ID: 1061718477

View in Genome Browser
Species Human (GRCh38)
Location 9:132536722-132536744
Sequence CGGAATATCCAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 18, 3: 55, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061718477_1061718480 2 Left 1061718477 9:132536722-132536744 CCATTGTCCATTTGGATATTCCG 0: 1
1: 0
2: 18
3: 55
4: 170
Right 1061718480 9:132536747-132536769 TCTCAACCTGTTTAGAGATTAGG No data
1061718477_1061718484 22 Left 1061718477 9:132536722-132536744 CCATTGTCCATTTGGATATTCCG 0: 1
1: 0
2: 18
3: 55
4: 170
Right 1061718484 9:132536767-132536789 AGGTCCCACCTGGGAGCAGTTGG No data
1061718477_1061718482 12 Left 1061718477 9:132536722-132536744 CCATTGTCCATTTGGATATTCCG 0: 1
1: 0
2: 18
3: 55
4: 170
Right 1061718482 9:132536757-132536779 TTTAGAGATTAGGTCCCACCTGG No data
1061718477_1061718483 13 Left 1061718477 9:132536722-132536744 CCATTGTCCATTTGGATATTCCG 0: 1
1: 0
2: 18
3: 55
4: 170
Right 1061718483 9:132536758-132536780 TTAGAGATTAGGTCCCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061718477 Original CRISPR CGGAATATCCAAATGGACAA TGG (reversed) Intronic
902240332 1:15084061-15084083 AGGAATATCCAAGTGAATAATGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
910625733 1:89304378-89304400 CTGAATGTCCATATGCACAATGG - Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918732812 1:188019582-188019604 AGAAATATCAAAATGGAGAAAGG - Intergenic
918980279 1:191548422-191548444 AGCAATATCCAAATGGAAATTGG - Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919523391 1:198617373-198617395 TAGGATATCCAAATGGCCAATGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1065259116 10:23906375-23906397 TGGAATATCCAAATGTGAAATGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1074553241 10:114464501-114464523 CTTATTACCCAAATGGACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1080348630 11:31355971-31355993 CGGTATATCCAAAAGGAAATGGG + Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1081864017 11:46349848-46349870 CGGAACATCACAATGGCCAAGGG + Intronic
1082301845 11:50515501-50515523 CCGAATATCCATTTGGAAAATGG + Intergenic
1083090587 11:60195322-60195344 AGGAATATACTAATGGAGAAAGG - Intergenic
1083210203 11:61179481-61179503 AGGAGGATACAAATGGACAACGG - Intergenic
1084894487 11:72255660-72255682 GGGAAAATCCAAAATGACAATGG + Intergenic
1085796666 11:79547369-79547391 TGGGAAATCCAAATGGACAGGGG - Intergenic
1085980853 11:81722935-81722957 AAGGATATCCAAATGGAAAAGGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1089080034 11:115767919-115767941 GAGAATATCCAAAAGTACAATGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095724033 12:45432860-45432882 GGCAATATGTAAATGGACAATGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1097555569 12:61133347-61133369 AGGAATTTCCTCATGGACAAAGG + Intergenic
1099181396 12:79475262-79475284 CCTAATATCCAAATGGAGACAGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107068355 13:36242363-36242385 TGGGATATCCAAATGGCCAAAGG - Intronic
1107542006 13:41397362-41397384 CAAAAAAACCAAATGGACAAAGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112230442 13:97584192-97584214 CTGAATATCTAAATAGACCATGG - Intergenic
1112387560 13:98954387-98954409 CAGAACCTCCAAATGGACCAAGG + Intronic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116441041 14:44953233-44953255 CGGAATAGCCATATGGAAACAGG + Intronic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1120544614 14:85795454-85795476 TGGACAATCAAAATGGACAATGG + Intergenic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1126123592 15:45275145-45275167 GGAAATTTCCAAATGGACTATGG + Intronic
1126260589 15:46685043-46685065 AGGGATATCCAAAGGGCCAAAGG + Intergenic
1129243854 15:74268139-74268161 TGAAATATTCAAATGGAAAAGGG + Intronic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135789659 16:25382002-25382024 GAGGATATCCAAATGGCCAAAGG + Intergenic
1137037457 16:35578581-35578603 GGGAGTATCCCAATGGGCAATGG + Intergenic
1137073461 16:35931204-35931226 CGGAATCTTCAAAGGGACACTGG - Intergenic
1137081421 16:36063075-36063097 CCAAATATCCACATGCACAAAGG - Intergenic
1138027293 16:53532050-53532072 CTGAATATCCCAAGGGACACAGG + Intergenic
1139104374 16:63809277-63809299 GGGAAGATCCAAATGTAGAAAGG + Intergenic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1146120013 17:30184467-30184489 CTGATTATCCAAATGCAAAAAGG - Intronic
1147172134 17:38627904-38627926 CAGAAAATCCAACAGGACAAAGG + Intergenic
1148052560 17:44776257-44776279 CGGGAAAACCAAATCGACAAGGG - Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1150188899 17:63216380-63216402 AGGAATAACCAAATGGAAGAGGG - Intronic
1150619298 17:66797380-66797402 AGGAATATCAAAAACGACAAAGG + Intronic
1153536889 18:6111198-6111220 AGGAAGATGCAAATGGATAAGGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1168514329 19:56998363-56998385 CCGAATGTGCAAATGCACAAGGG + Intergenic
926500094 2:13642932-13642954 AGAAATAACCAAATGGAAAAGGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938449341 2:131402809-131402831 CAGAATATTCAAATGAACACAGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940747923 2:157591122-157591144 AGGAATAGCCAAATGAACTAGGG + Intronic
940781088 2:157934320-157934342 AGGAATATCCAAGTAGGCAATGG + Intronic
941144055 2:161821059-161821081 GAGAATATCCAAATGGCCAAAGG - Intronic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
947421901 2:229948761-229948783 CGGAAAACCCAAATGGAAAGGGG + Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1169847870 20:10015328-10015350 AGGAATAACAAAATGGAAAAGGG - Intronic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178027208 21:28481841-28481863 CAGAAAAGCCAAAAGGACAAAGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180003775 21:45009492-45009514 CGGAATAGCCACATGGAAGAGGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
949809126 3:7987203-7987225 AGGAATTACTAAATGGACAAAGG + Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957248765 3:77746117-77746139 CAGAATATCAAAATGGACACTGG - Intergenic
957564519 3:81866781-81866803 AGGAATTTCCTAGTGGACAAAGG - Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
962094314 3:132277673-132277695 AGGACGATCCAAATGTACAAGGG + Intronic
964165268 3:153697197-153697219 GGGAATAGCCAAGTGGACAAAGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966290268 3:178347866-178347888 TGTAATATACAAATGGACACTGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
970481558 4:16480783-16480805 CTGAGTATCAAAATGTACAATGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971629802 4:28976013-28976035 AGGAATATCCAAATGCTCTAAGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
975529471 4:75385845-75385867 AGGCATATACAAATGGGCAATGG + Intergenic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
978604299 4:110462678-110462700 TGGAATATGCAAGTGGACACAGG + Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979638463 4:122983949-122983971 CGGAATATCCCATGGGACAAAGG + Intronic
979961940 4:127031031-127031053 CACAATATCCAAATCAACAATGG + Intergenic
980333562 4:131440590-131440612 TGGAAAGTCCAAATGGATAAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
984013925 4:174403768-174403790 CTGAATATCCAAATCGCAAAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
993594788 5:89840086-89840108 TGAAATATCCAAATGGAACACGG - Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004794831 6:19069870-19069892 GGGAATATCAAAATGCATAATGG - Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009049836 6:58262978-58263000 CCTAATATCCAAATGGAAAGAGG - Intergenic
1009225385 6:61016237-61016259 CCTAATATCCAAATGGAAAGAGG - Intergenic
1010651943 6:78466226-78466248 CGGTATATCAAAAAGGACATTGG - Intergenic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012775091 6:103487261-103487283 CTGAATATCCAAATGGGGAGAGG + Intergenic
1012775274 6:103488468-103488490 CCTAATATCCAAAAGGACAGAGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016651929 6:146471818-146471840 GGAAATATTCAAATAGACAAAGG + Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020876021 7:13694674-13694696 GGGAAAATCCAAATGGATAGGGG + Intergenic
1023553987 7:41400681-41400703 TGTAATCTCCAAATGGATAATGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034062255 7:148103165-148103187 AGGAATATCCTTGTGGACAAAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041384388 8:57283590-57283612 CGGTATATACAATAGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042359347 8:67864839-67864861 CAAAATATCCAAAAGGAAAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043685542 8:83081314-83081336 GGGAATATCCAAATAGAGAGGGG + Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044918307 8:97139271-97139293 CGGAATATTCAAAATCACAAAGG + Intronic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051688848 9:19687468-19687490 GGGACCACCCAAATGGACAAAGG - Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056922166 9:90801092-90801114 AGGAATGTCCAAAAGGAAAAGGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1187576310 X:20559477-20559499 CAGAATATCCAAATTAAGAAAGG - Intergenic
1188882846 X:35511254-35511276 CGGATAATACAAAGGGACAAAGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1195941163 X:110169154-110169176 TGGAATATCCAAGTGGAAATGGG - Intronic
1196884258 X:120227928-120227950 AGGAAAATCCTCATGGACAAAGG + Intergenic
1199307043 X:146279271-146279293 TGGAATATCCAAAGAGACTAGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic