ID: 1061723079

View in Genome Browser
Species Human (GRCh38)
Location 9:132565725-132565747
Sequence CCAGGAAGGCAGAGCCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 5, 3: 68, 4: 595}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061723079_1061723086 4 Left 1061723079 9:132565725-132565747 CCATGTGGGCTCTGCCTTCCTGG 0: 1
1: 0
2: 5
3: 68
4: 595
Right 1061723086 9:132565752-132565774 TGTGTTTCCAGGGCACTGCATGG No data
1061723079_1061723084 -6 Left 1061723079 9:132565725-132565747 CCATGTGGGCTCTGCCTTCCTGG 0: 1
1: 0
2: 5
3: 68
4: 595
Right 1061723084 9:132565742-132565764 TCCTGGCAGGTGTGTTTCCAGGG No data
1061723079_1061723083 -7 Left 1061723079 9:132565725-132565747 CCATGTGGGCTCTGCCTTCCTGG 0: 1
1: 0
2: 5
3: 68
4: 595
Right 1061723083 9:132565741-132565763 TTCCTGGCAGGTGTGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061723079 Original CRISPR CCAGGAAGGCAGAGCCCACA TGG (reversed) Intronic
900300789 1:1976133-1976155 CCACGAGGGCAGGGCCCCCATGG + Intronic
900302609 1:1985665-1985687 CTGGGCAGGCAGTGCCCACATGG + Intronic
900391244 1:2434904-2434926 CCAGGAGAGCTGAGCCCGCACGG + Intronic
900421464 1:2557663-2557685 CAAGCCTGGCAGAGCCCACAGGG + Intronic
900616591 1:3568310-3568332 CCTGGAGGCCAGAGCCCTCAGGG - Intronic
900620791 1:3586772-3586794 CCAGGTGGGCAGAGGCCACAGGG + Intronic
900900910 1:5515247-5515269 CCAGGTGTGCAGAGGCCACAAGG + Intergenic
901042996 1:6376818-6376840 CCTGGGAGGCAGAGCGAACATGG + Intronic
901195799 1:7439147-7439169 CCAGGACCGCAGACCCCACCTGG - Intronic
901217140 1:7561200-7561222 CCAGGCAGGAAGAGCCCAACAGG + Intronic
901629609 1:10641719-10641741 CGAGGAAGGCAGACCCTACAGGG + Intronic
901783765 1:11611059-11611081 TCAGGAAGGCAGAGCCTCCCAGG - Intergenic
902218705 1:14950860-14950882 CCAGAAAGGAAGAGTGCACAGGG + Intronic
902571935 1:17352574-17352596 TCTGGAAGGCAGAGCCAGCAGGG + Intronic
902819781 1:18936779-18936801 GCAGCCAGGCAGAGCCCACCAGG + Intronic
903002063 1:20273643-20273665 ACAAAAAGGCAGAGCCCTCAAGG - Intergenic
903227804 1:21903773-21903795 CCTCCAAGGCAGAGACCACATGG - Intronic
903404795 1:23087308-23087330 GCAGGAGGGAAGAACCCACACGG + Exonic
903571786 1:24311303-24311325 CTAGGAAGGCAGAGGCCATGTGG - Intergenic
903810732 1:26033692-26033714 CCAGAAAGGCAAAGTCCACCTGG - Exonic
904998442 1:34649603-34649625 ACAGCAAGGTAGAGCCCTCATGG + Intergenic
905168877 1:36098617-36098639 CCAGGGGAGCAGGGCCCACAGGG - Exonic
905358086 1:37398869-37398891 ACAGCAAGGAAGAGACCACATGG + Intergenic
905731620 1:40302692-40302714 CCAGGCAAGCAGGGCCCCCATGG - Exonic
905811579 1:40917122-40917144 CCAGGATGCCAGGGCCCACTTGG + Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906670592 1:47651439-47651461 CAAGGAAAGCAGAGGCCAGAGGG + Intergenic
906911304 1:49954352-49954374 TCATGAGGGCAGAGCCCTCATGG - Intronic
907291995 1:53421193-53421215 TCATGAGGGCAGAGCCCTCATGG + Intergenic
907337984 1:53712921-53712943 CCAGGAAGGCAGAAACCAAGAGG + Intronic
907340774 1:53734653-53734675 CAAGGCAGGCAGAGCCCAGCTGG + Intergenic
907676563 1:56522998-56523020 CCAGGAAATCAGAGCAGACACGG + Intronic
907979692 1:59469473-59469495 TCATGAGGGCAGAGCCCTCATGG + Intronic
908386060 1:63643124-63643146 CCCTGTAGGCAAAGCCCACAGGG + Intronic
908451720 1:64262599-64262621 CCAGGCTGGGAGAGCCCATATGG - Intronic
910544548 1:88398924-88398946 TCATGAAGACAGAGCCCTCATGG - Intergenic
911803046 1:102168259-102168281 CCATGAGGGCAGACCCCTCATGG - Intergenic
912383451 1:109259946-109259968 CTAGGAAGGAAAGGCCCACAGGG - Intronic
912515755 1:110215645-110215667 CCAGGAAGGCAGCTCCAGCAGGG + Intronic
912861427 1:113217189-113217211 GCAGGAAGACAGAGCCAAGAGGG - Intergenic
913034762 1:114953107-114953129 CCATAAGGGCAGAGCCCTCATGG + Intronic
913083573 1:115413028-115413050 CCAGGAGAGCAGAGCCCAAATGG + Intergenic
913099664 1:115551419-115551441 TCATGATGGCAGAGCCCACATGG - Intergenic
913183944 1:116349689-116349711 CCATGAAGACAGGGCCCTCATGG + Intergenic
913197644 1:116471375-116471397 TCAGGAAGGCAGAGCTCACGGGG - Intergenic
913465748 1:119140839-119140861 CCAGGAAGGCTGAGCAGACAAGG - Intergenic
914881453 1:151550105-151550127 CCTGGGAGGCAGAGGCCCCAGGG - Intronic
915319029 1:155046056-155046078 CCAGGAAGGCAGAGAGGAAAGGG + Intronic
915756618 1:158267291-158267313 CCATGAAGGAAGAGCCCAAGAGG - Intergenic
916674247 1:167053127-167053149 CCAGAAAACCAGAGCCCAAATGG + Exonic
917106588 1:171498438-171498460 CTGTGAGGGCAGAGCCCACATGG + Intronic
917851817 1:179070854-179070876 CCATGAGGGCAGAGCACTCATGG + Intronic
918382327 1:183968700-183968722 CCAGCAAGGCAGAAACAACAGGG - Intronic
918740625 1:188126781-188126803 CAATGAGGGCAGAGCCCTCATGG + Intergenic
919438732 1:197599219-197599241 CCAGGAAGGCAGAGCATAAAAGG + Intronic
919837614 1:201586549-201586571 CCAGGAAGACAGACCTCACCAGG - Intergenic
920315363 1:205072800-205072822 GCAGAAAGGCAGAGTTCACAGGG + Intronic
921180796 1:212629865-212629887 CCTGAAAGACAGAGCACACATGG + Intergenic
921698391 1:218238786-218238808 CCATAAAGGCAGATTCCACAGGG - Intergenic
922110318 1:222549259-222549281 TCATGAAGGCAGAGGCCTCATGG - Intergenic
922184321 1:223260564-223260586 ACAGCAAGCCAGGGCCCACAGGG + Intronic
922996272 1:229964263-229964285 CCAGGGTGGCAGGGCACACAGGG + Intergenic
923024091 1:230190604-230190626 TCAGGGAGTCAGAGCCCAGAGGG - Intronic
923676922 1:236088312-236088334 TCATGAGGGCAGAGCCCTCATGG + Intergenic
923691939 1:236202739-236202761 CCATGATGGCAGTGCCCATAGGG + Intronic
924738817 1:246782567-246782589 CCAGGCCTGCAGAGCCCACCCGG - Intergenic
1062778061 10:172124-172146 TCATGAGGGCAGAGCCCCCATGG + Intronic
1062867808 10:871618-871640 TCAGGAAGGCACAGCGCAGAGGG - Intronic
1062874244 10:932037-932059 TCCGGAAGTCAGGGCCCACACGG - Intergenic
1062954072 10:1528917-1528939 CTAGGAAGGGACAGACCACAGGG - Intronic
1063378090 10:5566071-5566093 CGAGGATGGATGAGCCCACAGGG + Intergenic
1063730976 10:8696825-8696847 CCATGAATGCAGCGACCACAAGG + Intergenic
1064409580 10:15093274-15093296 ACAGGGTGGCGGAGCCCACATGG - Intergenic
1064493281 10:15883000-15883022 CCAGGAAAGCAGAGGCCAGGAGG + Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1067059334 10:43069885-43069907 CCTGGAAGCCAGGGCCCAGAGGG + Intergenic
1067146526 10:43698213-43698235 CAGGCGAGGCAGAGCCCACATGG - Intergenic
1067162333 10:43837807-43837829 TCATGAAGGCAGAACCCTCATGG + Intergenic
1067162665 10:43840477-43840499 TCATGAAGGCAGAGCCCTAATGG + Intergenic
1067686201 10:48467088-48467110 CCAGGCAGGAAGAGGCCAGAAGG - Intronic
1068426234 10:56868177-56868199 CCATGAGGGCAGAGCCCTCATGG + Intergenic
1069838271 10:71323033-71323055 CCAGGATGTCTGAGCCCTCAGGG - Exonic
1069901771 10:71710586-71710608 CCTGGAAGGGAGGGTCCACAGGG + Intronic
1072021140 10:91403117-91403139 ACATGAAGACAGAGCCCTCATGG + Intergenic
1073461317 10:103667441-103667463 CCAGTGAGCCAGAGCCCACTTGG - Intronic
1074476210 10:113777055-113777077 CCAGGAGGGCAGGGCACGCAGGG - Intronic
1074519552 10:114206687-114206709 CCAGGGAGGCAGAGGTTACAGGG - Intronic
1074584415 10:114753209-114753231 CCAGCAAGGCAGAGACTACTTGG + Intergenic
1075793419 10:125102244-125102266 GCAGGAGGGCAGAGTCCTCATGG - Intronic
1075810630 10:125222358-125222380 TGATGAAGGCAGAGCCCTCATGG - Intergenic
1076070593 10:127485256-127485278 CCAGGGAAGCAGAGCACAGAGGG - Intergenic
1076153835 10:128187595-128187617 CCTGAAAGGCAGAACCCACTGGG - Intergenic
1076508037 10:130991436-130991458 CCAGGAAGCCAGATCCCCCACGG + Intergenic
1076552241 10:131288809-131288831 CCAGGAAGGCAAAGGACACCAGG + Intronic
1076563173 10:131380932-131380954 CCAGCATTGCAGATCCCACAGGG - Intergenic
1076823995 10:132958146-132958168 CCAGGAAGGAAGGGACCAAATGG - Intergenic
1076879854 10:133234806-133234828 TCAGGGAGGCCGAGGCCACAGGG + Intergenic
1076991517 11:278551-278573 CCAGGGAGGAAGAGACCCCATGG + Exonic
1077032749 11:477058-477080 GAAGGTGGGCAGAGCCCACAGGG - Intronic
1077116948 11:889492-889514 ACAGGGAGGCTAAGCCCACAGGG - Intronic
1077244375 11:1528986-1529008 TCAGCAAGACAGACCCCACAGGG - Intergenic
1077396874 11:2328604-2328626 CCAGGAGGGCGGAGCCCCCACGG + Intergenic
1077930191 11:6722951-6722973 CCATGATGGCATAGCCCTCATGG - Intergenic
1077931104 11:6733968-6733990 ATAGGAAGGCAGAGCCCTCATGG - Intergenic
1078250573 11:9613587-9613609 CCCGAAAGGAAGAGCCCAGAAGG - Intergenic
1078509775 11:11976691-11976713 GCAGGAGGGCAGGGTCCACAAGG + Intronic
1078759984 11:14244058-14244080 CCCAGAAGGCAGAATCCACAGGG - Intronic
1078890265 11:15549343-15549365 CCATGAAGGTGGAGCCCTCATGG - Intergenic
1080413873 11:32051616-32051638 GCAGGACTGCAGAGCCCACCTGG + Intronic
1080767281 11:35308648-35308670 CCATGAAAGCAGAGACCTCATGG + Intronic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1082769431 11:57195347-57195369 CATGGAAGGCAGAGATCACAAGG + Intergenic
1082793987 11:57366898-57366920 CCATGAGGGCAGAGCCCGCAGGG + Intronic
1082794368 11:57369096-57369118 CCATGAGGGCAGAGCCCGCAGGG + Intronic
1082935829 11:58655711-58655733 CCAGGAGCGCAGGTCCCACATGG - Intronic
1083006505 11:59351555-59351577 CAAGGAAGGCAAAACCCACTAGG + Intergenic
1083610748 11:64003046-64003068 CTGGGGAGGCAGAGCCCACTTGG + Intronic
1083919997 11:65777458-65777480 GCAGGAGGGCAGAGCCCTCGTGG - Exonic
1083965306 11:66040117-66040139 CCAAGTATGCAGAGACCACAGGG - Intergenic
1084194689 11:67517820-67517842 CCATAAGGGCAGAGCCCTCATGG - Intergenic
1084981308 11:72830162-72830184 CTTACAAGGCAGAGCCCACAGGG + Intronic
1085007150 11:73102631-73102653 CTATGAGGGCAGAGCCCTCATGG - Intronic
1085039985 11:73321310-73321332 CCAGGATAGCTCAGCCCACACGG + Intronic
1085457611 11:76674133-76674155 CCTAGAAGGCAGGGCCCAGAAGG - Intergenic
1086375610 11:86197163-86197185 CCATGAAGGAAAAGCCCAAAAGG + Intergenic
1086903771 11:92396337-92396359 CCAGGAAAGCAGAGCTACCAAGG - Intronic
1087632341 11:100664962-100664984 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1088278584 11:108114984-108115006 CCATGAGGGCAGAGCCCTCGTGG - Intergenic
1088375215 11:109133435-109133457 CCATTAAGGCAGAACCCTCACGG - Intergenic
1088627820 11:111744654-111744676 CCAGGAAGGTTGGGCCCACCTGG - Intronic
1088847706 11:113681919-113681941 CCAGACTGCCAGAGCCCACAGGG - Intergenic
1088917850 11:114240618-114240640 TCAGGAAAACAGAGCCCAAAAGG + Intronic
1089134059 11:116235295-116235317 CCAGGGAAGTAGAGCCCCCAGGG + Intergenic
1089188979 11:116640789-116640811 CCAAGAAGCCAGGGCCCATATGG + Intergenic
1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG + Intergenic
1089597154 11:119587816-119587838 TCATGAAGGCAGACCCCTCATGG - Intergenic
1089626249 11:119752951-119752973 ACAGGAAGGCAGAGGGCACTAGG - Intergenic
1089675811 11:120088327-120088349 CCAGGGAAGCAGAGCCCTTATGG + Intergenic
1090921246 11:131207738-131207760 CCAGGAAGACAAAGACCTCATGG - Intergenic
1091304539 11:134529278-134529300 CAAGTAAGACAAAGCCCACACGG + Intergenic
1091449377 12:562953-562975 CGGGGAATGCAGAGCCCACTAGG - Exonic
1091590366 12:1839112-1839134 GCAGGAAGACAGAGCCCAGCCGG + Intronic
1091798893 12:3312394-3312416 CCAGGCAGGCACAGCGCACAAGG - Intergenic
1091802170 12:3331165-3331187 CCAGGAGGGCTCAGCCTACAGGG - Intergenic
1093558976 12:20515085-20515107 CCATGAGGGTAGAGCCCTCAGGG + Intronic
1093959961 12:25261720-25261742 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1094376693 12:29797786-29797808 CAAGGAGAGCAGGGCCCACAGGG + Intergenic
1094494274 12:30979691-30979713 CCTTGAAGGCCAAGCCCACAAGG + Intronic
1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG + Intergenic
1095496419 12:42789182-42789204 CCAGGCAGGAAGACTCCACAAGG - Intergenic
1096504134 12:52082101-52082123 CCAGGAAAGCTGAGCCCAGCTGG - Intergenic
1096778214 12:53976505-53976527 GCAGGCAGGCAGAGCCCAGCGGG + Exonic
1096896174 12:54822238-54822260 TCATGAAGGCAGAGCCCTCTTGG - Intergenic
1097575362 12:61386474-61386496 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1097796597 12:63869337-63869359 TCAGGAAGGCAAACCCCTCATGG + Intronic
1098140985 12:67450224-67450246 CCAGGATGGAAGAAGCCACAAGG - Intergenic
1098857858 12:75673632-75673654 CCAGAAAGGCAGTGACCACGTGG + Intergenic
1099675489 12:85755701-85755723 CCACAGAGGCAGAGCCCTCATGG + Intergenic
1100337635 12:93647005-93647027 CCAGGAAGGGAGCTCCCACCAGG + Intergenic
1100733367 12:97498738-97498760 ACAGAGAGGCAGAGCCCATAAGG - Intergenic
1100795296 12:98175849-98175871 TCAGGCAGGCTCAGCCCACATGG + Intergenic
1101104830 12:101429412-101429434 TCATGAAAGCAGAGCCCTCATGG - Intergenic
1101438153 12:104681904-104681926 CCTGGGAGGCAGAGCTCGCAGGG - Intronic
1101752170 12:107590799-107590821 CCAGGAAGCCAAATCCCACATGG - Intronic
1101811460 12:108111640-108111662 CAAGGAAGGCATGGCCCATAAGG - Intergenic
1102298964 12:111757625-111757647 CAGGGAAGGCAGTTCCCACAGGG - Intronic
1103325143 12:120115510-120115532 TCAGGAAGGCAGGCCCCAGAAGG - Intronic
1103528717 12:121584831-121584853 ACAGGAATCCAGAGCCCACAGGG - Intergenic
1104436544 12:128761529-128761551 CCAGGAAGGGAGATTCCAGAGGG - Intergenic
1104760317 12:131294128-131294150 CCAGGAAGCCAGAGCCACCCAGG - Intergenic
1104819450 12:131666519-131666541 CCAGGAAGCCAGAGCCACCCAGG + Intergenic
1104977124 12:132557083-132557105 CCAGGAGTGCAGAGCACACAGGG - Intronic
1105670124 13:22604247-22604269 CCAGGAGGGCAGATCCCTCATGG - Intergenic
1106013532 13:25847085-25847107 CCCAGATGGCAGAGGCCACATGG - Intronic
1106952651 13:34901764-34901786 CCAGGAATGAAGAGTCCAGAAGG - Intergenic
1107402975 13:40087163-40087185 CCAGGAGGGCAGAGACCAACAGG - Intergenic
1108305928 13:49132643-49132665 CAAGGAAGTCAGGGGCCACAGGG - Intronic
1108452798 13:50584477-50584499 CCATGAGGACAGAGCCCTCATGG + Intronic
1108601685 13:52000386-52000408 TCGAGAAGGCAGAGCCCTCATGG + Intronic
1111316376 13:86566615-86566637 CAATGAAGGCAGAGCCCTCATGG - Intergenic
1111759454 13:92443263-92443285 TCATGCAGGCAGAGCCCTCATGG - Intronic
1111854534 13:93621168-93621190 CCAGGTTGCCAGAGCCCTCAAGG + Intronic
1112369817 13:98784763-98784785 ACAGGAAGCCACCGCCCACATGG + Intergenic
1112717574 13:102204435-102204457 CCAGGAAAGCAGAGACAGCAGGG + Intronic
1113678682 13:112226606-112226628 CCAGGCAGGCAGAGTCCTCTTGG - Intergenic
1113941673 13:114021629-114021651 CCATCAAGGCTCAGCCCACAGGG + Intronic
1114487210 14:23069991-23070013 CCAGGGAGACTGAGGCCACAGGG - Intronic
1114549592 14:23525282-23525304 CCAGGAAGGGTGGGCCCAGATGG + Exonic
1115114651 14:29865448-29865470 TCATGAGGGCAGAGCCCTCAAGG - Intronic
1115743099 14:36408948-36408970 CCAGGAAGGTGGAGTCCTCATGG + Intergenic
1115840936 14:37469690-37469712 TCATGAGGGCAGAGCCCTCATGG - Intronic
1117069293 14:52042228-52042250 CAATGATGGCAGAGCCTACACGG - Exonic
1118050898 14:62026519-62026541 TCAGGAAGGAGGAGCCCTCATGG + Intronic
1119249051 14:73136609-73136631 CCAGGAAGGCACCGCGGACATGG + Intronic
1119594026 14:75917476-75917498 GCAGGGAGGCGGAGGCCACAGGG - Intronic
1119602224 14:75983852-75983874 CCAGGGAGGCAGAGTTTACAGGG + Intronic
1119926536 14:78499820-78499842 CCATGATGGGAAAGCCCACACGG - Intronic
1120583009 14:86277651-86277673 TCAGGAGGGCAGAGCACTCATGG - Intergenic
1122073347 14:99219559-99219581 TCAGGCAGGGAGACCCCACAAGG + Intronic
1122281544 14:100625745-100625767 CCATGAGGGCAGACCCCTCATGG - Intergenic
1122297079 14:100711782-100711804 TCAGGAAGGCAGAGGCCCCTTGG - Intergenic
1122323474 14:100868961-100868983 CCAGGATGACAGAGGCCAGATGG - Intergenic
1122555223 14:102575267-102575289 TCATGAGGGCAGAGCCCTCACGG - Intergenic
1122788969 14:104176451-104176473 CCAGGCGAGCACAGCCCACACGG - Exonic
1124008033 15:25810295-25810317 CCGAGAGGGCAGAGCCCACAGGG + Intronic
1124217189 15:27817071-27817093 CCAGGAGCGCAGAGCCTAGAGGG - Intronic
1124431138 15:29609437-29609459 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1124477719 15:30049411-30049433 CCATGAGGGCAGAGCCCCCATGG + Intergenic
1124906263 15:33871490-33871512 CCTGGGAGGCAGAGGCCGCAGGG + Intronic
1125507917 15:40277725-40277747 CCAGGGGAGAAGAGCCCACAAGG + Intergenic
1125769993 15:42158948-42158970 CCAGGAAGGCAGGGCACACATGG + Exonic
1126905590 15:53361101-53361123 TCGGGAAGGCTGGGCCCACAAGG - Intergenic
1128392379 15:67190942-67190964 CTAGGTAGGAAGAGCCCGCAGGG + Exonic
1129030830 15:72616519-72616541 CCAAGTTGGCAGGGCCCACAGGG + Intergenic
1129209549 15:74059706-74059728 CCAAGTTGGCAGGGCCCACAGGG - Intergenic
1129228592 15:74184002-74184024 CCAGGGAGGCAGAGACCTCAGGG + Intronic
1129255403 15:74331343-74331365 CCAGGAAGGCAGGGCCTCCAGGG - Intronic
1129477673 15:75797045-75797067 CCAATTAGGCAGGGCCCACAGGG + Intergenic
1129835735 15:78704317-78704339 CCAAGTTGGCAGGGCCCACAGGG + Intronic
1130511605 15:84594308-84594330 CCAGTTTGGCAGGGCCCACAGGG - Intergenic
1130927867 15:88398622-88398644 CCATGGGGGCAGAGCCCTCAAGG - Intergenic
1131219419 15:90569393-90569415 CCAGGGAGGCAGAGGCTGCAGGG - Intronic
1131268388 15:90932196-90932218 CCAGCTAGTCAGAGTCCACAAGG - Intronic
1131518853 15:93098467-93098489 TTATGAGGGCAGAGCCCACAAGG + Intergenic
1132408841 15:101561621-101561643 CCAGGACGGCGGAGTCCACCCGG - Intergenic
1132622526 16:874552-874574 CCAGGCAGGCAGCGGCCCCAGGG + Intronic
1132652285 16:1026950-1026972 CCAGGGAGGCCGAGCACAGATGG + Intergenic
1132772529 16:1572164-1572186 CCAGGTGGGCAGAGGCCACAGGG + Intronic
1133055702 16:3144506-3144528 CCACTAAGGCACACCCCACAGGG - Exonic
1133357704 16:5148591-5148613 CCAGGGAGGAAGAGCACTCACGG - Intergenic
1134023843 16:10940264-10940286 TCACGAAGGCAGAGCCTTCATGG + Intronic
1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG + Intronic
1134118772 16:11569051-11569073 ACAGGCAGACAGAGCCCAAAAGG + Intronic
1135562635 16:23488246-23488268 CCAGGAAGGCTGTGCACAAAAGG + Intronic
1136138612 16:28274415-28274437 CGAGGAAGGCAGAGCACCCGAGG + Intergenic
1136241029 16:28944120-28944142 CCAAAGTGGCAGAGCCCACAAGG - Intergenic
1136372921 16:29847431-29847453 CCAGGAAGGCAGAGCCAAGGCGG + Intronic
1136612802 16:31377546-31377568 CCAGCAAGGCACACCCCACAAGG - Intronic
1137249683 16:46732540-46732562 CCAGGCAAGCAGGGCCCACCTGG - Exonic
1138301838 16:55937109-55937131 CCAGGTAGGCAAAGCACATACGG - Intronic
1138505859 16:57477985-57478007 CCAGGAAGGCACCAGCCACAAGG - Intronic
1138695746 16:58811563-58811585 CCATGGGGACAGAGCCCACATGG + Intergenic
1139320754 16:66111936-66111958 CCACAAGGGCAGAGCCCTCATGG - Intergenic
1139555447 16:67706207-67706229 CGAGGCAGGCAGATCTCACAAGG - Intronic
1140021139 16:71239904-71239926 ACAGGAAGGCAGAGGCCAGTGGG + Intergenic
1140642980 16:76998909-76998931 CCAGGCAGGCAGATCACTCAAGG + Intergenic
1140864629 16:79049495-79049517 TCAGGAAGGCCAAGCCCAGATGG + Intronic
1140913575 16:79475026-79475048 ACAGTAAGGCAGTGCACACATGG + Intergenic
1141605668 16:85152009-85152031 CCAGGAAGTCAGAGTCCCCAGGG + Intergenic
1141766511 16:86063154-86063176 CCAGGAAGGCAGAACCCGAGGGG - Intergenic
1142297321 16:89234015-89234037 CAGGGGAGGCAGAGGCCACAGGG - Exonic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1143708781 17:8718903-8718925 TCAGAAAGGAAGAGGCCACAAGG + Intergenic
1143864156 17:9911738-9911760 CCAGGAAGCCTGAGCCCCCGGGG - Intronic
1144844266 17:18207990-18208012 CAAGCCAGGCAGACCCCACAGGG + Intronic
1145747727 17:27332591-27332613 CCAGGCAGGCCCAGCCCCCAGGG + Intergenic
1146437732 17:32866813-32866835 CCAGGATGGCTCAGGCCACAGGG + Intronic
1146804594 17:35855291-35855313 ATGTGAAGGCAGAGCCCACAAGG - Exonic
1147863774 17:43539771-43539793 CCAGGAAAGCACATCTCACAGGG + Intronic
1147904843 17:43816158-43816180 CCAGGCAGGAAGAGCCCCCTGGG + Intronic
1148770554 17:50063704-50063726 CCAGGAAGCAAGAGCCAGCAGGG - Intronic
1149216843 17:54366168-54366190 TCATGAAGGCAGAGCCCTCATGG + Intergenic
1149625526 17:58077799-58077821 CGAGGAAGGAAGAGCTGACAGGG - Intergenic
1150603914 17:66675290-66675312 CCAGGAGGGCAGAGCCTCCATGG - Intronic
1150835490 17:68560054-68560076 CCATGAGGGCAGAGCCCTCATGG + Intronic
1150981028 17:70141738-70141760 TCATGAAGGCAGAGCCTCCATGG + Intergenic
1151178283 17:72306965-72306987 CTAGGAATGCAGAGTCCATAAGG + Intergenic
1151306050 17:73263245-73263267 CCAGGGAGGCCAAGACCACATGG + Intergenic
1151331368 17:73411161-73411183 CCAGGAAGGCAGTGAACCCAAGG - Intronic
1151577694 17:74960985-74961007 GCAGGGAGGCCCAGCCCACATGG - Intronic
1151683122 17:75632066-75632088 GCAGAAAGGCACAGCCCTCACGG + Intronic
1152389347 17:79993427-79993449 CCTGCAAGGCAGAGGACACAGGG - Intronic
1152735773 17:81996192-81996214 ACAGGCAGGCAGAGGCCACCAGG - Intronic
1152820498 17:82435437-82435459 CCAACAAAGCAGAGACCACAGGG - Intronic
1152949920 17:83223134-83223156 CCAGGAAGGCTGAGCCCCGCAGG - Intergenic
1153215963 18:2821386-2821408 CCAGGTAGGCTGACCCCCCAGGG + Intergenic
1153952196 18:10067180-10067202 GCAGGAAGGGACAGCCCACTGGG + Intergenic
1155021898 18:21904064-21904086 TCAGGAAGGCAGTCTCCACATGG + Intergenic
1156018112 18:32569214-32569236 TCATGATGGCAGAGCCCTCATGG + Intergenic
1156069872 18:33194020-33194042 CCATGAAGGCAGAGCACTCATGG + Intronic
1156987956 18:43371415-43371437 CCAGGAAGGCAAAGAACTCAAGG - Intergenic
1158089080 18:53689626-53689648 TCATGAAGGCAGAGCTCTCATGG + Intergenic
1158368314 18:56766892-56766914 GCAGGAAAGCACAGTCCACAAGG - Intronic
1158542559 18:58369991-58370013 CCGGCAGTGCAGAGCCCACATGG - Intronic
1158962172 18:62596354-62596376 CCGGGGAAGCAGAGCCCACCCGG - Intergenic
1158992051 18:62879189-62879211 TCATGAAGGTAGAGCCCTCATGG - Intronic
1160030150 18:75250390-75250412 GACGGAAGGGAGAGCCCACAGGG - Intronic
1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG + Intronic
1161749897 19:6088015-6088037 CCAGGAAGCCACAGTCCTCAAGG + Intronic
1162464539 19:10832016-10832038 CCCCGAAAGCAGAGCCCTCAGGG - Intronic
1162574533 19:11491326-11491348 CCAGTAAGCCAGGACCCACAAGG + Intronic
1163386241 19:17001983-17002005 CCAGGGAGGAGGCGCCCACAGGG + Intronic
1163411706 19:17158959-17158981 CCAGGCAGGCAGATCGCCCAAGG + Intronic
1163424488 19:17233847-17233869 TGAGGAAGACAGAGCCCAGAAGG + Intronic
1163714634 19:18866644-18866666 ACAGGAAGGGAGAGCGCACGAGG + Exonic
1164511072 19:28897658-28897680 CCATGAGGGAAGAGCCTACATGG + Intergenic
1164563895 19:29312340-29312362 CCAGGGAGGAAGAGCCAACCAGG - Intergenic
1165251943 19:34545982-34546004 TCATGACGGCAGAGCCCTCAAGG - Intergenic
1165274708 19:34738387-34738409 TCATGAGGGCAGAGCCCTCAAGG + Intronic
1165384462 19:35502211-35502233 CCGGGGAGGCAGAACCCACGGGG + Intronic
1166570296 19:43791632-43791654 CCTGGAAGGCAGAGCTTGCAGGG - Intergenic
1167299668 19:48671531-48671553 CCAGGCACCCAGAGGCCACAGGG + Intronic
1167473098 19:49686241-49686263 CCAGTGAGGCGGGGCCCACAGGG + Exonic
1167530219 19:50011214-50011236 ACAGGAAAACAGAGACCACAGGG - Intronic
1168200535 19:54812176-54812198 CCAGGGAGACAGAACACACAGGG + Intronic
925025154 2:601568-601590 CCATTAAGCCAAAGCCCACATGG - Intergenic
925128131 2:1476311-1476333 CCAGGGAGGAAGAGCTGACAGGG + Intronic
925334982 2:3090347-3090369 CCATGAAGGCAGTGCTCAGAGGG + Intergenic
925366203 2:3313854-3313876 CGAGGAAGGCAGAGGCAAGAGGG + Intronic
926116888 2:10218983-10219005 CCCTGCAGGCAGAGCCCTCATGG - Intergenic
926147326 2:10404679-10404701 ACAGCAGGGCAGAGCCCACTCGG - Intronic
926272892 2:11379900-11379922 CCAAAAAGGCAGAGGCCACCAGG + Intergenic
926323393 2:11764645-11764667 ACAGGCAGGCAAAGGCCACATGG + Intronic
927057064 2:19375125-19375147 CCATGATGGCAGAGCCCTCATGG + Intergenic
927698617 2:25253282-25253304 CCTCGAGGGCAGAGCCAACAGGG - Intronic
927717892 2:25364315-25364337 CCAGGAAGGCATGGTCCCCAGGG + Intergenic
927893076 2:26764491-26764513 CCAGGAGGGCAGGGCCAAGAAGG - Intronic
928036180 2:27825663-27825685 TGAGGAAGGCAGAGCTGACAGGG + Intronic
928098812 2:28422980-28423002 CCAGGAAGACAGAGGGGACAAGG + Intergenic
928441178 2:31293482-31293504 GCAGGAAGGAAGAACCCACCAGG - Intergenic
928613351 2:33012070-33012092 CCAGCCAGGGAGACCCCACAGGG - Intronic
929532759 2:42762965-42762987 CTAGGAAGGCGGAGGCCATAGGG - Exonic
929758965 2:44790594-44790616 CTGGGAAGCCAGAGCCCAAAAGG + Intergenic
929867973 2:45734599-45734621 CCAGGAAGGCGGAGAACACACGG - Intronic
929943347 2:46351899-46351921 CCAGGAAGTCCCACCCCACATGG + Intronic
930122337 2:47770138-47770160 CCAGGAGGGCCAAGCCCTCATGG - Intronic
930185037 2:48404853-48404875 CCAGGGATTCTGAGCCCACAGGG + Intergenic
932317718 2:70796975-70796997 CCAGGAGGGCAGACCCAGCAGGG - Intergenic
932365610 2:71151176-71151198 TCTTGAAGGCAGAGCCCTCATGG - Intergenic
932806937 2:74792417-74792439 CCAGGAAGGCAGGGCCTAGTAGG + Intergenic
933345817 2:81084349-81084371 CCAGGAAGGCAGAGGTTTCAGGG + Intergenic
933749556 2:85594398-85594420 CCAGGGAGGCAGTGCCTTCAGGG + Intergenic
934122549 2:88854149-88854171 CCAAGGAGGCAGAGACCAGAGGG - Intergenic
935280166 2:101510453-101510475 CAAAGAATGAAGAGCCCACATGG - Intergenic
936085272 2:109463360-109463382 CAAGGGGGGCAGGGCCCACATGG - Intronic
937037663 2:118795274-118795296 CCAGGGAGGCAGAGGACTCAGGG - Intergenic
937098966 2:119254122-119254144 CCAGGAAGACAGAGGGCTCAGGG + Intronic
937653189 2:124344059-124344081 CCACAAGGGCAGAGCCCTCATGG + Intronic
937675908 2:124589967-124589989 TCAGGAAGTCAGAGCACTCATGG - Intronic
937697082 2:124819912-124819934 GAAGTAAGGCAGAGCCTACATGG - Intronic
938074987 2:128327213-128327235 GCAGGTGGGCAGGGCCCACACGG - Intergenic
938079596 2:128362716-128362738 TCAGGAAGGCCCAGCCCTCAGGG - Intergenic
938927538 2:136057982-136058004 TCAGGAGGGCAGAGCCCTCATGG + Intergenic
939288501 2:140163814-140163836 TCATGAAGGCAGAACCCTCATGG + Intergenic
939651082 2:144762868-144762890 CCATGAGGGCAGAACCCTCAGGG - Intergenic
942229753 2:173849358-173849380 CCAGGAGCACAGAGCCCAGAGGG - Intergenic
942750615 2:179282794-179282816 TCATGAAGGCAGAGCCCTCATGG - Intergenic
942844031 2:180401312-180401334 CAGAGAAGGCAGAGCACACATGG + Intergenic
943675812 2:190715599-190715621 CCAGAAAGGCAGAGGCCAGGGGG + Intergenic
943990250 2:194680556-194680578 TGATGAAGGCAGAGCCCTCATGG + Intergenic
946221687 2:218232946-218232968 TCATGAGGGCAGAGCCCTCATGG + Intronic
946436985 2:219663716-219663738 CCAGGAAGGAAGAGCCATGAAGG - Intergenic
947069001 2:226264986-226265008 CCAGGAATGCAGACACAACAAGG - Intergenic
947586578 2:231360490-231360512 CCAGGAAGGCTGAGCGGCCAGGG + Intronic
947832760 2:233153418-233153440 TCCGGAAGGCAAAACCCACAGGG + Intronic
948040206 2:234895623-234895645 CCAGGAAGGCAGTGCCTAATTGG - Intergenic
948052396 2:234988513-234988535 CCAGGGGAGCAGAGCCCAAAGGG + Intronic
948478736 2:238237664-238237686 CCAGGAGGTCAGAACCCTCAGGG - Intergenic
948761822 2:240197099-240197121 CCCACAAGGGAGAGCCCACAAGG + Intergenic
1168773237 20:429130-429152 CCTCTAAGGCAAAGCCCACAAGG - Intronic
1168891533 20:1298052-1298074 CCAGGAAGGAAGAGCTGTCATGG + Intronic
1168940028 20:1701631-1701653 CCAGGATGGGAGAGCCCAGTAGG - Intergenic
1168978970 20:1988883-1988905 CCAGGGAGGCAGAGCCAACAAGG - Intronic
1169031150 20:2408091-2408113 CCAGGAAGACAGAGTCCAACAGG + Intronic
1169189714 20:3650479-3650501 CCAGGACGGCAGAGGCCTCCTGG + Exonic
1169213216 20:3778957-3778979 CCAGGATGGCAGTGGCTACATGG - Exonic
1169300652 20:4439348-4439370 CCAGGAAGAGAGCCCCCACAAGG + Intergenic
1170285737 20:14706454-14706476 CTTGGAAGTCAGAGGCCACAAGG - Intronic
1171027077 20:21640590-21640612 GCAGGAAGACAGAGCCAAGATGG + Intergenic
1171214119 20:23339971-23339993 CCATGAAGACAGGGCCCTCAAGG + Intergenic
1172296778 20:33817625-33817647 ACATGAAGCCAGAGCCCACCAGG + Intronic
1172308139 20:33896405-33896427 CCACGCAGGCAGAGCCCTCATGG - Intergenic
1172493365 20:35359767-35359789 CCAAGAAAGCAGAGCCTAGATGG + Intronic
1173305399 20:41842643-41842665 CCAGTGAGGAAGAGCCCAGAAGG - Intergenic
1173873738 20:46357170-46357192 CCAAGTAGGCAGAGCCCTGAAGG - Intronic
1174092774 20:48062694-48062716 CCTGGATGGCTGAGTCCACATGG - Intergenic
1174102514 20:48138330-48138352 CCCAGAAGCCAGAGGCCACAAGG - Intergenic
1174124318 20:48291523-48291545 CCAGGATGGCTGAGTCCACGCGG + Intergenic
1175874656 20:62223680-62223702 CCATGAAGGCAGAGCCGGCATGG + Intergenic
1177006746 21:15682637-15682659 CCAGGAATGCAGAGGACCCAAGG - Intergenic
1179433306 21:41340508-41340530 TCAGGAGGGCAGAGTCCTCATGG + Intronic
1179596127 21:42444260-42444282 CCAGGCAGCCAGCGACCACAGGG + Intronic
1179728918 21:43356441-43356463 ACAGCAAGTCAGAGCCAACAGGG - Intergenic
1179880667 21:44292136-44292158 ACAGGAAGGGAGAGCCCAGCAGG - Intronic
1179881051 21:44293476-44293498 CCTGAAAGGCGGTGCCCACAGGG - Intronic
1179931752 21:44575276-44575298 CCAGGAGGACAGAGACCTCACGG - Exonic
1180023238 21:45142684-45142706 CCCAGTAGGCAGATCCCACACGG - Intronic
1180170442 21:46055508-46055530 CTAGGTGGGCAGAGCCCTCAGGG - Intergenic
1180180885 21:46118239-46118261 CCAGGAGGGCAGAGCCCCTGGGG - Intronic
1180225394 21:46388978-46389000 CCAGGACGGCAGTGCTCCCAAGG - Intronic
1180881950 22:19210458-19210480 CCATCAAGGCAGACCGCACACGG - Exonic
1181309508 22:21937020-21937042 CCCTGAAGCCAGAGCCCCCATGG - Intronic
1181481195 22:23200206-23200228 CCTGGATGTCTGAGCCCACACGG - Intronic
1181573736 22:23781357-23781379 CCTCGAAGGCAGCGTCCACAGGG - Exonic
1181758367 22:25041014-25041036 CGAGGGTGGCAGAGCCCAGAAGG - Exonic
1181768004 22:25105730-25105752 CCAGAAAAGCAGAGACCAAATGG - Intronic
1182447761 22:30399437-30399459 CCCGGGAGGCAGAGCTTACAGGG + Intronic
1183073524 22:35412404-35412426 CCCAGAAGGCAGAGCCCTTAGGG - Intronic
1183211583 22:36454849-36454871 CCAGGACGGCGCAGCCCACCGGG - Intergenic
1183228103 22:36563786-36563808 CCAGGGAGGCAGGGCCCGCTGGG + Intergenic
1183334070 22:37236736-37236758 CAAGGAACCCAGAGACCACAGGG + Intronic
1183349008 22:37324420-37324442 CCAGAGAGGCAAAGCTCACACGG - Intergenic
1183717133 22:39540107-39540129 TCTCGAAGGCTGAGCCCACAGGG - Intergenic
1184662407 22:45971461-45971483 CCGGCAAGGCAGAGCCCACGGGG - Intronic
1184722990 22:46326287-46326309 CCAGGAGAGCGGAGCTCACACGG + Intronic
1185000425 22:48242164-48242186 CCTGGAAAGGAGAGCCCAGATGG + Intergenic
1185214377 22:49590046-49590068 GCCGGAGGGCAGAGCCCACAGGG - Intronic
1185312091 22:50161868-50161890 CCAGGCATGCAGAGCCCACAGGG + Intergenic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
949524352 3:4888641-4888663 CCAGGAAGGGAGAGTCGCCAAGG - Intergenic
950106685 3:10393084-10393106 CCTGGAGGGCAGGGACCACAGGG - Intronic
950106770 3:10393523-10393545 CCAGGAAGGCAGAGCTGGGATGG + Intronic
950250289 3:11459582-11459604 CCTGGAAGCCAGAGCCAACAGGG + Intronic
950939895 3:16883246-16883268 CCAGGAATGCAGTCCCCGCAGGG - Intronic
952760046 3:36905488-36905510 CCAGGAAGACAGCCCTCACAGGG + Intronic
952991156 3:38832084-38832106 CTATGAGGGCAGAGCCCTCAGGG + Intergenic
953434991 3:42871156-42871178 CCAGGAAGCAAGAGCCCCCCAGG - Intronic
953756669 3:45652425-45652447 GCAGGAAAGCACAACCCACAGGG - Intronic
954387161 3:50250081-50250103 CCAGGGAGGCTGAGGTCACAGGG - Intronic
954459493 3:50618220-50618242 CCAGACAGGCAGGGGCCACAGGG - Intronic
954472699 3:50711789-50711811 CCAGAAAAGCACAGCCCAGATGG - Intronic
954502503 3:51031771-51031793 CCATGAGGGCAGAGCCCTCGTGG - Intronic
956086930 3:65621508-65621530 GAAGGAAGACAGAGCCCACTGGG + Intronic
956332806 3:68130131-68130153 CCTGGAATGAAGAGCCCAAAGGG + Intronic
959070357 3:101696009-101696031 CCGGGATGGGAGAGCCCCCATGG - Intergenic
960137555 3:114121351-114121373 CCATGAGGGCAAAGCCCTCATGG - Intergenic
960678841 3:120225865-120225887 CCAGGAAAGCAAAGTCCACGAGG + Intronic
961106935 3:124250281-124250303 CCAGGAAACCAGAGCCCAGCTGG + Intronic
961240070 3:125403005-125403027 CCATGAAGACAGAGGCCTCATGG + Intergenic
962374870 3:134851188-134851210 GCAGAAAGGCAGAGCCCAGCAGG + Intronic
962940818 3:140123278-140123300 TCATGAAGGCAGAGCCCTCATGG + Intronic
963793301 3:149605991-149606013 TCATGGGGGCAGAGCCCACATGG + Intronic
964359344 3:155878108-155878130 GCATGAGGGCAGAGCCCACACGG - Intronic
966060600 3:175749606-175749628 CCATAAAAGCAGAGCCCCCAAGG + Intronic
966338991 3:178903731-178903753 TCATGAAGGCAGTGCCCTCATGG - Intergenic
967870472 3:194225119-194225141 GCAGCAGGGCAGAGCCCACGGGG + Intergenic
968505831 4:971129-971151 CCAGGAAGTTAGAGGCCCCAGGG + Intronic
968699011 4:2046060-2046082 GGAGGAAGGCAGGGCCCACAGGG - Intergenic
969056706 4:4407050-4407072 CCAGGGCCGCAGTGCCCACAGGG - Intronic
969283941 4:6190783-6190805 CCAGGACGCCAGAGCTCCCAGGG + Intronic
969704762 4:8785719-8785741 GCATGGAGGCAGAGACCACAGGG + Intergenic
969842361 4:9891893-9891915 CCATGAAGCCAGAGCACACATGG + Intronic
969871239 4:10106499-10106521 CCAGGCTGGGAGAGCCCACGAGG - Intronic
970914787 4:21320620-21320642 CCAGGCAAGCAAAGCTCACAGGG - Intronic
973681708 4:53327324-53327346 CCAGGGTGGCAGAGCCAAAATGG + Intronic
974198576 4:58610008-58610030 TCATGAAAGCAGAGCCCTCATGG + Intergenic
974630331 4:64480095-64480117 CCTGGAAGCAAGAGCCCACTTGG + Intergenic
974687425 4:65247987-65248009 CTATGAGGGCAGAGCCCTCATGG - Intergenic
974973382 4:68858978-68859000 ACAGGAGGGCACAGCCCCCATGG - Intergenic
975559001 4:75692214-75692236 CCAGGAAGCCAGAGCACAAGAGG - Intronic
975954551 4:79821994-79822016 CCATGAGGGTAGAGCCCTCATGG + Intergenic
976550274 4:86386438-86386460 CCAGGACTGCAGGGACCACATGG + Intronic
976619534 4:87114449-87114471 CCAGGAGCACAGAGCCCCCACGG + Exonic
977652420 4:99485721-99485743 TCATGAAGGCAGAGCCCTCATGG - Intergenic
979107441 4:116705688-116705710 CAAGGAAGGCACCGCCCACGCGG + Intergenic
980937793 4:139242658-139242680 GCAGGGAGGCAGAGCCCCCGGGG + Intergenic
981145581 4:141320405-141320427 ACAAGATGGCAGAGTCCACATGG + Intergenic
981407491 4:144387845-144387867 CCATGAGGGCAGAGCCCTTATGG + Intergenic
981867520 4:149441869-149441891 CCATGAGGGCACAGCCCTCATGG + Intergenic
981891866 4:149747736-149747758 CTAGGAACGCAGGGACCACATGG + Intergenic
982106496 4:152016059-152016081 TCAGGAGGGCAGAGCCCTCATGG - Intergenic
982161070 4:152569940-152569962 CCATGATGGTAGAGCCCTCATGG - Intergenic
982278412 4:153659858-153659880 CCAGGAAGGCAGAGACCCCTTGG + Intergenic
983936808 4:173508106-173508128 CCAGGAAGAGGGAGCCGACAGGG - Intergenic
984156664 4:176202976-176202998 CCAGGAAAGCAGAGGGCACGTGG + Intergenic
984468710 4:180136257-180136279 ACAGGAAGGCAGAGCCGACCTGG + Intergenic
984709097 4:182869976-182869998 CCAGGAAGCCAGAGGGCACGGGG + Intergenic
985681216 5:1256899-1256921 CCAGGAAGGCCGAGCCCCAGCGG + Intronic
985710949 5:1429639-1429661 AAAGGAAGGCAGTCCCCACATGG + Intronic
985843863 5:2329873-2329895 CCAGCCAGTCAGAGCCCACTCGG - Intergenic
986814262 5:11390966-11390988 AAAGGAAGGCACAGGCCACAGGG + Intronic
987156527 5:15095197-15095219 GCAGAGAGGCAGAGCCCAGATGG - Intergenic
987303493 5:16617212-16617234 CCAGGAACCCAGAGCCCCCCGGG - Intergenic
987478288 5:18419846-18419868 CCAGGAGAGTAGAGCCCACATGG - Intergenic
987995536 5:25272979-25273001 CCGTGAAGGGAGAGCCCTCATGG + Intergenic
988169421 5:27634623-27634645 CCAGGATGGCAGGGGCCAAATGG - Intergenic
988566214 5:32321551-32321573 TCATGATGGCAGAGCCCTCAGGG + Intergenic
988699859 5:33662666-33662688 CCAGCCAGGCAGATGCCACAGGG - Intronic
989196779 5:38724108-38724130 TCATGAGGGCAGAGCCCTCAGGG - Intergenic
990100458 5:52178658-52178680 ACATGAGGACAGAGCCCACATGG - Intergenic
991007539 5:61844629-61844651 TCATGAAGGCAGAGCCCTCCTGG - Intergenic
991088518 5:62670990-62671012 CCAGAAAGGCAGGGCCCACATGG - Intergenic
991233840 5:64369641-64369663 ACAAGAAGGCAGTTCCCACACGG + Exonic
991769222 5:70025344-70025366 CCGGGAAGGCTGAGCCCTCGTGG - Exonic
991848517 5:70900762-70900784 CCGGGAAGGCTGAGCCCTCGTGG - Exonic
992002897 5:72452536-72452558 CCAGGAAGGAAGAAACCAGATGG - Intronic
992988694 5:82260646-82260668 TCAGAAAGGCAGAGTCCTCATGG - Intronic
993299937 5:86195982-86196004 CTATCAAGGCAGAGCACACATGG + Intergenic
994024940 5:95071160-95071182 CCAGGAAGGCTGTAGCCACAGGG + Intronic
994108812 5:95977353-95977375 TTAGGAGGGCAGAGCCCTCATGG - Intergenic
995631344 5:114136205-114136227 TCATGATGGCAGAGCCCTCATGG - Intergenic
995779591 5:115761513-115761535 TCATGAGGGCAGAGCCCTCATGG + Intergenic
995926841 5:117385288-117385310 CCAGCAGAGCAGAGCCCTCATGG - Intergenic
996780802 5:127184652-127184674 GCAGGAAGTTAGAGCCCGCACGG - Intergenic
997286190 5:132680421-132680443 CCAGGACAGCAGATCACACAAGG + Intronic
997750910 5:136344962-136344984 CCATGAGGGCAGAGACTACAGGG + Intronic
997904935 5:137807192-137807214 TCATGAGGGCAGAGCCCTCATGG + Intergenic
998039575 5:138943886-138943908 CAAGGAAGACAGAGCCCAGTGGG - Intergenic
998251428 5:140556021-140556043 CTAGGAAGATAGTGCCCACAGGG + Intronic
998577092 5:143328028-143328050 CCATGGAGGCAGAGCCTTCATGG - Intronic
999136795 5:149325877-149325899 CCATGAAGGCAAAGCCCTCATGG + Intronic
999324132 5:150632623-150632645 CCTGGAGGGCAGAGCCGAAAGGG - Intronic
1000107945 5:158078674-158078696 CCAGCAAGGGACACCCCACAAGG - Intergenic
1001144451 5:169171632-169171654 ACAGGATGGCAGAGCAAACAAGG + Intronic
1001195392 5:169668913-169668935 CCAGGAAGGCAATGGACACAAGG + Intronic
1002106448 5:176881543-176881565 CCAGGAAGGAAGAGAGCACAGGG + Intronic
1002306157 5:178285108-178285130 TGAGGAAGTCAGAGCCGACAAGG - Intronic
1002399863 5:178985625-178985647 CCCGGAAGGCAGAGCTTGCAGGG + Intronic
1002443448 5:179275932-179275954 CCAGGATGCCTGAGCCCAGAGGG - Intronic
1002519486 5:179783315-179783337 CCAGGAAGCCATGGCCCACAAGG + Intronic
1002639518 5:180624099-180624121 ACAGGCAGGAAGGGCCCACATGG + Intronic
1002886983 6:1306201-1306223 TCATGAAGGCAGAGTCCTCATGG - Intergenic
1002921228 6:1574867-1574889 CTAGAAAGGCAGTTCCCACAGGG + Intergenic
1003163784 6:3658545-3658567 TCATGAAGGCAGAGCCCTTATGG + Intergenic
1003490863 6:6620432-6620454 CCAGCAACGCAGAGGCCACAGGG + Intronic
1006520040 6:34565966-34565988 CCAGGCAGGCAGGGAGCACAGGG - Intergenic
1008275496 6:49539501-49539523 TCATGAAGGCAGAGCCCTCATGG - Intergenic
1008933259 6:56962031-56962053 TCATGAGGGCAGAGCCCTCATGG - Intronic
1009194698 6:60669659-60669681 CAAAGAAGCCAGAGCACACAGGG - Intergenic
1009294572 6:61930022-61930044 TCATGAAGGCAGAGCCTTCATGG + Intronic
1009619009 6:66047058-66047080 ACATGAAGGCAGAGTCCTCATGG - Intergenic
1010012858 6:71069290-71069312 CCATCAGGGCAGAGCCCTCATGG + Intergenic
1010131481 6:72499512-72499534 CCAGGTAAGCAGTGTCCACACGG + Intergenic
1010661299 6:78573347-78573369 TCATGAAGGCAGATCCCCCATGG - Intergenic
1010905005 6:81476683-81476705 TCATGAAGGCAAAGCCCTCATGG - Intergenic
1011038372 6:83002349-83002371 CCATGAGGGCAGAGCCATCATGG - Intronic
1013318818 6:108967047-108967069 CCAGAATGGCAGAGCCCAGGGGG - Intronic
1014771446 6:125462227-125462249 CCATGAAGGTGGAGCCCTCATGG + Intergenic
1015042382 6:128738011-128738033 TCAGGAATGCAGAGCTCAAAAGG + Intergenic
1015410571 6:132889459-132889481 CCAGGAAGGCAGAGTTCAATAGG - Intergenic
1015707964 6:136108901-136108923 GAAGGAAGGCAGACCCCAGAAGG - Intronic
1017148898 6:151260479-151260501 CTAGGAAGGCAGAGTGCACAGGG - Intronic
1017718469 6:157228536-157228558 CCTGCAAGGCAGAGCCCAAGGGG - Intergenic
1018713470 6:166514283-166514305 CCAGGAAGTGAGAGCCCAGTGGG + Intronic
1019324426 7:431297-431319 CGAGGAAGAAAGAGCCCAGATGG - Intergenic
1020368122 7:7401993-7402015 CCAGGAATGCAGAGTACAGAAGG + Intronic
1020420167 7:7994584-7994606 TCATGAAGGCAGAGCCCTCATGG + Intronic
1020462280 7:8439339-8439361 CCAGGAAAGCATCTCCCACAGGG + Intronic
1021938280 7:25653168-25653190 TCAGGAAGGTAGAGCCTAAAGGG - Intergenic
1022369785 7:29759619-29759641 CCATGAGGGCAGAGCCCTCATGG - Intergenic
1022425329 7:30263349-30263371 CCAGGAAGTCAGAGCACAGATGG - Intergenic
1022783450 7:33610591-33610613 TCATGAGGGCAGAGCCCCCATGG + Intergenic
1023089906 7:36608065-36608087 CCAGGAAGGGAGAGCCAGCCTGG - Intronic
1023558789 7:41450767-41450789 GCAGGAAGGTAGAGCTCAAAAGG + Intergenic
1023677597 7:42646820-42646842 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1023865190 7:44235093-44235115 CCAGGAAGGCAGGGCCCGGGAGG - Intronic
1024059607 7:45687940-45687962 CCAGACAGGCACAGCCCAGAGGG + Intronic
1024247985 7:47484881-47484903 CGAGGAAGGCCAAGCCCACCTGG - Intronic
1024259705 7:47564750-47564772 CCAGGGAAGCAGAACCAACAGGG - Intronic
1024309224 7:47953789-47953811 CCAAGGAGGCAGAGCACATAAGG - Intronic
1024365228 7:48512928-48512950 CCAGGGAAGAAGAGCCCCCAAGG + Intronic
1024672207 7:51606642-51606664 ACAGGCAGGCACAGCCAACAGGG - Intergenic
1024675627 7:51635750-51635772 GCAGGAAGGAAGAACCCACCAGG - Intergenic
1025104687 7:56161373-56161395 CCAGGAATGCAAAGCCAAAAGGG + Intergenic
1025161454 7:56664838-56664860 CCAGGAGGGCAGAGCCCAGCAGG - Intergenic
1026742051 7:72984929-72984951 CCAGGAAGGGTGAGGCCCCAGGG - Intergenic
1026801896 7:73405357-73405379 CCAGGAAGGGTGAGGCCCCAGGG - Intergenic
1027101684 7:75380148-75380170 CCAGGAAGGGTGAGGCCCCAGGG + Intergenic
1029650080 7:101885600-101885622 CCAGGAAGGCCCAGGCCGCAGGG + Intronic
1030828253 7:114187947-114187969 CCATGAAAGCAGAGCCCTCATGG + Intronic
1030986472 7:116247098-116247120 CCATGATGGCAGAGAGCACATGG + Intronic
1032016609 7:128384099-128384121 CCAGGGCTGCAGAGCACACAAGG + Intergenic
1032524896 7:132572666-132572688 GTAGGAAGGTGGAGCCCACAGGG - Intronic
1032852343 7:135805731-135805753 TCACGAGGGCAGAGCCCTCATGG + Intergenic
1032959548 7:137015645-137015667 CCAGAATGGCAAAGCCCCCAGGG + Exonic
1033008282 7:137591096-137591118 TCACAAAGGCAGAGCCCACAGGG + Intronic
1033092774 7:138402435-138402457 TCAGGAGGGCAGAGCCCTTATGG + Intergenic
1033473441 7:141668720-141668742 CCAGGGAAGCACTGCCCACAGGG + Intronic
1033511876 7:142067383-142067405 CCAGGAAGGCTGGGCCCAGCAGG - Intronic
1033514948 7:142096373-142096395 CCAGGAAGGCTGGGCCCAGCAGG - Exonic
1034459716 7:151191691-151191713 CCAGGAACTCAGAGGCCACCAGG + Exonic
1034932879 7:155177126-155177148 CCACGAGAGCAGAGCCCTCATGG + Intergenic
1036121891 8:6027233-6027255 CCACGAAGGTGGAGCCCTCATGG + Intergenic
1036161670 8:6394659-6394681 CCAAGAATGCAGAACCCAAATGG - Intergenic
1036190952 8:6670503-6670525 CCAATAAGACATAGCCCACAGGG + Intergenic
1036476948 8:9102137-9102159 CCAGGTAGGCAGAGTCTTCAGGG - Intronic
1036618539 8:10406951-10406973 CCCAGAAGGCTGAGGCCACAGGG - Intronic
1037462277 8:19123257-19123279 TCATGAAGGCAGAGCCCTCATGG + Intergenic
1038068863 8:23991696-23991718 ACAGGAATGCAGAAGCCACAAGG - Intergenic
1038841421 8:31187986-31188008 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1038936643 8:32259289-32259311 TTATGAAGGCAGAGCCCTCATGG - Intronic
1039706786 8:40015618-40015640 CCAGCAATGCAGAGCCCCCATGG + Exonic
1040110196 8:43563817-43563839 CCAGGAAGGCACTGGCCTCAGGG + Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1040655503 8:49502918-49502940 TCATGAAGGCAGAGCCATCATGG + Intergenic
1040691288 8:49941638-49941660 GCAGGCAGCCAGAGCCCAGAGGG - Intronic
1040737784 8:50531646-50531668 CCTGGGAGTCAGAGCTCACAGGG + Intronic
1040807442 8:51409312-51409334 ACAGGAAGGCCGAGCCCGCGGGG + Exonic
1041168341 8:55114456-55114478 ACAGGAAGTCAGAGTCCAGAGGG + Intronic
1041211222 8:55553041-55553063 CCAGGAAGAGAGCTCCCACAAGG - Intergenic
1042474696 8:69233893-69233915 CCATGAGGGCAGAGACCTCAGGG - Intergenic
1043310203 8:78849569-78849591 ACAGGAAGGCAGATCCCTCATGG - Intergenic
1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG + Intronic
1044544892 8:93448694-93448716 TCATGAAGGCAGAGCCCTCATGG + Intergenic
1044799953 8:95944028-95944050 CAAAAAAGGCAGAGCCCAGAAGG + Intergenic
1045655846 8:104385692-104385714 TCATAAAGGCAGAGCCCTCATGG - Intronic
1046395166 8:113631993-113632015 CCAGGAATGAAGGGCCCAAAAGG + Intergenic
1046418666 8:113949069-113949091 TTAGGAGGGCAGAGCCCTCATGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1049178309 8:141207115-141207137 CCAGGAAGGCAGAGGGCAGGAGG + Intergenic
1049277103 8:141725363-141725385 CCTGGCAGGCAGAGCCCAGCAGG - Intergenic
1049500194 8:142958933-142958955 CCCCGAAGGCAGAGACCAAAAGG - Intergenic
1049587084 8:143437190-143437212 CCAGGCAGGCAGAGGGCACAAGG + Intergenic
1049618404 8:143586625-143586647 CCAGGAAGGCAGAGGCACCCTGG - Intronic
1049684415 8:143933649-143933671 CCAGGAGGACAGGGCCCACGTGG - Intronic
1051601444 9:18878439-18878461 CCAGGAACTGAGAGCCAACAGGG + Intronic
1051602070 9:18885296-18885318 CCATGAGGACAGAGCCCTCATGG + Intronic
1052143301 9:25016354-25016376 TCATGAAGGCAGAGCCTTCATGG + Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1053297801 9:36927328-36927350 CCAAGAAAGCAGAGCCAACCTGG + Intronic
1053459665 9:38258522-38258544 TCATGAGGGCAGAGCCCTCACGG + Intergenic
1053512581 9:38701209-38701231 TGGGGGAGGCAGAGCCCACAGGG + Intergenic
1056542040 9:87580209-87580231 TCAGGAAGAAAGAGCACACAGGG - Intronic
1056585356 9:87924365-87924387 CTAGGAAGTCAGAGCCTGCAAGG + Intergenic
1056601843 9:88052895-88052917 CAAGGAAGCCAGAGCCCAGTGGG + Intergenic
1056602958 9:88060913-88060935 CAAGGAAGGCACTGCCCACTGGG + Intergenic
1056611525 9:88128575-88128597 CTAGGAAGTCAGAGCCTGCAAGG - Intergenic
1056782843 9:89564314-89564336 CCAGGACTGCAGAGGACACACGG + Intergenic
1057163382 9:92907233-92907255 CCTGGAAGGCAAAGACCAAAAGG + Intergenic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1057387189 9:94614462-94614484 CCAGGGAGGCAGAGGTCGCAGGG + Intronic
1057569825 9:96196111-96196133 GCAGGAAGGCTGGGACCACAAGG + Intergenic
1058170702 9:101677694-101677716 AAAGGAAGGCAGATACCACAGGG - Intronic
1059881608 9:118696497-118696519 CCATGATGGCAAAGCCCTCATGG - Intergenic
1060739279 9:126087635-126087657 TCATGAGGGCAGAGCCCCCATGG + Intergenic
1060961600 9:127684688-127684710 CCAGCAGGTCAGAGCCCAGAGGG - Intronic
1060969754 9:127731317-127731339 CCAGCAAGGCCGAGTCCACCTGG + Exonic
1061045684 9:128163725-128163747 CCAGGCAGGCAGACCCACCAGGG - Exonic
1061338713 9:129961658-129961680 CCCGGGAGGCAGAGGTCACAGGG - Intronic
1061564558 9:131429430-131429452 CTAGCAAGGGAGAGACCACATGG - Intronic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1061787727 9:133040606-133040628 ACAGCAAGTCAGAGCCCAAATGG + Intronic
1061858984 9:133458321-133458343 CCAGGAGGGCAGATCACTCAAGG + Intronic
1062055415 9:134467393-134467415 CCAGGATGGCAGAGCCGCCTGGG - Intergenic
1062088091 9:134658800-134658822 CCAGGACCCCAGAGCCCACCTGG - Intronic
1062174325 9:135152637-135152659 CTTGGAAGGCAGAGCTCCCAGGG + Intergenic
1062485623 9:136773824-136773846 CCTGGATGCCAGTGCCCACATGG - Intergenic
1187087464 X:16056147-16056169 CCAAGAAGGAAGGGACCACATGG - Intergenic
1188377399 X:29448842-29448864 CCAGGAAGCCAGCCCTCACAAGG - Intronic
1188480466 X:30632028-30632050 CCATGAAGGTAGAGCCCTCATGG - Intergenic
1189102039 X:38200731-38200753 TCATGAAGGCAGAGCCCTAATGG + Intronic
1189380018 X:40496083-40496105 CCATGAGGGCAGAGTCCCCAGGG - Intergenic
1189774498 X:44458260-44458282 CCATGAGAGCAGAGCCCTCATGG + Intergenic
1189916174 X:45857826-45857848 CCATGAGAGCAGAGCCCTCATGG + Intergenic
1190304550 X:49074574-49074596 CCAGGAAGGCAGCGACCCCTTGG - Intronic
1190581691 X:51896805-51896827 CCTGGATGGCAGACCCCACCGGG + Exonic
1192017738 X:67349817-67349839 CCGTAAAGGCAGAGCCCTCATGG + Intergenic
1192038935 X:67596567-67596589 TGAGGAAGGCAGAATCCACAAGG - Intronic
1192177603 X:68895579-68895601 CTAGGAAGACAGAGCCCCCCAGG + Intergenic
1192178505 X:68900821-68900843 CCAAGCAGGCAGAGCCCAGTGGG - Intergenic
1193242022 X:79181610-79181632 GAAGTAATGCAGAGCCCACAGGG - Intergenic
1193682746 X:84541789-84541811 CCACAGAGGCAGAGCCCTCATGG + Intergenic
1194866255 X:99071932-99071954 TCAGCAAGGCAGAGACCACGAGG - Intergenic
1195088060 X:101431617-101431639 CCCGGAAGGCAGAGCTTGCAGGG - Intronic
1195292572 X:103443343-103443365 TCATGAAGGCAGAACCCTCATGG - Intergenic
1196622052 X:117835150-117835172 CCAGGAAGGTTGAGAACACAAGG + Intergenic
1196870702 X:120110504-120110526 CCAGTAAGGCAGGGCCCCCTAGG + Intronic
1197257027 X:124274559-124274581 GCAGGGAGGCAGAGCACGCAAGG - Intronic
1197866559 X:131025320-131025342 CTGGAAAGGCAGAGCCCAGAGGG + Intergenic
1198120725 X:133590005-133590027 CCATGAGGGCAGAGCTCTCATGG - Intronic
1198137977 X:133773292-133773314 TCATGAAGGCAGAGCCCAGGCGG + Intronic
1199926393 X:152470054-152470076 CCATGGAGGCAGAACCCACAGGG + Intergenic
1199983395 X:152933497-152933519 CCAAGAAGCCAGAGCCCAGCTGG - Intronic
1200215155 X:154365030-154365052 CCAGGCAGGAAGAGCCCATGTGG + Intronic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201980861 Y:19909003-19909025 GCTGCAAGGCAGCGCCCACACGG - Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic