ID: 1061723387

View in Genome Browser
Species Human (GRCh38)
Location 9:132567585-132567607
Sequence CAGCCCTCAAGCCATTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061723387_1061723391 25 Left 1061723387 9:132567585-132567607 CCCAGGGAATGGCTTGAGGGCTG 0: 1
1: 0
2: 1
3: 18
4: 213
Right 1061723391 9:132567633-132567655 CAAATTGTCACAAACCTTGGTGG No data
1061723387_1061723389 -7 Left 1061723387 9:132567585-132567607 CCCAGGGAATGGCTTGAGGGCTG 0: 1
1: 0
2: 1
3: 18
4: 213
Right 1061723389 9:132567601-132567623 AGGGCTGTATTAGCTTCTAGAGG No data
1061723387_1061723390 22 Left 1061723387 9:132567585-132567607 CCCAGGGAATGGCTTGAGGGCTG 0: 1
1: 0
2: 1
3: 18
4: 213
Right 1061723390 9:132567630-132567652 TAACAAATTGTCACAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061723387 Original CRISPR CAGCCCTCAAGCCATTCCCT GGG (reversed) Intronic
900905584 1:5554865-5554887 CCCCCCTCAACCCATTTCCTTGG + Intergenic
900915423 1:5635083-5635105 CAGCTCTGAAGACATTCCCCAGG - Intergenic
901905655 1:12407298-12407320 CAGATCCCAAGCTATTCCCTCGG - Intronic
902440700 1:16428030-16428052 CAGCCCTCAAGCCACTGCCATGG - Intronic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
903770963 1:25764078-25764100 CAGCCAGCAAGGCATTCGCTCGG + Intronic
903951298 1:26997487-26997509 CAGCCCCCAAGGGATCCCCTGGG - Intronic
905267474 1:36764765-36764787 CAGCCCTGAAGGCAACCCCTGGG - Intergenic
905865042 1:41372039-41372061 GAGCCCTCAATCCCTTCCCGGGG - Intronic
907087039 1:51685027-51685049 CAGCCCTACAGCCCTTCCCTAGG + Intronic
907518904 1:55010556-55010578 CAACCCGGAAGCCCTTCCCTAGG - Exonic
907559440 1:55375234-55375256 CAGCCCTAAGGCCCTTGCCTAGG + Intergenic
907657402 1:56358164-56358186 CAGCACCCAAGTCATTTCCTGGG + Intergenic
911039863 1:93583034-93583056 CAGCCCTCCATTCATGCCCTTGG + Intronic
912278427 1:108286586-108286608 CACCCATCAACCCATTACCTGGG + Intergenic
912289799 1:108407771-108407793 CACCCATCAACCCATTACCTGGG - Intronic
912551688 1:110489308-110489330 CAGCCCTCAGCCCCTTCCCTGGG - Intergenic
913537028 1:119782926-119782948 CAGCCCTGCAGGCATTTCCTAGG + Intergenic
916947716 1:169745476-169745498 AAACCCACAAGTCATTCCCTGGG + Intronic
917937376 1:179882298-179882320 CAGCCCTCAAGACACACCATGGG + Exonic
919617883 1:199830219-199830241 AATCCCTCAAGCCAAACCCTTGG + Intergenic
919796547 1:201324656-201324678 CATCCTTTAAGCCATTCCCTGGG + Intronic
923080839 1:230653312-230653334 CAGGCCTCAAGCAATTCTCATGG + Intronic
923161637 1:231319305-231319327 CAGTCCTCAGGACAGTCCCTAGG - Intergenic
923264458 1:232300839-232300861 CTGCCCTCAGGCCCTTTCCTTGG - Intergenic
923460454 1:234205612-234205634 AAGCCCTCATGCCTTTCTCTAGG - Intronic
923811567 1:237323792-237323814 AAACACTCAAGTCATTCCCTTGG - Intronic
1064580456 10:16787858-16787880 CAGTCCTAAAGCCATTAACTGGG - Intronic
1071553708 10:86586396-86586418 CTACCCTCAAGCCTTTTCCTCGG + Intergenic
1073327175 10:102649792-102649814 CATGCCTCAAGCCACTGCCTTGG - Intronic
1073357584 10:102869622-102869644 CAGCCCCCAGCCCCTTCCCTGGG + Intronic
1075091067 10:119444442-119444464 CGGCCCTCAGGCCCTTCCCTGGG + Intronic
1075791767 10:125089815-125089837 CACCCATTAGGCCATTCCCTTGG - Intronic
1075937248 10:126352883-126352905 CTGCACTGAAACCATTCCCTGGG - Intronic
1076757205 10:132578815-132578837 CAGCCACCATGCCATTCCCTGGG - Intronic
1077098784 11:811894-811916 TAGCCCTGAGGCCATTCCCCAGG + Intronic
1079584404 11:22107927-22107949 CATCCGTAAAGCCATGCCCTTGG + Intergenic
1080036196 11:27714150-27714172 AAGACTGCAAGCCATTCCCTGGG - Intronic
1080140766 11:28917092-28917114 CACCCATCAACCCATTACCTAGG - Intergenic
1082254121 11:50013598-50013620 CAGCGCTGAAGCAATTCCCCTGG + Intergenic
1083306920 11:61766149-61766171 CTGCCCCCAAGCCCTTCCCGGGG + Exonic
1083514157 11:63241219-63241241 CAGGCCTGAAGCCATTCCATGGG + Intronic
1083848803 11:65353528-65353550 CAGCCCTGCAGCCTTTCCCAGGG + Intergenic
1085747032 11:79123746-79123768 TAGCCTTCAGGCCATTCTCTAGG + Intronic
1085828907 11:79878389-79878411 CAGCCCAAGAGCCATTCCCAAGG - Intergenic
1086484523 11:87284156-87284178 CTGCACTCATGCCATTTCCTTGG + Intronic
1086731121 11:90250831-90250853 CAGTCCCCAAACCATTCTCTAGG - Intergenic
1088566008 11:111173757-111173779 CAGGCCTCAACCCATACCCTTGG + Intergenic
1089078959 11:115760471-115760493 CAGCCCTCCACCCCTTCCCCTGG - Intergenic
1090621220 11:128562701-128562723 CAGCCCTAAAGCCACCACCTGGG + Intronic
1090671765 11:128952449-128952471 CAGCCCAAAGGGCATTCCCTTGG - Intergenic
1092994269 12:13933554-13933576 CAACCCACTAGCCATTCCCTAGG + Intronic
1095450617 12:42326856-42326878 CAGGCCTCTAACCACTCCCTGGG + Intronic
1096138234 12:49220613-49220635 CCCCCTTCAAGCCCTTCCCTTGG - Intronic
1098292406 12:68968962-68968984 CTGCCCCCAACCCATTCCCACGG - Intronic
1099919220 12:88936374-88936396 CTGCCCTCCACCCATTCCCATGG - Intergenic
1100615938 12:96231850-96231872 CAGCCATCCAGCCATCCCTTTGG + Intronic
1103588153 12:121971351-121971373 CAGACCTTAAGCCAGTCCGTGGG + Intronic
1105971458 13:25432546-25432568 CAGCCCACAAGCACATCCCTAGG - Intronic
1107870871 13:44745464-44745486 CAGCACTCACGTCACTCCCTTGG + Intergenic
1108089325 13:46830355-46830377 CATCCCATATGCCATTCCCTTGG - Intergenic
1110830431 13:80024957-80024979 CAACCCCCAAGGCATTCCCTTGG + Intergenic
1112723572 13:102275540-102275562 CAGCCATAAAGGCATTCCATTGG + Intronic
1113070833 13:106419640-106419662 CACCCATCAACCCATCCCCTAGG + Intergenic
1119423898 14:74523837-74523859 CATTCCCCAACCCATTCCCTTGG - Intronic
1119739396 14:77004357-77004379 CAGGCCTCCAGCTCTTCCCTGGG - Intergenic
1122943679 14:104995077-104995099 CAGCCCAGAAGCCATGCCCAGGG - Exonic
1123200221 14:106656456-106656478 CAGACCTCAAGCCCTTTTCTTGG - Intergenic
1123217688 14:106827087-106827109 CAGGGCTCAAGCCTTTTCCTGGG - Intergenic
1124604058 15:31157754-31157776 CAGCTCTGAAGCTCTTCCCTTGG - Intronic
1126073225 15:44884004-44884026 CAGCTCTTAAGCCATTCCTGGGG - Intergenic
1126085036 15:45003620-45003642 CAGCTCTTAAGCCATTCCTGGGG + Intergenic
1128888120 15:71307028-71307050 CCTCCCTCAAGCCATACTCTTGG + Intronic
1129190745 15:73936188-73936210 CAGCCATCAAGCCAGGCCCAGGG - Intronic
1130270827 15:82445955-82445977 CAGCCCCCAAGCCAGCCCCGCGG - Intergenic
1130463167 15:84173278-84173300 CAGCCCCCAAGCCAGCCCCGCGG - Intronic
1130489507 15:84421510-84421532 CAGCCCCCAAGCCAGCCCCGCGG + Intergenic
1130501098 15:84500272-84500294 CAGCCCCCAAGCCAGCCCCGCGG + Intergenic
1130991845 15:88880208-88880230 GAGCCCTCACCCCATTCCCGGGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1138436680 16:57004687-57004709 CAGCCCACAGGCCTTTGCCTTGG - Intronic
1138491674 16:57380774-57380796 CAGCCCTGAGGCCTTTCCCCAGG + Intronic
1138857650 16:60713640-60713662 CAGTCCTAATGCCCTTCCCTGGG - Intergenic
1140975266 16:80054056-80054078 CAGCTATCAAGCCATCACCTTGG + Intergenic
1141590584 16:85066196-85066218 CACCCCTCAAGCCTCTGCCTCGG - Intronic
1142863859 17:2778739-2778761 CAGCCTGCAAGCCTTTCTCTCGG - Intronic
1147138906 17:38450864-38450886 CAGCCTTCAAGCCCCTCCCCAGG + Intronic
1147966609 17:44197554-44197576 CAGCAGTCCAGCCCTTCCCTGGG - Intronic
1147988083 17:44317995-44318017 CAGCCCTCAAGTCACCCCCCAGG - Intronic
1151078780 17:71304596-71304618 CAGGCCTCACCCCACTCCCTTGG - Intergenic
1151325389 17:73376800-73376822 CACCCCTCAAGGCATTGCCCAGG - Intronic
1152170298 17:78741882-78741904 CAACCCTCAAGCCAGATCCTGGG + Intronic
1153591868 18:6682928-6682950 CTGCCCCCAAGCTATTCCCAGGG + Intergenic
1154231779 18:12562582-12562604 CACCCATCAACCCATTACCTAGG + Intronic
1156268608 18:35510893-35510915 CAGGCCTCATGCTGTTCCCTTGG + Intergenic
1157292967 18:46423139-46423161 AAGCCCTAAAGCCTTTCCTTTGG + Intronic
1159350863 18:67270823-67270845 GAGCCCACAAGGCATTTCCTTGG + Intergenic
1160311230 18:77792379-77792401 CAGACCTCAAGAAATGCCCTAGG - Intergenic
1160424108 18:78768473-78768495 CAGCCATGAAGCCATGTCCTTGG - Intergenic
1161578016 19:5065540-5065562 CATCCATCAAGCCATTCCGGGGG + Intronic
1161666986 19:5583110-5583132 CAGCCCTTCAGCCATTTCTTTGG - Intergenic
1163501888 19:17681129-17681151 CAAGGCTCAAGCCATCCCCTCGG + Intronic
1163811927 19:19438485-19438507 CTGCCCTCAAACAATGCCCTGGG - Intronic
1165068717 19:33243054-33243076 CTGCCCTAATGCCTTTCCCTGGG - Intergenic
1165092863 19:33395854-33395876 CAGCCCTCAGGGCCTGCCCTGGG - Intronic
1165152888 19:33771339-33771361 CAGCCCATAAGCAGTTCCCTGGG + Intronic
1165447663 19:35865446-35865468 CAGCCGACATGCCATTCTCTTGG + Intronic
1166296330 19:41891855-41891877 CACCCCTAAAGCCAGGCCCTGGG - Intronic
1166333565 19:42092103-42092125 CAGCCCTCAAGGCAGCCACTCGG - Exonic
1167009406 19:46796793-46796815 AAGACCTAAAGCCATTTCCTAGG - Intergenic
1167250583 19:48396659-48396681 GAGCCCCCAACCCCTTCCCTGGG + Intronic
1167291486 19:48627593-48627615 CAGCCCTCCACCAATTCCGTTGG + Intronic
1168706941 19:58475774-58475796 CCGCCCCCACGCCATTCCCCGGG - Intronic
925267403 2:2575797-2575819 CAGCACTCAGGCAGTTCCCTAGG - Intergenic
926227467 2:10978556-10978578 CAGCCCACAGGGCTTTCCCTGGG - Intergenic
927640837 2:24844366-24844388 CAGCCATCCAGCCAGGCCCTAGG - Intronic
931248241 2:60508715-60508737 CAGGCCTCCAGCTATTCCCACGG - Intronic
944126218 2:196295761-196295783 CAGACCTGAAGTAATTCCCTGGG + Intronic
944359058 2:198829977-198829999 CACCCATCAACCCATTACCTAGG - Intergenic
944557338 2:200900459-200900481 TAGCCCTCTGGCCATTCCTTTGG + Intronic
946178532 2:217936558-217936580 CAGGCCTCAAGCCAGGGCCTGGG - Intronic
946364268 2:219238868-219238890 GATCCCTGAAGCCCTTCCCTGGG - Intronic
947684785 2:232073381-232073403 CAGTTCTCAAGCCATTTCCGCGG + Intronic
948262042 2:236611708-236611730 CAGCCCTCATGACTTGCCCTGGG - Intergenic
948368888 2:237475196-237475218 CGGCCCTCCAGCCCTTCCCGGGG - Intergenic
948750265 2:240128151-240128173 CCTTCCTCAAGCCTTTCCCTTGG + Intronic
1170045381 20:12079943-12079965 CTGCACTCAAGCCATTTCCTCGG - Intergenic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1174136404 20:48382985-48383007 CAGCTCTCAGGCCATCACCTGGG - Intergenic
1174274514 20:49394009-49394031 CATCCCTGAAGCCATCCCTTTGG + Intronic
1178123657 21:29494738-29494760 CAGCCCTCAAGATAATGCCTTGG - Intronic
1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG + Intergenic
1181047533 22:20222726-20222748 CAGACCCCAAGCCATTCCCCAGG - Intergenic
1183184869 22:36286029-36286051 CTCCCCTCAAGCCCTTCCCCAGG + Intronic
1183290710 22:37000105-37000127 CAGCCCTCAACCTATTCACAGGG + Intronic
1184361814 22:44023744-44023766 CGGCCTGCAAGCCATTTCCTGGG + Intronic
1185026350 22:48415699-48415721 CAGCCTTCATGCCATCCCCTCGG + Intergenic
950623896 3:14230324-14230346 TAGCTTTCAAGCCATTTCCTTGG + Intergenic
951840288 3:27026932-27026954 TCTCCCTCAAGGCATTCCCTAGG + Intergenic
953075694 3:39568355-39568377 CAGCTCTAAAGTCATTTCCTGGG - Intergenic
954002229 3:47566753-47566775 CGGCACTCAAGCCATCCCTTAGG - Intronic
954365555 3:50144322-50144344 TTGCCCTCAAGCCTTTGCCTAGG - Intergenic
954784695 3:53084282-53084304 CACCCCTTATGCCATTCCCCTGG + Intronic
955793036 3:62607799-62607821 AAACCCACAAGCCAGTCCCTGGG - Intronic
955992770 3:64645767-64645789 GAGCCTTCAAGGCATTCCCAAGG - Intronic
956020181 3:64925730-64925752 CAGCCCTCAAGGCATCCTCCAGG + Intergenic
956840879 3:73138680-73138702 CGGCCCTCAAGTTGTTCCCTGGG - Intergenic
960094024 3:113670832-113670854 CTGCCCTCAGCCCCTTCCCTGGG + Intronic
961222085 3:125209103-125209125 TAGCCCTCAAGAAATTTCCTGGG - Intronic
962284971 3:134077867-134077889 CAGACCTCCTGCCATTCTCTTGG + Intronic
962347636 3:134630261-134630283 CAGCCCCCAGGCAATTCTCTTGG + Intronic
963532574 3:146489224-146489246 CAACCATCAAGCCATCACCTAGG - Intronic
965021085 3:163232020-163232042 CAGCCATCAACCCATTATCTAGG - Intergenic
965256801 3:166424168-166424190 CAGGCCTCCAGCCCTGCCCTGGG - Intergenic
968907456 4:3461306-3461328 CAGCTCTCCAGCCTTCCCCTTGG + Intergenic
969236527 4:5869355-5869377 CTGCCCTGAAGCCCATCCCTTGG + Intronic
969710456 4:8840371-8840393 CTTCCCTCAAGCCAGTCCCAAGG + Intergenic
970142208 4:12995111-12995133 CAGCTCTCAAGCCATTCATGAGG + Intergenic
972285711 4:37645960-37645982 CTGCCCTCAGGCCCTGCCCTGGG - Intronic
972355401 4:38275795-38275817 CAGCCCTCACACAAATCCCTGGG - Intergenic
972400746 4:38701205-38701227 CAGCCCTCAAGCTATGTCCCTGG + Intergenic
972820116 4:42691956-42691978 CATCCCTGAGGCCATGCCCTGGG + Intergenic
972848411 4:43018225-43018247 CTGCCCTCAGGTCTTTCCCTTGG - Intronic
973578046 4:52312738-52312760 CAGCCCACCAGCTATTCTCTTGG - Intergenic
974924772 4:68283420-68283442 CAGGCCTCAAGCGATCCTCTAGG - Intergenic
975636983 4:76460149-76460171 TAGCCCTCAACACTTTCCCTTGG - Intronic
983557373 4:169070476-169070498 AAGCCAACAAGCTATTCCCTGGG - Intergenic
983671890 4:170247142-170247164 AAGACCTCCAGCCTTTCCCTAGG + Intergenic
985207465 4:187554640-187554662 CAGCACTCAAGACCTTCGCTGGG - Intergenic
985589073 5:755492-755514 CAGCCCTGTAGCCACCCCCTAGG + Intronic
985603753 5:848008-848030 CAGCCCTGTAGCCAACCCCTAGG + Intronic
985952305 5:3231658-3231680 CTGCCCTCAAGCACTTCTCTAGG + Intergenic
991259095 5:64647712-64647734 CAGGCCTCAGGCTATACCCTTGG - Intergenic
991500243 5:67269425-67269447 CAGCAATCAAGCCATTTCCCTGG - Intergenic
992021652 5:72630638-72630660 AAGCTCTCAAGCCATTGACTTGG - Intergenic
992616143 5:78547959-78547981 GAGTCTTCCAGCCATTCCCTGGG - Intronic
993091266 5:83429476-83429498 CAACCCACAAGCCCTTCCCAAGG + Intergenic
994153089 5:96472682-96472704 CAGACCTAAAGCCATTACATGGG - Intergenic
997362110 5:133301717-133301739 CAGCCTGCAAGCTATGCCCTTGG - Intronic
997597786 5:135118683-135118705 GTCCCCTCAAGTCATTCCCTGGG - Intronic
997665428 5:135626450-135626472 GAGCCCTCAAGCCAAAGCCTTGG + Intergenic
998477226 5:142432180-142432202 CACCCCTGAAGCCATTTGCTGGG + Intergenic
999514304 5:152285578-152285600 CATTCCTCAAGCTAGTCCCTTGG - Intergenic
1000670623 5:164058229-164058251 CATCCCTCTAAACATTCCCTGGG - Intergenic
1002329361 5:178430899-178430921 CAGCCCTCACGTGATGCCCTGGG + Intronic
1004277772 6:14253542-14253564 TACCCCTCAAGGCTTTCCCTAGG + Intergenic
1005471882 6:26169264-26169286 CAGCGCCCAAGCCAGTGCCTAGG - Intronic
1006217942 6:32461457-32461479 CAGCTATCAACCCATTACCTAGG + Intergenic
1007627689 6:43255502-43255524 CAGCTCTCAGGTCCTTCCCTGGG - Intronic
1008957165 6:57228510-57228532 CTGCCCTCAATCCATTTCTTTGG - Intergenic
1010512148 6:76733439-76733461 CATCAGTCAAGCCATTCCCTGGG - Intergenic
1011650406 6:89500886-89500908 CAGCTCACAACCCATTGCCTTGG - Intronic
1019224460 6:170498726-170498748 CAGCCTTACAGCCATGCCCTGGG - Intergenic
1019736287 7:2651281-2651303 CAGCCCACAAGCCAATCCTGTGG - Intronic
1019737828 7:2659300-2659322 CAGCTCTCAGGCCCTTTCCTGGG + Intronic
1026429067 7:70325920-70325942 CAGCTCTGAAGCCCCTCCCTTGG + Intronic
1027679192 7:81197830-81197852 AACATCTCAAGCCATTCCCTGGG - Intronic
1029488770 7:100858998-100859020 CAGCCCTCCAGCCATCCCCCTGG - Intronic
1031884492 7:127231749-127231771 CAGCCCTCAAGCCTGTCCTTTGG - Intronic
1032885826 7:136137090-136137112 CAGCCTTCAAGCCCATCCCCAGG - Intergenic
1032999117 7:137483529-137483551 CACCCATCAACCCATACCCTAGG + Intronic
1034813538 7:154152439-154152461 CAGGCCTCAATCCATAACCTTGG + Intronic
1035215444 7:157363063-157363085 CAGCTCTGAAGCCATTCTCGTGG + Intronic
1036666990 8:10752721-10752743 CAGCCCTTAAGCCTTTACCCTGG - Intronic
1038380799 8:27091426-27091448 CAGACCTCTTGCCATTCTCTTGG + Intergenic
1038388660 8:27174177-27174199 CAGCCCTCAGGCCTTGCACTGGG + Intergenic
1040107680 8:43549659-43549681 CAGGCCCCGTGCCATTCCCTGGG - Intergenic
1040991245 8:53352631-53352653 CGGCCCTCAGGAGATTCCCTGGG + Intergenic
1044722085 8:95160396-95160418 CAGCCCTAAAGCCATTAGGTGGG - Intergenic
1048712189 8:137224824-137224846 CAGCCCTCAAGACCTACCCCAGG + Intergenic
1048784808 8:138039256-138039278 CACCTCTCAACCCATTACCTAGG - Intergenic
1049518756 8:143077532-143077554 CAGCCCTCTACCTATTACCTGGG + Intergenic
1050234985 9:3568251-3568273 AAGCGCTCACGCCACTCCCTGGG - Intergenic
1054761306 9:69006628-69006650 CAGGCCTTTAGCCATTCCCCTGG + Intronic
1055977597 9:81969934-81969956 CAGCCCTCAAACCCTTCACCAGG - Intergenic
1056581123 9:87888618-87888640 CAGCCCTAAAGCCACCCCCAAGG + Exonic
1057314072 9:93958025-93958047 CAGCCCTCACCCCATTCCACAGG + Intergenic
1057553993 9:96073025-96073047 CAGCCCCCAGCCCACTCCCTGGG + Intergenic
1060797543 9:126522779-126522801 CACCCCTCGGGCCATTTCCTGGG - Intergenic
1061702211 9:132424463-132424485 CAGCCCTCCAGCAATTCCACAGG - Intronic
1061723387 9:132567585-132567607 CAGCCCTCAAGCCATTCCCTGGG - Intronic
1061828161 9:133274736-133274758 CCGCCCCCCAGCCCTTCCCTCGG - Intronic
1061974905 9:134063124-134063146 CAGCTCTCAGACCATCCCCTTGG + Intronic
1062110799 9:134781119-134781141 CGGCCTTAAAGCCATTCCCGAGG + Intronic
1185729145 X:2446990-2447012 CGGCACTGAAGACATTCCCTAGG + Intronic
1185730489 X:2457500-2457522 CAGCACTCAAGACATTCCCTAGG + Intronic
1185732011 X:2469007-2469029 CAGCACTGAAGACATTCCCTAGG + Intronic
1187397442 X:18930904-18930926 CAGCCCCTCAGCCCTTCCCTGGG + Intronic
1188348296 X:29095458-29095480 CAGTCCACAAGATATTCCCTAGG + Intronic
1194448772 X:94016778-94016800 CAGCCCTCAGGAGATTCCCCTGG + Intergenic
1199534838 X:148890773-148890795 GAGCCTTCAAGCCTTTCTCTAGG - Intronic
1202372026 Y:24205334-24205356 CAGCCCCCAAGCCAGCCCCGTGG + Intergenic
1202498759 Y:25464782-25464804 CAGCCCCCAAGCCAGCCCCGTGG - Intergenic