ID: 1061726500

View in Genome Browser
Species Human (GRCh38)
Location 9:132584801-132584823
Sequence GCCTCTCTAAGCAGGCCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 163}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061726500_1061726506 18 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726506 9:132584842-132584864 AGAGAGACTGGCATGGAGAAGGG No data
1061726500_1061726504 11 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726504 9:132584835-132584857 GCGCTGGAGAGAGACTGGCATGG No data
1061726500_1061726502 -5 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726502 9:132584819-132584841 GAGGCAAAGAAAACTTGCGCTGG No data
1061726500_1061726508 20 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726508 9:132584844-132584866 AGAGACTGGCATGGAGAAGGGGG No data
1061726500_1061726511 30 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG No data
1061726500_1061726510 26 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726510 9:132584850-132584872 TGGCATGGAGAAGGGGGAGGAGG No data
1061726500_1061726503 6 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726503 9:132584830-132584852 AACTTGCGCTGGAGAGAGACTGG No data
1061726500_1061726509 23 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726509 9:132584847-132584869 GACTGGCATGGAGAAGGGGGAGG No data
1061726500_1061726505 17 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726505 9:132584841-132584863 GAGAGAGACTGGCATGGAGAAGG No data
1061726500_1061726507 19 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726507 9:132584843-132584865 GAGAGACTGGCATGGAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061726500 Original CRISPR GCCTCTCTAAGCAGGCCCCC CGG (reversed) Intronic
900465201 1:2822069-2822091 GCCCCTCTTGGCAGGCGCCCTGG + Intergenic
901071195 1:6519572-6519594 GCCTCTCTAATCAGACACACAGG + Intronic
901150974 1:7101007-7101029 GCATCTCTAAGCAGGACACCTGG + Intronic
901656341 1:10771941-10771963 GCCCCTCTCGGCCGGCCCCCAGG + Intronic
903325121 1:22564791-22564813 GCGTCTCTGTGCAGGCTCCCAGG + Intronic
903469440 1:23575608-23575630 GGCTCTCTCAGCAAGCCCCAGGG - Intergenic
904042518 1:27592865-27592887 GCCTCTCTGAGCTGGGCCCGAGG - Intronic
904837806 1:33350063-33350085 GCCTCCCTAAGCTGAGCCCCGGG - Intronic
905515284 1:38558135-38558157 TCCTCTCCACGCAGGCGCCCTGG + Intergenic
912381122 1:109248828-109248850 GCCTCTCTAGACAGGACCTCAGG + Intergenic
912459132 1:109819524-109819546 GCCTCTCTGCCCAGGCCACCAGG - Intergenic
913251706 1:116917321-116917343 GCGTCTCTAAGCAGGCCCACAGG + Intronic
913703585 1:121397065-121397087 GCCACTCTATGCAGGCCACAGGG - Intergenic
913979936 1:143498776-143498798 GCCACTCTATGCAGGCCACAGGG - Intergenic
914074285 1:144324260-144324282 GCCACTCTATGCAGGCCACAGGG - Intergenic
914104891 1:144642186-144642208 GCCACTCTATGCAGGCCACAGGG + Intergenic
914246731 1:145891901-145891923 TGCTTTCTAAGCAGGCCCCAAGG + Exonic
914914885 1:151813479-151813501 GCTTCTCAAAGCAGGTGCCCAGG - Exonic
916789856 1:168115707-168115729 GCCTCTCTAATGAGGGTCCCCGG + Intronic
917741289 1:177964184-177964206 GCCTCAGCAAGCAGGCTCCCTGG + Exonic
921067373 1:211632467-211632489 GCCTTTCTGAGCAAGGCCCCGGG - Intergenic
923522175 1:234743848-234743870 TCCTCTCTAAGAAGGCGCCAAGG + Intergenic
1068410458 10:56647017-56647039 GCCTGTCTAAACAGGTGCCCAGG + Intergenic
1069946650 10:71990996-71991018 GGCTCTCTAAGCAGCATCCCAGG + Intronic
1070333171 10:75432013-75432035 GCCTCACTGAGCAGGCCCAGCGG + Intronic
1071564474 10:86664729-86664751 GCCTCCCTCAGCATTCCCCCCGG + Intronic
1075397868 10:122141018-122141040 CCCTCTCTGAGCAGGACTCCTGG - Intronic
1075426060 10:122342466-122342488 GCCTCTCTCAGCCGGGGCCCAGG - Intergenic
1075921777 10:126219296-126219318 GCCTCCCGAAGCAGGTCACCAGG - Intronic
1076807565 10:132866645-132866667 TCCTCGCTAAGCAGAGCCCCCGG + Intronic
1077043855 11:535835-535857 GCATCTCCGAGCAGGGCCCCGGG + Intronic
1081968615 11:47184194-47184216 TCCTCTCTGAGCAGGCCCAAGGG + Intronic
1082002122 11:47398909-47398931 GCCCCACCATGCAGGCCCCCTGG - Intergenic
1084274177 11:68043303-68043325 GCCTCCCCCACCAGGCCCCCCGG - Intronic
1084499222 11:69525061-69525083 GCCTCTCCTTTCAGGCCCCCTGG - Intergenic
1084642649 11:70434919-70434941 GCATCTCTGAGCAGGCTGCCTGG + Intronic
1084679235 11:70656440-70656462 GCCTCCCTCAGCAGGTCCCACGG + Intronic
1084972757 11:72780738-72780760 GCCTCTCTCAGCTGGAACCCAGG - Intronic
1085051879 11:73384132-73384154 GCCTCTCTTAGCAGGCAGCCTGG + Intronic
1089346273 11:117793716-117793738 GCCTCTCTGTCCAGTCCCCCGGG + Intronic
1089631890 11:119789157-119789179 TCCTCTGTAAGCGGGCTCCCCGG - Intergenic
1092140315 12:6179178-6179200 ACGTCTCTGAGCAGGCCCCAGGG + Intergenic
1092281652 12:7102017-7102039 TCCCCTCTGGGCAGGCCCCCTGG - Exonic
1096589137 12:52645663-52645685 GCCTCTCTAAGCAGCCACCAGGG + Intronic
1098651536 12:72976756-72976778 GACCGTATAAGCAGGCCCCCTGG + Intergenic
1102193124 12:111004361-111004383 GCCTCCCTTGGCAGTCCCCCAGG + Intergenic
1102496240 12:113321161-113321183 GCCCCTCTCACCAGCCCCCCAGG + Intronic
1103053753 12:117802630-117802652 TAATCTCTTAGCAGGCCCCCTGG + Intronic
1104378493 12:128286340-128286362 TCCTGTCTAAGCAGGGGCCCTGG - Intronic
1106242992 13:27925019-27925041 GCTTCTCTAAACAGGTCCCAAGG - Exonic
1107187972 13:37546615-37546637 CCCTCACCAAGCAGGGCCCCTGG - Intergenic
1113434524 13:110279850-110279872 CCCTCTCGATGCAGGCCCACGGG - Intronic
1121517701 14:94563752-94563774 GGCTGTGTGAGCAGGCCCCCAGG - Exonic
1202859639 14_GL000225v1_random:73108-73130 TCCGCTCAAAGCAGGCTCCCAGG + Intergenic
1123393264 15:19899325-19899347 GCCGCTCTATGCAGGCCACAGGG - Intergenic
1124291945 15:28460032-28460054 ACCTCTGTAAGCAGGCACGCAGG + Intergenic
1126050677 15:44682280-44682302 GCCTATCTGAGAAGGCCTCCTGG - Intronic
1128756482 15:70187024-70187046 ACCTCTTTAAGAAGCCCCCCGGG + Intergenic
1129323485 15:74787512-74787534 GCTCCCCTCAGCAGGCCCCCAGG + Intronic
1131178995 15:90227751-90227773 ACCCCTGTAAGCAGGTCCCCAGG + Intronic
1132128467 15:99251584-99251606 GGCTCTCTGACCCGGCCCCCCGG + Intronic
1132639771 16:972478-972500 CCCTTCCTAAGCTGGCCCCCAGG - Intronic
1132693106 16:1190494-1190516 CCCTCTCTAGGCAGAGCCCCAGG + Intronic
1133292000 16:4728473-4728495 GCATCTCCATGCAGCCCCCCTGG - Intronic
1134795453 16:17031479-17031501 CCCTCTGAAAGCAGGACCCCAGG - Intergenic
1136699257 16:32116690-32116712 GCCACTCTATGCAGGCCACAGGG - Intergenic
1136706838 16:32197645-32197667 ACCTCTGTAAGCAGGCACGCAGG - Intergenic
1136761073 16:32731772-32731794 ACCTCTGTAAGCAGGCACGCAGG + Intergenic
1136768394 16:32811244-32811266 GCCGCTCTATGCAGGCCACAGGG + Intergenic
1136799748 16:33059861-33059883 GCCACTCTATGCAGGCCACAGGG - Intergenic
1136807030 16:33138614-33138636 ACCTCTGTAAGCAGGCACGCAGG - Intergenic
1136957665 16:34803883-34803905 GCCGCTCTATGCAGGCCACAGGG - Intergenic
1137384619 16:48030092-48030114 TCCTCTGTATGCAGGGCCCCAGG - Intergenic
1138598532 16:58041937-58041959 CCCTCACTCAGCAGGCCCCGGGG + Intronic
1139445027 16:66992355-66992377 GCCTCTCTGCCCATGCCCCCAGG - Intronic
1140158384 16:72458077-72458099 GCATCTCTAACCAGGCTCACTGG - Intergenic
1141175005 16:81712969-81712991 GCCTCTGGAAGGAGGCCACCAGG - Intergenic
1141231246 16:82169913-82169935 GACTCTCTCAGGAGGCCCGCGGG - Intronic
1203063225 16_KI270728v1_random:992089-992111 ACCTCTGTAAGCAGGCACGCAGG + Intergenic
1203070786 16_KI270728v1_random:1073260-1073282 GCCGCTCTATGCAGGCCACAGGG + Intergenic
1145276960 17:21437315-21437337 GCCTGGCTCAGCAGGACCCCAGG + Intergenic
1145314791 17:21723208-21723230 GCCTGGCTCAGCAGGACCCCAGG + Intergenic
1145713232 17:26995145-26995167 GCCTGGCTCAGCAGGACCCCAGG + Intergenic
1145991350 17:29080979-29081001 GCCTCTCTAAGGAGGCCCCGGGG - Intronic
1146125021 17:30224618-30224640 GCCTCTCTACCCAGGCCCAGAGG + Intronic
1147588449 17:41666294-41666316 TGCTCTCTTAGCAGGCCTCCAGG + Intergenic
1149763204 17:59251885-59251907 GCCTCCCTAGGTAGGCCCACAGG - Intronic
1150003643 17:61456614-61456636 GCCGCGCTAGGCAGCCCCCCGGG + Exonic
1151272219 17:73005599-73005621 GCCTCTGTGAGCAGGTCCCTAGG - Intronic
1152437542 17:80285546-80285568 CCCCCTCTCAGCAGGTCCCCCGG + Intronic
1152600589 17:81260276-81260298 GCCTCTCCAAGCCGGCCGCCAGG + Exonic
1162250100 19:9435405-9435427 GTCTCTCTAAGGAGGCCCCTCGG + Intronic
1162285481 19:9735766-9735788 GTATCTCTAAGAAGGCCCCTCGG + Intergenic
1166312282 19:41969655-41969677 CCCTCTCCAAGGAGGCCTCCGGG - Intronic
1167619715 19:50553963-50553985 GCCTCTGCCAGCAGGCCTCCTGG - Intronic
1202680208 1_KI270712v1_random:2695-2717 GCCACTCTATGCAGGCCACAGGG + Intergenic
927691752 2:25213337-25213359 GCCTCTCTAGTCAGCCCCTCTGG - Intergenic
932139547 2:69263478-69263500 GCCTCTCTCATCAGCCACCCAGG + Intergenic
932302610 2:70677781-70677803 GCCTCTCTATACTGACCCCCAGG - Exonic
932868030 2:75367400-75367422 TCCTCTCTAAGCAGTCATCCTGG - Intergenic
933599477 2:84315304-84315326 GCCCTTCTATGCAGGACCCCAGG + Intergenic
934927274 2:98390559-98390581 GCTTTTCTGAGCAGGCCTCCAGG + Intronic
937317936 2:120943844-120943866 GCTTCTCCAAGCAGGCACCGAGG + Intronic
938296839 2:130183902-130183924 GCCTCTCTCTCCAGGCCCCCCGG + Intronic
938392884 2:130918652-130918674 GCCCCTCTTAGCAGCCCACCTGG - Intronic
938459918 2:131490755-131490777 ACCTCTCTCTCCAGGCCCCCCGG - Intronic
939275447 2:139992099-139992121 TCCTCACTAAGCAGATCCCCAGG - Intergenic
939667133 2:144965700-144965722 GCTTCTCTAAGCAGTGTCCCAGG - Intergenic
946188465 2:217994803-217994825 GCCTCTCTAAGCAGCCACAGGGG + Intronic
1169369915 20:5020810-5020832 GCCTCTCTAAGGAGGCACCTTGG + Intergenic
1169731788 20:8793909-8793931 GGGTCTCTAAACTGGCCCCCCGG - Intronic
1170474478 20:16701317-16701339 GCCTCTTCAAGAAGGCACCCTGG + Intergenic
1170533372 20:17316025-17316047 GCCTCTCCAGTCAGGCCGCCTGG + Intronic
1172138330 20:32703310-32703332 GCCTCTCAGAGCAGTCACCCAGG + Exonic
1172639121 20:36430528-36430550 GCCTCTCTAGGCAGGCACAGTGG + Intronic
1174200405 20:48803003-48803025 GCATTTCTAAGCAAGCTCCCAGG - Intronic
1175374047 20:58512894-58512916 CCCTCTCTCGTCAGGCCCCCGGG + Intronic
1175526217 20:59635850-59635872 GCCTCTCTGGGCAGGTCTCCGGG + Intronic
1175819714 20:61902270-61902292 GCCTCTGAAACCAGGACCCCCGG + Intronic
1175870931 20:62209037-62209059 GCCACTCGAGGCAGGCCGCCTGG + Intergenic
1176097598 20:63351530-63351552 GCCCCTCCAAGCAGCACCCCGGG + Intronic
1176842331 21:13850963-13850985 GCCCCACTGAGCAGGCCTCCAGG + Intergenic
1179918443 21:44493583-44493605 GCCCCTCTAAGCAGCTCTCCAGG + Intergenic
1184039013 22:41932605-41932627 GCCACTCTCAGCATGGCCCCGGG + Intergenic
1184431171 22:44442215-44442237 GCCTCTCTCAGCCGGGCCTCTGG - Intergenic
1184851241 22:47122480-47122502 GCCCCTCCAAGCTGGCCACCTGG + Intronic
1184890438 22:47375792-47375814 CCCTCTGTAAGCAGCGCCCCCGG - Intergenic
1185159083 22:49212055-49212077 GACTCCCTCAGCAGGCCCCACGG + Intergenic
953042795 3:39269671-39269693 CCCTCACTGAGCAGACCCCCTGG - Intronic
956427907 3:69155643-69155665 GCCTTTCTAAGCAGCTCCCGGGG + Intergenic
961480973 3:127180566-127180588 GCCTCTCTAAGCCCACCCCAAGG + Intergenic
966833550 3:184031604-184031626 GCCTCTCTAACAAGACCCCTTGG - Intronic
968908637 4:3465809-3465831 CCCTCTCTGGGCAGGGCCCCGGG + Intronic
969094250 4:4719996-4720018 GCCTCCTGAAGCAGGCCCGCTGG + Intergenic
969370233 4:6727292-6727314 TCCTCCCTAAGAAGGCCCCAAGG - Intergenic
971082899 4:23235681-23235703 GCCTCTCATTTCAGGCCCCCAGG + Intergenic
972488497 4:39564721-39564743 GCCTCACTAAGAAGGCACTCTGG + Intronic
975509458 4:75177726-75177748 GCCTCTTTAAGCAAGCTCCTGGG + Intergenic
982629868 4:157819145-157819167 ACTTCTCTAAGCAGGTCTCCCGG - Intergenic
984134270 4:175916134-175916156 TCCCCGCTATGCAGGCCCCCAGG + Intronic
985626586 5:992015-992037 GCCTCTCTCTGCAGGCTCCCAGG + Intergenic
986466134 5:8026660-8026682 GCCTCCCTAAGCATGTCTCCTGG - Intergenic
987741678 5:21916781-21916803 GCGTCTCTCAGCAGGCTCCTAGG + Intronic
987878565 5:23711789-23711811 TCCTCACTAAGCAGGGCCTCTGG + Intergenic
988934254 5:36066725-36066747 GCCTCTGAGAGCAGGACCCCAGG + Exonic
993138703 5:84002897-84002919 TCTTCTCTAGGCAGGGCCCCTGG + Intronic
993443047 5:87979391-87979413 TCCCTTCTAAGCAGTCCCCCAGG - Intergenic
997720764 5:136076894-136076916 GCCTCTCTGAGCTGGAGCCCTGG + Intergenic
997863852 5:137443786-137443808 TTCTCTCTAAGCTGGCCTCCAGG + Intronic
998094112 5:139387791-139387813 CCTTCTCTGAGCAGGCCCCCTGG + Exonic
998599068 5:143566327-143566349 GCCTACCCAAGCAGGCCCGCTGG - Intergenic
1002071005 5:176678956-176678978 GCCTCTCTGAGTAGGGCCACTGG - Intergenic
1002327012 5:178416333-178416355 GCCTCCCTCAGGAGGCTCCCCGG + Intronic
1015738079 6:136422989-136423011 GCCTCTCTAAGTAGGTCACATGG + Intronic
1016645306 6:146400047-146400069 GCCTCTCTGACCCAGCCCCCAGG - Intronic
1018284073 6:162218296-162218318 GCCTCTCTCAGCAGGAACACAGG - Intronic
1018856273 6:167677520-167677542 GCTGCACTAAGCAGGCGCCCAGG - Intergenic
1019614425 7:1952702-1952724 GCCTCACAAAGGAGGCCCTCAGG + Intronic
1024529998 7:50383713-50383735 GCCTCTCTAAGCCGGTGCCCTGG + Intronic
1025212537 7:57028270-57028292 GCCTCTCTTAGAAGGGCCCCAGG + Intergenic
1025481879 7:60992676-60992698 GCCGCTCTATGCAGGCCACAAGG - Intergenic
1025659418 7:63548557-63548579 GCCTCTCTTAGAAGGGCCCCAGG - Intergenic
1026795567 7:73364079-73364101 GCGCCACAAAGCAGGCCCCCAGG - Intergenic
1028422762 7:90651794-90651816 GCCTCTTAGAGCAGGCCTCCAGG + Intronic
1029675679 7:102066721-102066743 GCCTCTCTTAGAAGAGCCCCAGG + Intronic
1031826646 7:126574000-126574022 GCCTCTCTAAGGAGGTCCAAAGG + Intronic
1037820098 8:22131198-22131220 GCCTCTCTCGGCAGGCGCCCGGG - Exonic
1040579970 8:48689665-48689687 GTCTCTCCAACCAGGCCTCCTGG + Intergenic
1041024515 8:53670180-53670202 GACTCTCAAAGCAGGACCCGTGG + Intergenic
1041111934 8:54491260-54491282 GACTCTCTGAGCAGGCTCCCTGG - Intergenic
1045105520 8:98888817-98888839 TGCTCTCTCAGCAGGCCCCATGG + Intronic
1048609910 8:136010894-136010916 CCCACTCTAAGCATTCCCCCGGG - Intergenic
1049605467 8:143527169-143527191 GCCTCTCTCAGGAGTCCACCAGG - Intronic
1057442149 9:95090613-95090635 GCCTTTCTAGGCCGGCCCCAGGG - Intergenic
1058862462 9:109129218-109129240 GACTCTCCAAACAGGCCCCCAGG + Intergenic
1061284734 9:129615636-129615658 CCCTCTCTCAGCAGGCCCCACGG - Exonic
1061726500 9:132584801-132584823 GCCTCTCTAAGCAGGCCCCCCGG - Intronic
1062226480 9:135455332-135455354 GCCTCTCTGGGCAGCCTCCCAGG - Intergenic
1062547331 9:137069676-137069698 GCCTCCCTAAGCAAGCCCCTGGG + Intronic
1194550453 X:95291543-95291565 GCCTCTGTCACCAGGCCCACAGG - Intergenic
1195743541 X:108091270-108091292 GCCGCCCCAAGCAGTCCCCCTGG - Intronic
1198233687 X:134716625-134716647 GCCTCTGGAAGAAGGCCCTCTGG - Intronic
1198765024 X:140071632-140071654 CACTCTCTAAGAAGGCCCTCTGG - Intergenic