284254-92284276 ATGCTCCTTGTGAAGTTTTGGGG - Intergenic
1100726422 12:97413799-97413821 AATCTCCTTGTGGAAGTTGGAGG + Intergenic
1103848513 12:123916050-123916072 TAGCTCCATGTGCATTTTGGAGG - Intronic
1103890217 12:124232697-124232719 CACCTCCTTGTGTGGTTTAGGGG + Intronic
1103893172 12:124254967-124254989 ACCCTACTTCAGCAGTTTGGAGG + Intronic
1104875890 12:132034589-132034611 AGCACCCTTATGCAGTTTGGGGG - Intronic
1106397523 13:29395266-29395288 GACCACCTTGTTCAGTCTGGAGG + Intronic
1107796720 13:44060741-44060763 AAATTCCTTCTGCATTTTGGGGG - Intergenic
1110202990 13:72875360-72875382 AACATCCTTGTGCAGTTGTTTGG + Intronic
1114465980 14:22923084-22923106 GACCTCATTGTACAGCTTGGAGG + Exonic
1115328416 14:32167653-32167675 GACCTCCTGGTGCAGTTGGCTGG + Intergenic
1119624761 14:76163237-76163259 ATTCACCTTGTGGAGTTTGGGGG + Intronic
1120543064 14:85775311-85775333 AATTTCCTTATGCAGTTTGGTGG - Intergenic
1120951391 14:90045196-90045218 CACCTCCTTGTGCTGTTATGTGG - Intergenic
1121633841 14:95440226-95440248 AAATTCCTTGTGCTGTGTGGAGG - Intronic
1123867244 15:24533479-24533501 AGCCTCCTTGTCCATTCTGGAGG + Intergenic
1125011037 15:34875641-34875663 TACATTGTTGTGCAGTTTGGTGG - Intronic
1126139946 15:45429531-45429553 AACCTCACTTTGCAGTTTGCAGG - Intergenic
1128290642 15:66476070-66476092 AACCTCCTTGTTCATTTTTGAGG + Intronic
1131264765 15:90909490-90909512 AACCTCCATGTGCAGGTGTGAGG + Exonic
1138054532 16:53818832-53818854 ACCCTTCTTGGGCATTTTGGTGG + Intronic
1140328723 16:74030962-74030984 AACCTCGTGGTGTGGTTTGGCGG - Intergenic
1141344568 16:83233045-83233067 AACCCCCTTTTCCAGATTGGCGG + Intronic
1141400810 16:83745265-83745287 GGCGTCCTTCTGCAGTTTGGGGG + Intronic
1143016145 17:3892331-3892353 GACCTGCGTGTGCTGTTTGGAGG - Intronic
1144791677 17:17863049-17863071 CGCCTCCTTGAGCAGTTTGAGGG - Intronic
1146692993 17:34889541-34889563 AACCTGTTTGTGGAGCTTGGAGG - Intergenic
1147952916 17:44116993-44117015 AACCTCCGTGTGCAGGTGCGTGG - Intronic
1150567587 17:66355722-66355744 AACATCCTTTTCCAGTTTTGGGG + Intronic
1154370472 18:13756888-13756910 AACATCCTTGTGATGTTTGCAGG + Intronic
1157307269 18:46526192-46526214 AACATCCTTGTGCAATGTGAAGG - Intronic
1158149709 18:54354531-54354553 AAACTTCTTGGGCAGTTTGTTGG + Exonic
1161168787 19:2802633-2802655 AAGTTCCTGGTGCATTTTGGAGG + Intronic
1167299429 19:48670556-48670578 CACCTCCGTGTGGAGTTTGGGGG - Exonic
927224712 2:20752412-20752434 ATCCGTCTTGTTCAGTTTGGGGG - Intronic
930285018 2:49416612-49416634 CACCTCACTGTGAAGTTTGGTGG - Intergenic
932279300 2:70475850-70475872 CTCCTCCTTGTGCCTTTTGGGGG - Intronic
935089614 2:99882263-99882285 AACCCCCTTGTGCAGATTAATGG - Intronic
935307624 2:101752769-101752791 AAACTCCTGGTGCAGTTTTATGG - Intronic
935638075 2:105265789-105265811 AACATCCATGTGTTGTTTGGGGG - Exonic
936344899 2:111668030-111668052 AACTTCCTTGTCCAGTTTTGAGG + Intergenic
937978216 2:127594169-127594191 CAGCTCCCTGTGCATTTTGGGGG - Intronic
941214866 2:162694226-162694248 AACATCCTTCTGTAGTTTGGAGG + Intronic
942821224 2:180117880-180117902 AACCTACTTGTGTAGGTTTGTGG - Intergenic
944513937 2:200492143-200492165 AACCTCAGTGTGGAGTCTGGTGG - Intronic
944719470 2:202408366-202408388 AACCTACTGGTGCACTTAGGTGG - Intronic
944920240 2:204405040-204405062 CACCTCCTTGGTCAGGTTGGAGG + Intergenic
946378441 2:219328451-219328473 AACCTCTTTTTTCAGTGTGGAGG + Intronic
1169324140 20:4661534-4661556 AACCACCTTGTGGTGTTTGTCGG + Intergenic
1170664991 20:18379055-18379077 AACCCCCATGTGCAGGTAGGGGG + Intergenic
1171417696 20:24994502-24994524 AGACTCCTTGTGGGGTTTGGGGG + Intergenic
1171426538 20:25052039-25052061 AAGCTCCATGTGGGGTTTGGGGG + Intronic
1172192406 20:33069838-33069860 AAGCTCCTTCTGCCGATTGGGGG + Intronic
1172311854 20:33924586-33924608 AAATTCCTTTTGAAGTTTGGGGG - Intergenic
1173004988 20:39133338-39133360 CACCTCCCTGTGCAGAGTGGTGG + Intergenic
1173155175 20:40602464-40602486 AACAGCCTTTTGCAATTTGGGGG + Intergenic
1173727353 20:45307058-45307080 ATCCTGCTTTTGCAGTTCGGCGG - Intronic
1174138805 20:48398640-48398662 AGCCTCCCTGTGCTCTTTGGGGG - Intergenic
1175718819 20:61273214-61273236 GAGTACCTTGTGCAGTTTGGGGG + Intronic
1175718835 20:61273291-61273313 AAGTACCATGTGCAGTTTGGGGG + Intronic
1175718843 20:61273335-61273357 GAGTACCTTGTGCAGTTTGGGGG + Intronic
1175719010 20:61274149-61274171 AAGTACCATGTGCAGTTTGGGGG + Intronic
1175719087 20:61274515-61274537 AAGTACCATGTGCAGTTTGGGGG + Intronic
1175719212 20:61275178-61275200 AAGTACCATGTGCAGTTTGGGGG + Intronic
1177475133 21:21610713-21610735 GATCTCCTTGTGCAATATGGTGG - Intergenic
1178239046 21:30877970-30877992 TATCTCCTTTTGCTGTTTGGTGG - Intergenic
1180129404 21:45817441-45817463 AACATCTTCCTGCAGTTTGGGGG + Intronic
1182079195 22:27517314-27517336 ATCCCCCTTGTTCAGGTTGGAGG - Intergenic
1184627461 22:45747763-45747785 CACCTCCTTGTGGGGTTGGGAGG + Intronic
950584969 3:13885819-13885841 TACCTCCTTGGGTAGTTTTGAGG + Intergenic
955931097 3:64057777-64057799 AACCTTCTTGGGCAAATTGGGGG - Intergenic
956991681 3:74773688-74773710 AACATCCATGTGTAGTTTCGTGG + Intergenic
960789113 3:121407312-121407334 AACCGCCATATGAAGTTTGGAGG + Exonic
961003035 3:123386680-123386702 ACCCTCCTTGGGCAGTTTCAAGG + Intronic
966632557 3:182094811-182094833 GACTTACTTGTGCAGGTTGGTGG - Intergenic
968040351 3:195583573-195583595 CACCTCGTTGTCCAGTTTGGAGG + Intronic
970349844 4:15191411-15191433 AGCCTTCTTTTGTAGTTTGGTGG + Intergenic
981686376 4:147459187-147459209 GACCTCATTGTACAGCTTGGAGG + Intergenic
999512106 5:152263074-152263096 AAACTCCTAGTCCAGTGTGGTGG + Intergenic
1004486139 6:16068715-16068737 GGTCTCCTTGTGCAGTGTGGAGG - Intergenic
1004885952 6:20051839-20051861 AACCTCCTGGTGCTCTGTGGGGG - Intergenic
1005470790 6:26160329-26160351 AAGCTCCTTGTGCATTTTTGGGG - Intronic
1008799471 6:55348742-55348764 AATCTCCGTGTGCAGTTATGGGG - Intronic
1011713286 6:90077084-90077106 ATCCTTCATGTGCAGTTTGAGGG - Intronic
1015262407 6:131253147-131253169 ATCCTGCTTTTGCCGTTTGGTGG + Intronic
1017016144 6:150101015-150101037 CACCGCCTTGTGCTGTTTGTTGG + Intergenic
1017501330 6:155025942-155025964 AGCCTCCTTGAGCAGTTGTGGGG + Intronic
1018581276 6:165310313-165310335 GACCTCCAGGTGCAGTTGGGTGG - Intergenic
1019360069 7:600158-600180 AACCATTTTGTGCAGTTCGGTGG - Intronic
1019643702 7:2118046-2118068 AGCCTCCTAGGGCAGTTGGGTGG - Intronic
1020061626 7:5156805-5156827 AACCTCAGTGTGCAGTTTGATGG + Intergenic
1020181554 7:5926589-5926611 AAACTGGTTTTGCAGTTTGGAGG - Intronic
1020301379 7:6798300-6798322 AAACTGGTTTTGCAGTTTGGAGG + Intronic
1022892548 7:34715879-34715901 AACCTCTGTGTTCAGCTTGGAGG + Intronic
1024575848 7:50763654-50763676 TTCTGCCTTGTGCAGTTTGGTGG - Intronic
1034467659 7:151239323-151239345 AACCTCCCTGTTCAGCTTGTGGG - Intronic
1035222885 7:157416866-157416888 AACCTCCTTGTGCCGTCTCTGGG - Exonic
1036064647 8:5366105-5366127 GGCCTCCTTGTGCTGTATGGGGG - Intergenic
1038356760 8:26836469-26836491 ATCATCATTGTTCAGTTTGGTGG - Intronic
1039184971 8:34906478-34906500 AATCACCTAGGGCAGTTTGGAGG + Intergenic
1039383527 8:37108558-37108580 GAGCTCTTTGTGCAGTTTGTTGG - Intergenic
1039438385 8:37577395-37577417 AACCTCCTTGTCCAGAATAGAGG - Intergenic
1040647602 8:49418187-49418209 AAACTCCTTGTTCAGCCTGGGGG + Intergenic
1041912390 8:63102792-63102814 ACCCTCCTCTTGCAGTTGGGTGG + Intergenic
1044863773 8:96549328-96549350 AACCTCCCTGAGCAGCCTGGTGG + Intronic
1046313792 8:112474051-112474073 AACCTCCTTTTGGTGTTTGAGGG - Intronic
1048028867 8:130612397-130612419 AAGCTCCTTGCCCAGGTTGGAGG + Intergenic
1053062112 9:35040198-35040220 AACCTCCTTCTTCAGACTGGTGG + Intergenic
1056569829 9:87805609-87805631 AACCTCCTTCTGCAATAAGGTGG + Intergenic
1058765901 9:108182511-108182533 AATTTCCTTGAGCATTTTGGCGG + Intergenic
1061718252 9:132534741-132534763 AACCTCCTTGTGCAGTTTGGAGG - Intronic
1186002656 X:5030750-5030772 TAACTCCTTGTGCAGTTGGTTGG - Intergenic
1186060135 X:5696053-5696075 TACCTCCTTCTGCAGTCTGGTGG + Intergenic
1186333290 X:8559400-8559422 ATCCTTCTTGTTCAGTTTTGTGG - Intronic
1187217929 X:17295204-17295226 AACCTCCATCTCCATTTTGGGGG - Intergenic
1187321532 X:18242787-18242809 AACCTGCTTTTGTTGTTTGGGGG - Intronic
1190000895 X:46685478-46685500 AACCTTCTTGTCCTGTTTGCAGG + Intronic
1191899390 X:66025073-66025095 CATCTCCTTGTGCTGTATGGTGG - Exonic
1193720190 X:84976650-84976672 AACTACCTTCTGTAGTTTGGTGG - Intergenic
1197398816 X:125963139-125963161 AATCTCCATGTATAGTTTGGAGG - Intergenic
1198895326 X:141448165-141448187 AACTGCTTTGTGCAGTGTGGTGG + Intergenic
1199360133 X:146907640-146907662 AGCCTCCCTGTGCTCTTTGGGGG - Intergenic
1201354098 Y:13078999-13079021 AACCAACTTGTTCAGTTTGAAGG - Intergenic