ID: 1061722354

View in Genome Browser
Species Human (GRCh38)
Location 9:132560416-132560438
Sequence GGTAACACCAGTCCCAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 104}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061722354 Original CRISPR GGTAACACCAGTCCCAAGGT GGG (reversed) Intronic
905223762 1:36466446-36466468 GGTAACCCCAGCCCCAAGCCAGG - Exonic
905270890 1:36786740-36786762 GGATACACCAATCCCAAGGCTGG - Intergenic
905391803 1:37640680-37640702 TGTAATCCCAGTGCCAAGGTGGG - Intergenic
906709874 1:47921344-47921366 AGAAAGACAAGTCCCAAGGTGGG + Intronic
906848838 1:49225508-49225530 AGTTCCACCAGACCCAAGGTGGG + Intronic
907294939 1:53444773-53444795 GGTAACACCAGTGCCTGGGAAGG + Intergenic
907321255 1:53603754-53603776 GGGAAAGCCAGGCCCAAGGTTGG - Intronic
909413613 1:75380772-75380794 GGTAACACCAGTCACATGGATGG + Intronic
915402029 1:155629330-155629352 GGTAACACCAGTCACATGGATGG - Intergenic
916010066 1:160697330-160697352 GGTAACACCAGTCACATGGATGG + Intronic
918306355 1:183250387-183250409 GGTAATGCCAGTCCCAGGGGAGG - Exonic
920136311 1:203771938-203771960 GAGAACACCAGACCCAAGGCTGG + Intronic
920629493 1:207637763-207637785 GGAAACACCAGTCACATGGATGG - Intronic
922412168 1:225387539-225387561 GGCAACACCAGCCTCAAGGGAGG + Intronic
922697186 1:227736381-227736403 GGTAACTCCAGTTGCAAGTTTGG - Intronic
1064176887 10:13082676-13082698 GGTAACACCAGTGCCTGGGAAGG - Intronic
1064902472 10:20310209-20310231 GATGACGCCAGTCCCAAGGTTGG - Intergenic
1065728018 10:28684941-28684963 GGTAACACCAGTCCAGACATAGG - Intergenic
1076417086 10:130299804-130299826 AGTAACACCAGCCAAAAGGTCGG + Intergenic
1076775757 10:132697188-132697210 GGTAGCTCCACACCCAAGGTGGG - Intronic
1077017959 11:405245-405267 GGCAACTCCAGGCCCAGGGTGGG - Intergenic
1078068372 11:8092763-8092785 GGAAACACCAGTTCCTGGGTAGG - Intronic
1079502679 11:21119492-21119514 GGAAACCCCAGTCCCCAGGGAGG - Intronic
1083151392 11:60793931-60793953 GGTAACAGCTGTCCAAAGGGTGG - Intronic
1086158793 11:83697619-83697641 AGCAACACCATTCCCAAGTTTGG - Intronic
1086990447 11:93297678-93297700 GTTAAGAGCAGTGCCAAGGTAGG - Intergenic
1089471434 11:118723673-118723695 GGTAACACCAGTCACATGGATGG - Intergenic
1091895281 12:4097848-4097870 GGTAACAGTCTTCCCAAGGTAGG - Intergenic
1094822082 12:34233811-34233833 GGCAACACCAGTCCCAGGAGGGG + Intergenic
1097243062 12:57589491-57589513 GGTAACACCAGTGCCTGGGAAGG - Intergenic
1097314193 12:58154625-58154647 GGTAACATCAGTCCAAGGTTGGG - Intergenic
1102250359 12:111382557-111382579 GGTAACAGTCTTCCCAAGGTAGG - Intergenic
1105723158 13:23135671-23135693 GGCTACCCCAGTCCCAAGGAAGG + Intergenic
1107213340 13:37885604-37885626 GGTAACCCCTGACCCAAGTTGGG + Intergenic
1109405896 13:61900113-61900135 GGGAACACCATCACCAAGGTAGG - Intergenic
1113642901 13:111970971-111970993 CGTAACAGCACTCCCACGGTGGG - Intergenic
1114076049 14:19161730-19161752 GGGAACACCAGATCCCAGGTGGG - Intergenic
1114086108 14:19237841-19237863 GGGAACACCAGATCCCAGGTGGG + Intergenic
1117139736 14:52776473-52776495 GGTAAAATCATTCACAAGGTTGG - Exonic
1118055935 14:62079908-62079930 GGTAGCACCAGTCCAGTGGTGGG + Intronic
1118616276 14:67576428-67576450 GGTGGCAGCAGTGCCAAGGTGGG + Exonic
1125785824 15:42316789-42316811 GGTAACACCAGTACCTGGGAAGG - Intronic
1126451596 15:48814524-48814546 GGGAACACTAGACCCAAGCTGGG + Intergenic
1128322956 15:66705379-66705401 GGTCACTCCAGTCCCAATTTAGG + Intronic
1132479716 16:160915-160937 TGTACCACCAGCCCCAAGGCAGG - Intronic
1135330413 16:21555532-21555554 CGTAACAGCAGTCCTATGGTGGG - Intergenic
1136281452 16:29213924-29213946 GGTAACAACAGTACCAAGGATGG + Intergenic
1136930590 16:34414713-34414735 GGTAACACCAGTCACATGGATGG - Intergenic
1136973984 16:34997095-34997117 GGTAACACCAGTCACATGGATGG + Intergenic
1140244102 16:73232593-73232615 CGTAACAGCAGACCCAAGATGGG - Intergenic
1142043436 16:87910000-87910022 CGTAACAGCAGTCCTATGGTGGG - Intronic
1142085821 16:88179848-88179870 GGTAACAACAGTACCAAGTATGG + Intergenic
1144303367 17:13944620-13944642 GTAAACACCAGTCCCAAGAGAGG - Intergenic
1145770096 17:27486662-27486684 GGGACCACAAATCCCAAGGTAGG - Intronic
1146271343 17:31487889-31487911 GGTAACCCCGCCCCCAAGGTAGG - Intronic
1146691546 17:34879648-34879670 GGTAACACCACCCAGAAGGTTGG + Intergenic
1146761209 17:35481141-35481163 GGTAACACCAGCGCCAGGGAAGG + Intronic
1148693481 17:49545911-49545933 TGTAACACCATCCCCAAGCTTGG + Intergenic
1154066116 18:11108999-11109021 AGTACCACCAGCACCAAGGTGGG + Intronic
1155414364 18:25581509-25581531 GATAACACCACTCCCTAGGGAGG + Intergenic
1166461494 19:42992041-42992063 GCAGACACCCGTCCCAAGGTGGG + Intronic
1167045405 19:47046268-47046290 GGTAGCAACAGGGCCAAGGTCGG + Intronic
1167854268 19:52225594-52225616 GGATACACCAAACCCAAGGTGGG - Intronic
926190233 2:10722348-10722370 GCTAATACCAATCACAAGGTTGG + Intronic
931445871 2:62326726-62326748 GGTTACACCAGTGTCAAGGGAGG + Intergenic
931987605 2:67756634-67756656 AGTCACACCAGTCTGAAGGTAGG - Intergenic
938108594 2:128549780-128549802 GGTCACACCAGCCCCAGGGTGGG - Intergenic
938270332 2:129964622-129964644 GGTAACACCAGTCACATGGATGG - Intergenic
938496090 2:131798887-131798909 GTGAACACCAGGCCCCAGGTGGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1177248573 21:18563290-18563312 AGTAACACCAGTCACATGGATGG - Intergenic
1180291859 22:10855352-10855374 GGGAACACCAGATCCCAGGTGGG - Intergenic
1180494663 22:15884774-15884796 GGGAACACCAGATCCCAGGTGGG - Intergenic
1180838417 22:18945166-18945188 GGTAACACCAGTCACATGGATGG + Intergenic
1181179246 22:21055528-21055550 GGGAACACCAGGCCTCAGGTGGG - Intronic
1181769339 22:25113982-25114004 GGTCACACCACTCCCCAGGGTGG - Intronic
1183262212 22:36802846-36802868 GGTAACAGCAGTGCCAAGGATGG + Intronic
1183627439 22:39013351-39013373 GGTAACGCCAGTGCCTAGGAAGG - Intergenic
1184133407 22:42531473-42531495 GGTAACACCAGTGCCTGGGAAGG + Intergenic
950030618 3:9850340-9850362 GGAAACACCAGTCACATGGATGG - Intronic
951207752 3:19942372-19942394 GGTAACACTCTTTCCAAGGTAGG + Intronic
955889267 3:63632563-63632585 AGTAACACCTGTTCCAAGTTAGG + Intergenic
959070555 3:101698332-101698354 GGTAACCCCAGTCACATGGATGG + Intergenic
960027658 3:113026934-113026956 GGTAACACCAGTCACATGGATGG - Intergenic
962689601 3:137880698-137880720 GGTAACAATCTTCCCAAGGTCGG - Intergenic
965027797 3:163325179-163325201 GGAAAACCCAGTCCCCAGGTGGG - Intergenic
967026089 3:185565212-185565234 GGTAACACCAGTCACATGGATGG - Intergenic
973662673 4:53123978-53124000 GGTAACAACAGTCCCATACTAGG + Intronic
974888659 4:67851946-67851968 TGTAACCTCAGTCCCAAGGTGGG - Intronic
978182520 4:105816377-105816399 GGTTGCTACAGTCCCAAGGTGGG + Intronic
978821205 4:112968615-112968637 GGCAACAGCAGTCACAATGTGGG - Intronic
989529740 5:42494175-42494197 GGGAACACCAGCTCCAAGATTGG + Intronic
989836723 5:46002702-46002724 GGAAACACCAGTCACATGGATGG - Intergenic
998729137 5:145054104-145054126 GGTAACAGCTGTCCCAAACTTGG - Intergenic
999951934 5:156660370-156660392 GGTAACACCAGTCACATGGATGG - Intronic
1005864993 6:29930559-29930581 GGTAACACCAGTGTCTAGGAAGG - Intergenic
1008422013 6:51312079-51312101 GGAAATTCCAGTCCCATGGTTGG - Intergenic
1010662159 6:78583820-78583842 GGTAACAGTAGTCCCTTGGTAGG + Intergenic
1013799056 6:113919543-113919565 GGTGACACCACTCTCAAGGAGGG + Intergenic
1014771550 6:125463426-125463448 GGGGGCACCAGTACCAAGGTAGG - Intergenic
1018768326 6:166951513-166951535 GGTAACACCAGTGCCTGGGAAGG - Intronic
1019106536 6:169672138-169672160 GGTAACAGCAGTCCCTCGGGGGG - Intronic
1020094387 7:5360573-5360595 GCTAACACCTGGCCCGAGGTCGG + Intronic
1020615238 7:10451710-10451732 GGTAACAGTCTTCCCAAGGTAGG - Intergenic
1026151467 7:67791222-67791244 GGTGAGTCCAGTCCTAAGGTGGG + Intergenic
1026876373 7:73881382-73881404 GGTCACAGGTGTCCCAAGGTGGG - Intergenic
1034544599 7:151781601-151781623 GGTAGCACCTGCCCCAAGGATGG + Intronic
1039227367 8:35402899-35402921 GGCAGCACCAGATCCAAGGTAGG - Intronic
1045307257 8:100968952-100968974 GGTAACACCAGTGCCTTGGTAGG + Intergenic
1047137394 8:122095802-122095824 GGTAAAACAAGTCCAAACGTAGG + Intergenic
1048529848 8:135237475-135237497 CCTCACACCTGTCCCAAGGTAGG - Intergenic
1049497556 8:142943459-142943481 GGGCACACCAGTCCCCACGTCGG + Intergenic
1052342197 9:27374969-27374991 GCCAACACCTGTCCCAAGGAAGG - Intronic
1052475613 9:28955887-28955909 TGTAATCCCAGTGCCAAGGTGGG - Intergenic
1054747748 9:68872040-68872062 GGTAACTCCAGTCTCAAGCAAGG + Intronic
1061572202 9:131484790-131484812 GGTAACACCAGCCCTGAGCTGGG + Exonic
1061722354 9:132560416-132560438 GGTAACACCAGTCCCAAGGTGGG - Intronic
1188507470 X:30898006-30898028 GGAAAGACCAGTCCCCATGTTGG - Intronic
1190331286 X:49236991-49237013 GGAAACACTAGTACCAGGGTCGG - Intronic
1196354649 X:114776356-114776378 GGTAACAGTCTTCCCAAGGTAGG + Intronic
1196980204 X:121204595-121204617 GGTAACAGTCTTCCCAAGGTAGG + Intergenic
1197156381 X:123274438-123274460 GGTAAGACCAGTCTCATGATGGG - Intronic