ID: 1061725976

View in Genome Browser
Species Human (GRCh38)
Location 9:132582274-132582296
Sequence GGCATCAGCACCGCGGAGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061725976_1061725985 19 Left 1061725976 9:132582274-132582296 CCGCTCTCCGCGGTGCTGATGCC 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1061725985 9:132582316-132582338 GCCCGCTGCTAGCGCGGCCCGGG 0: 1
1: 0
2: 0
3: 11
4: 119
1061725976_1061725984 18 Left 1061725976 9:132582274-132582296 CCGCTCTCCGCGGTGCTGATGCC 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1061725984 9:132582315-132582337 CGCCCGCTGCTAGCGCGGCCCGG 0: 1
1: 0
2: 1
3: 4
4: 90
1061725976_1061725982 13 Left 1061725976 9:132582274-132582296 CCGCTCTCCGCGGTGCTGATGCC 0: 1
1: 0
2: 1
3: 10
4: 88
Right 1061725982 9:132582310-132582332 CTTTCCGCCCGCTGCTAGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061725976 Original CRISPR GGCATCAGCACCGCGGAGAG CGG (reversed) Exonic
901825712 1:11859472-11859494 GTGATCAGCACCACGGACAGCGG - Intergenic
906513739 1:46425929-46425951 GGCAGCAGCACGGCAGAGTGTGG + Intergenic
912993442 1:114510946-114510968 TCCACCAGCACCGCGGTGAGAGG + Exonic
923273716 1:232379275-232379297 GGAATGAGCACTGGGGAGAGGGG + Intergenic
1066371961 10:34825034-34825056 GGCCCCAGCACCTCGGGGAGGGG - Intergenic
1066488938 10:35875430-35875452 GGCCTCAGCACCCTGAAGAGAGG - Intergenic
1067187455 10:44043045-44043067 GGCATCAGCACAGTGAACAGGGG - Intergenic
1070160736 10:73865430-73865452 GGCAGCAGGAACGGGGAGAGCGG - Intronic
1072916552 10:99540604-99540626 GGGAGAAGCCCCGCGGAGAGGGG - Intergenic
1073390900 10:103175757-103175779 GGCCTCAGCACCCTGGATAGGGG - Intronic
1076789957 10:132771646-132771668 GGCAGCCGCCCCGCGAAGAGTGG + Intronic
1083900697 11:65641941-65641963 CGCACCAGCACTGCGGAGAGAGG + Intronic
1084952989 11:72676959-72676981 GGGTTCAGCACCCTGGAGAGAGG - Intergenic
1091283630 11:134396229-134396251 GGCATGAGCACCGGGGGGTGGGG + Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1102536067 12:113582547-113582569 GGCAGCAGCTCTGAGGAGAGTGG + Intergenic
1103267736 12:119645074-119645096 GGCCTCAGCACTGCGAAGAATGG - Intergenic
1103433162 12:120904584-120904606 TGCAGCAGCCCCTCGGAGAGGGG - Intergenic
1110618751 13:77571292-77571314 GGCAGCAGAATCGCGGAGGGCGG + Intronic
1114693184 14:24604351-24604373 GGCAGCAGCACAGGTGAGAGAGG - Intergenic
1117288525 14:54310304-54310326 GGCATGAGCACAGAGAAGAGGGG - Intergenic
1117995607 14:61474876-61474898 TGCATCAGCACTGCAGACAGGGG + Intronic
1124249355 15:28096963-28096985 GGCAGCGGCGCCGCGGGGAGGGG - Intronic
1125476636 15:40052199-40052221 GGCATCAGAAGTGAGGAGAGGGG + Intergenic
1125522188 15:40354483-40354505 GGCAGCAGCCCCGTGGAGTGGGG + Intronic
1128999336 15:72319798-72319820 GGTTTCAGCACCGCGGACAGCGG - Exonic
1132078331 15:98841829-98841851 TGTATCAGCACAGGGGAGAGTGG - Intronic
1132552346 16:558793-558815 GCCAGCAGCCCCGTGGAGAGCGG - Intergenic
1133022658 16:2973764-2973786 GGCACCAGCACCCCAGGGAGTGG - Intronic
1133684680 16:8154903-8154925 GGCAGCAGCAGCTCTGAGAGAGG - Intergenic
1133969543 16:10557894-10557916 GGCATCAGAACTGGAGAGAGTGG + Intronic
1142762390 17:2050157-2050179 TTGATCAGCACCGCGGACAGCGG + Intergenic
1148027796 17:44600397-44600419 GGCATCAGCAGCAAGGAGGGAGG - Intergenic
1150569949 17:66376753-66376775 GGCATCGGCATCTGGGAGAGGGG + Intronic
1151405281 17:73882158-73882180 GGCATGGGCACCGCGGACAGGGG - Intergenic
1152493436 17:80653669-80653691 GGCCGCAGCACGGCGGAGACCGG - Intronic
1153847199 18:9060746-9060768 GGCATCAGCACCACACAGAAGGG + Intergenic
1154376209 18:13812074-13812096 GGCATCAGCAGCTTGGGGAGAGG + Intergenic
1157904759 18:51559696-51559718 CTCATCAGCACTGAGGAGAGCGG - Intergenic
1158427804 18:57354072-57354094 GGAATCAGCACCGCGGACAGCGG - Intronic
1158475199 18:57773714-57773736 GGCATGAGCACCTGGGAGATGGG - Intronic
1161420349 19:4173203-4173225 GACTTCAGCACCTTGGAGAGCGG + Intergenic
1161915477 19:7225026-7225048 GGCAGCAGCAAAGAGGAGAGAGG + Intronic
1164324087 19:24177714-24177736 GGATTCAGCACTGAGGAGAGTGG + Intergenic
1165065264 19:33224963-33224985 GGCAGCAGGACCCAGGAGAGGGG - Intronic
1166428155 19:42698044-42698066 AGCATCCGCACCGCGGTGGGAGG + Intronic
1166771738 19:45287542-45287564 AGCTGCAGCACCGCGGGGAGTGG + Exonic
1168128910 19:54304668-54304690 GGAATCAGCACCATGGACAGGGG + Intergenic
937085234 2:119167258-119167280 GCCATTAGCACCACGGACAGCGG - Intergenic
939017752 2:136921034-136921056 GGCATCAGCACCCGGGAGTGCGG + Intronic
943364700 2:186958015-186958037 GGCAGCAGCAATGCAGAGAGGGG + Intergenic
947103850 2:226648345-226648367 GGGATCAGCACCGTGGAGCAGGG - Intergenic
947432958 2:230046620-230046642 GGCCTCAGCACCACGGGGACCGG - Exonic
1171398439 20:24855908-24855930 GGCATCAGCACTGGGAAGAGGGG - Intergenic
1171935824 20:31274231-31274253 GGCATGAGCATCGTGGATAGAGG - Intergenic
1172164407 20:32890198-32890220 GGCCTCAGCACCACAGGGAGGGG - Intronic
1172328762 20:34059096-34059118 TGGATCAGCACCCTGGAGAGAGG + Intronic
1172474643 20:35227191-35227213 TGCTTCAGCACCGCGGACAGGGG + Intronic
1172959390 20:38787799-38787821 GGCACCAGAACTGGGGAGAGGGG + Intergenic
1178879243 21:36435490-36435512 AGCATTAGCACTGCGGAGAGGGG - Intergenic
1179158637 21:38873820-38873842 GGCCTCAGCACATCAGAGAGAGG + Intergenic
1179486010 21:41711172-41711194 GGCATCTGCACCGTTGACAGTGG + Intergenic
949384402 3:3484038-3484060 GCCTTCAACACCACGGAGAGAGG - Intergenic
950480268 3:13239445-13239467 GGCATCAGAGCCGCGGACACAGG + Intergenic
950679479 3:14575251-14575273 GGAATCAGCATTGCGGACAGTGG - Intergenic
956787120 3:72651972-72651994 ACCATCAGCACTGTGGAGAGAGG + Intergenic
957562194 3:81836324-81836346 TGCATCAGAACCTCTGAGAGAGG + Intergenic
958208538 3:90436245-90436267 GGCATCAGCAAGGCGGGGACAGG - Intergenic
959737083 3:109671842-109671864 GGCAATAGAACCGAGGAGAGTGG - Intergenic
967199881 3:187063576-187063598 GGCAGCAGCAAAGAGGAGAGGGG + Intronic
968225211 3:196968813-196968835 CGCCTCAGCAGCGCGGAGACTGG + Exonic
968615619 4:1576516-1576538 GCCATCAGCACCGCGAGAAGGGG + Intergenic
969348627 4:6584982-6585004 GGCAACAGCACCGCACTGAGAGG - Intronic
969867707 4:10086368-10086390 GGCAGCAGCACTGCTGAGAGGGG - Intronic
982962968 4:161863821-161863843 GACTTCAGCACCGCTGGGAGGGG + Intronic
985890930 5:2714837-2714859 GGCAGCAGCTCCCCCGAGAGCGG - Intergenic
997752841 5:136365354-136365376 TACTTCAGCACCACGGAGAGCGG - Exonic
998164607 5:139835849-139835871 GGGATCAGCACCATGGAGAGTGG - Intronic
1006460313 6:34154265-34154287 GGGAGCAGGACCGCGGTGAGGGG - Intronic
1007394445 6:41569660-41569682 GGCCTCAGCACCGCCGCCAGCGG - Intronic
1008731945 6:54493232-54493254 GGCATCACCTCTGAGGAGAGAGG - Intergenic
1012866956 6:104630080-104630102 GGAAACAGCAAGGCGGAGAGAGG - Intergenic
1019688560 7:2396519-2396541 GGCATCAGCACAGCAGAGCTGGG - Intergenic
1019918078 7:4145895-4145917 GTCATCACCACCGAGAAGAGAGG + Exonic
1033262262 7:139854028-139854050 TGCATCAGCAGAGAGGAGAGTGG + Intronic
1035458387 7:159024031-159024053 CGGAGCAGCACCGCAGAGAGAGG - Intergenic
1035933022 8:3805265-3805287 GGCATCAGCATCGCAGAGGAAGG + Intronic
1047063221 8:121250949-121250971 GGCATCAGCAGTGCGTAGTGGGG + Intergenic
1049968839 9:803475-803497 GACATCAGAACCCAGGAGAGTGG - Intergenic
1053530407 9:38875647-38875669 TGCATCAGAACTGCGGAGACAGG + Intergenic
1054202633 9:62100077-62100099 TGCATCAGAACTGCGGAGACAGG + Intergenic
1054635729 9:67488288-67488310 TGCATCAGAACTGCGGAGACAGG - Intergenic
1056246990 9:84705506-84705528 GCCAGCAGCACCGCAAAGAGCGG - Intronic
1056965338 9:91160110-91160132 GCCAGCAGCACCCTGGAGAGGGG - Intergenic
1061725976 9:132582274-132582296 GGCATCAGCACCGCGGAGAGCGG - Exonic
1061860733 9:133467530-133467552 GGAATCTCCACCGCGGAGAGGGG - Intronic
1061905033 9:133692355-133692377 GGCATCAGCCCCCAGTAGAGGGG - Intronic
1062175015 9:135156815-135156837 GGCCTCATCAACTCGGAGAGTGG - Intergenic
1187159039 X:16747381-16747403 GGCATCTGCACCCCGGAGCTTGG - Intronic
1190732116 X:53233308-53233330 AGCATCAGCCCTGGGGAGAGAGG - Exonic