ID: 1061719309

View in Genome Browser
Species Human (GRCh38)
Location 9:132542059-132542081
Sequence ACCCTGTGAGCTCATGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061719305_1061719309 12 Left 1061719305 9:132542024-132542046 CCAATTTAAGAGAAAATACACAA 0: 1
1: 0
2: 5
3: 62
4: 650
Right 1061719309 9:132542059-132542081 ACCCTGTGAGCTCATGCCCAGGG No data
1061719304_1061719309 13 Left 1061719304 9:132542023-132542045 CCCAATTTAAGAGAAAATACACA 0: 1
1: 0
2: 6
3: 62
4: 684
Right 1061719309 9:132542059-132542081 ACCCTGTGAGCTCATGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061719309 Original CRISPR ACCCTGTGAGCTCATGCCCA GGG Intronic
No off target data available for this crispr