ID: 1061726501

View in Genome Browser
Species Human (GRCh38)
Location 9:132584809-132584831
Sequence TTTTCTTTGCCTCTCTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 360}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061726501_1061726511 22 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG No data
1061726501_1061726504 3 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726504 9:132584835-132584857 GCGCTGGAGAGAGACTGGCATGG No data
1061726501_1061726513 26 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726513 9:132584858-132584880 AGAAGGGGGAGGAGGAAGGAGGG No data
1061726501_1061726514 27 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726514 9:132584859-132584881 GAAGGGGGAGGAGGAAGGAGGGG No data
1061726501_1061726509 15 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726509 9:132584847-132584869 GACTGGCATGGAGAAGGGGGAGG No data
1061726501_1061726508 12 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726508 9:132584844-132584866 AGAGACTGGCATGGAGAAGGGGG No data
1061726501_1061726507 11 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726507 9:132584843-132584865 GAGAGACTGGCATGGAGAAGGGG No data
1061726501_1061726510 18 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726510 9:132584850-132584872 TGGCATGGAGAAGGGGGAGGAGG No data
1061726501_1061726512 25 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726512 9:132584857-132584879 GAGAAGGGGGAGGAGGAAGGAGG No data
1061726501_1061726515 28 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726515 9:132584860-132584882 AAGGGGGAGGAGGAAGGAGGGGG No data
1061726501_1061726503 -2 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726503 9:132584830-132584852 AACTTGCGCTGGAGAGAGACTGG No data
1061726501_1061726505 9 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726505 9:132584841-132584863 GAGAGAGACTGGCATGGAGAAGG No data
1061726501_1061726506 10 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726506 9:132584842-132584864 AGAGAGACTGGCATGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061726501 Original CRISPR TTTTCTTTGCCTCTCTAAGC AGG (reversed) Intronic
900796943 1:4713645-4713667 TTTTCTCTGCCTCTGTTAACAGG + Intronic
901329523 1:8394847-8394869 TTTTGTTTGCATTTCTTAGCAGG + Intronic
903463026 1:23532244-23532266 TTCTCTGAGCCTCTCTAAACCGG - Intergenic
903544677 1:24116551-24116573 TTTTCCTTCCCACTCTAAGGAGG - Intergenic
903583498 1:24390334-24390356 ATCTCTTTTCCTCTCTAACCTGG - Intronic
905309666 1:37040611-37040633 CTCTCTCTGCCTCTCTAAGGAGG - Intergenic
905696138 1:39975131-39975153 TTTTCTTTTCTTTTCTGAGCTGG + Intergenic
906903750 1:49865894-49865916 ATTTATGTGCCTCTCTAAACTGG - Intronic
907095063 1:51770635-51770657 TTTCCATTGCCTCTCAAAACTGG + Intronic
908569055 1:65389601-65389623 GTTTCTTTGCCTCTCTCTGTTGG + Exonic
909028323 1:70508628-70508650 TTTTCTTTACCATTTTAAGCAGG - Intergenic
909672532 1:78204682-78204704 ATTTATTTTCTTCTCTAAGCTGG - Intergenic
910187608 1:84560340-84560362 TTTTCTTGGCCTCTCTGTGAAGG - Intronic
911287004 1:96007793-96007815 TTTTCTTTGTCTTTATATGCTGG - Intergenic
911295153 1:96106151-96106173 TTTTCTTTGCCTCTCAGACTTGG + Intergenic
912160646 1:106981024-106981046 GTTTCTTAACCTCTCTAATCTGG - Intergenic
915846372 1:159269845-159269867 ATTTATTTTCCTCTCTAAACTGG - Intergenic
915847425 1:159281622-159281644 TTTTCCTTGCCTCTCTTTTCTGG - Intergenic
915990759 1:160513149-160513171 ATTTATGTTCCTCTCTAAGCTGG - Intronic
916122664 1:161542641-161542663 TTTTTTTTTCCCCTCTAAACTGG + Exonic
917062680 1:171057251-171057273 ATTTCTGTTCCTCTCTAAACTGG - Intronic
917276541 1:173337518-173337540 TTTTCTTTTCCTCTGTCAACTGG - Intergenic
917944728 1:179957470-179957492 TATTCTTTGCCTTTCTCATCTGG + Intronic
918090843 1:181293321-181293343 TTTTTTTTACCTCTCTCATCTGG - Intergenic
918214634 1:182382735-182382757 TTTCCTGTACCTCTCTAAGTTGG - Exonic
918411477 1:184262279-184262301 TTTTCTTAGACTCTCTAACCTGG - Intergenic
918777831 1:188658216-188658238 TTTTATTTTCCTTTCTAAGCAGG + Intergenic
918943299 1:191028145-191028167 ATTTGTATTCCTCTCTAAGCTGG - Intergenic
919100497 1:193091317-193091339 TTCACTTTGCCTTTCAAAGCAGG + Intronic
920930652 1:210384675-210384697 TCTTCTTTGGCACTCTAAGGGGG - Intronic
921156246 1:212441116-212441138 TTTTTTTTGGCTCTATTAGCAGG - Intronic
922690830 1:227688676-227688698 TTTTCTTTGACTCTCTGTGTTGG - Intergenic
922874808 1:228932166-228932188 TTTTCTCTGCCTATCTCATCTGG - Intergenic
924504377 1:244667523-244667545 TTATCTGTGCCTCTCTAAAATGG - Intronic
1063260670 10:4385843-4385865 TCTTTTTTTCCTCTGTAAGCTGG - Intergenic
1063346043 10:5313353-5313375 TTATCATTGCCTCTCTGAGATGG + Intergenic
1064247930 10:13684018-13684040 TTTTTATTGCCTCTCTGAGAAGG + Intronic
1064358133 10:14638289-14638311 TTTTTTTCCCCTCTGTAAGCTGG + Intronic
1065429335 10:25637903-25637925 TTATCTTTACCTCTCTTAGAAGG - Intergenic
1067008453 10:42688404-42688426 TTATCTTTGTATCTCAAAGCAGG - Intergenic
1067675560 10:48372663-48372685 TTTTTTTTTTCTCTCTAATCTGG - Intronic
1068455733 10:57251347-57251369 TTTTCTTTTCATCTATAAGATGG + Intergenic
1068692974 10:59936736-59936758 TTTACTTTGCCTGTATAAGAAGG + Intergenic
1069888619 10:71639170-71639192 TTCTCATCGCCTCTCTCAGCTGG + Intronic
1070951773 10:80436890-80436912 TCTTCTTGGCCTCTCTGTGCAGG - Exonic
1073365156 10:102934163-102934185 TCTTCTTTTCCTATCTAATCTGG - Intronic
1073906496 10:108286974-108286996 TTTTCCTTGACTCTCTATGTTGG + Intergenic
1074819026 10:117165547-117165569 TTTTTTTTTCCTCTCAAAGGCGG + Intergenic
1077937044 11:6799343-6799365 TTATCTTTTCCTCTCATAGCTGG - Intergenic
1078265218 11:9750401-9750423 CCTTCTGTGCCTCTCTAAGTGGG + Exonic
1080197407 11:29628680-29628702 TTTTCTTTCCCTCTCTAGGGAGG + Intergenic
1081428614 11:42951631-42951653 TTTTCTTTCCCTTTTTAGGCAGG + Intergenic
1085071600 11:73551429-73551451 TCGTCTATGCCTCTCAAAGCTGG + Intronic
1088084311 11:105959458-105959480 TTTTATGTTCCTCTCTAAACTGG + Intronic
1088682496 11:112255935-112255957 ATCTCTTTACCTCTCTGAGCCGG + Intronic
1089010544 11:115128565-115128587 TCTGCTCTGCCTCTCCAAGCTGG - Intergenic
1090100897 11:123795948-123795970 TTTTCCTTGCCTCTCCAGACAGG - Intergenic
1090218612 11:124994936-124994958 TTCTCTTGGCCTCTTTAAGAGGG + Intronic
1090990676 11:131814532-131814554 TTTTTTTTTCCTTTTTAAGCAGG - Intronic
1091009315 11:131984000-131984022 TTTTCTTTGGCTCTACAGGCAGG - Intronic
1091289422 11:134429192-134429214 TTGGCTTTGCCTCTCACAGCTGG - Intergenic
1094131143 12:27076706-27076728 TTTTCTTTTCCTTTCTAAGTAGG + Intergenic
1094180584 12:27588556-27588578 TTTTCTTTTCCTTTCTGAGTGGG + Intronic
1094204525 12:27826412-27826434 TTCTCTGTGCCTCTCAAAGCTGG + Intergenic
1094473859 12:30826446-30826468 TTTTCTCCGCCTCTCAGAGCTGG - Intergenic
1095736030 12:45557167-45557189 TTCTCTTTGCTTCTATGAGCTGG - Intergenic
1095796269 12:46222245-46222267 TTTTTTTTTCCTCTAAAAGCAGG + Intronic
1096801875 12:54115758-54115780 TTCTCTTTGTCTCTCCATGCTGG - Intergenic
1096836205 12:54352898-54352920 TTGTCTTTGCCTGTCTGAGCTGG + Intergenic
1096917908 12:55053065-55053087 CTTTCATTGTGTCTCTAAGCTGG - Intergenic
1098773694 12:74586636-74586658 TTTTCTTTTCCTCTCTTATCTGG - Intergenic
1098875819 12:75865516-75865538 TCTTCTTGGCCTCTCTGTGCAGG + Intergenic
1099817096 12:87663909-87663931 TTCTCTCTGGCTTTCTAAGCTGG + Intergenic
1101158220 12:101947462-101947484 TTTTCTTTGTCTCTCTTAGATGG - Intronic
1103198380 12:119066360-119066382 GTTTCTTTCCCTCTTTAAGCTGG - Intronic
1104126927 12:125856485-125856507 TTCCCTTTGCCTCTCTAGCCTGG + Intergenic
1104849810 12:131867290-131867312 TTTTCTCTCTCTCTCTAAGAAGG + Intergenic
1105468397 13:20668846-20668868 TTTCCTTTTATTCTCTAAGCAGG + Intronic
1105808036 13:23969458-23969480 TTTTTTTTTCCTCTCTGAGATGG - Intergenic
1106000112 13:25714269-25714291 GTTCCTTTGGCTCTCAAAGCAGG + Intronic
1108208414 13:48114280-48114302 TTTTCTTTCTCTCTATAAACTGG - Intergenic
1111720143 13:91933152-91933174 TTTTCTTTGGCTCTCACAACAGG + Intronic
1111916093 13:94362089-94362111 TTTTCTTTGACTCATTAAGCTGG + Intronic
1112143589 13:96673199-96673221 CTTTCTTTGCCTCTCTCATAAGG + Intronic
1112433315 13:99372405-99372427 TTCTCCTTGCCTCCCTTAGCTGG - Intronic
1112491106 13:99864974-99864996 TTTTCTTTGCCCCTCAAGGATGG + Intronic
1113095626 13:106661000-106661022 TTTTTTTTGCCTTTCTAAAAAGG - Intergenic
1113202623 13:107883823-107883845 TTTTATTTGGCTTTCCAAGCTGG - Intergenic
1113992778 14:16041643-16041665 TCCTCTCGGCCTCTCTAAGCAGG - Intergenic
1114940059 14:27598053-27598075 TTTTCTTTCCCTTTCTAGGGTGG - Intergenic
1115757353 14:36542880-36542902 TTTCCTTTGCCTCTCTCACATGG + Intergenic
1116560786 14:46376450-46376472 ATTTATTTTCCTCTCTAAACTGG + Intergenic
1117053004 14:51880943-51880965 TTTTTTTTGTCTTTTTAAGCTGG - Intronic
1118262287 14:64258894-64258916 TTTTTTTCTCCTCTCTTAGCTGG - Intronic
1118479042 14:66144956-66144978 ATTTATGTTCCTCTCTAAGCTGG - Intergenic
1118558369 14:67051245-67051267 ATTTATTTTCCTCTCTAAACTGG - Intronic
1120338442 14:83189165-83189187 ATTTCTGTTCCTCTCTAAACTGG + Intergenic
1120520740 14:85525507-85525529 GTTTCTTTGCCTTTCTGTGCAGG - Intergenic
1121706938 14:96003242-96003264 ATTTATGTTCCTCTCTAAGCTGG - Intergenic
1122170478 14:99870066-99870088 TTTTCTTTGCATCTATAACTTGG - Intronic
1122905500 14:104799922-104799944 TTTTCCGTGCCTCTCTGCGCTGG + Intergenic
1123679518 15:22749465-22749487 TTTTCTTTGGCTCTCACAACAGG + Intergenic
1124046400 15:26154852-26154874 ATTTATGTTCCTCTCTAAGCTGG + Intergenic
1124047723 15:26165702-26165724 TGTTCTTTTCCTGTCCAAGCTGG - Intergenic
1124092035 15:26614394-26614416 TTTTCTTCATCTCTCAAAGCTGG - Intronic
1124331734 15:28823918-28823940 TTTTCTTTGGCTCTCACAACAGG + Intergenic
1124717245 15:32075185-32075207 CTTTCTTTGTTTCTGTAAGCAGG + Intronic
1125658127 15:41375013-41375035 TTTTTTTTCCCTCTCTGAGATGG + Intronic
1125808483 15:42515652-42515674 TTTTCTTTTCCTTTCAAAGGAGG + Intronic
1125812535 15:42553843-42553865 TTTTCTTTGTTTCTCTCAGGAGG - Intronic
1126379945 15:48036156-48036178 TGTTCTATGCATTTCTAAGCAGG - Intergenic
1128856041 15:71016736-71016758 GTTTCTTTGCCTCTATAAATGGG - Intronic
1129747290 15:78032154-78032176 TTTCCTTTGCTTCTCTCAGTTGG - Intronic
1130726539 15:86445027-86445049 TTGTCTTTGCCTGTCTGAGTTGG + Intronic
1131658513 15:94487336-94487358 TTTTTTTTGCCTGTATAATCAGG - Intergenic
1131933175 15:97469257-97469279 TTTTCTCTGCCTGTAAAAGCAGG + Intergenic
1133091587 16:3408571-3408593 TTTTCTTTAGCTCTCTCAGTGGG - Exonic
1134257619 16:12625150-12625172 TTTGCTTTGCCCCACAAAGCAGG - Intergenic
1134435329 16:14251419-14251441 TCTTCTATTCCTCTCTAAGGTGG - Intronic
1135654564 16:24236319-24236341 GTTCCTTGACCTCTCTAAGCAGG - Intergenic
1136643375 16:31587878-31587900 TTTTATGTTCCTCTCTAAACTGG + Intergenic
1136662237 16:31772906-31772928 TTTTATGTTCCTCTCTAAACTGG - Intronic
1136706519 16:32193015-32193037 TTTTCTTTGGCTCTCGCAACAGG - Intergenic
1136761392 16:32736402-32736424 TTTTCTTTGGCTCTCGCAACAGG + Intergenic
1136806711 16:33133984-33134006 TTTTCTTTGGCTCTCGCAACAGG - Intergenic
1136912143 16:34153382-34153404 TCCTCTCGGCCTCTCTAAGCAGG - Intergenic
1139269673 16:65670567-65670589 TTTTCTTTGACTCTGTAACGTGG - Intergenic
1140691217 16:77486243-77486265 CTTGCTTTGACTCTCTAGGCCGG + Intergenic
1142107334 16:88311475-88311497 TTTTCTCTGCTTCTCCAATCAGG - Intergenic
1203063546 16_KI270728v1_random:996719-996741 TTTTCTTTGGCTCTCGCAACAGG + Intergenic
1142561225 17:810584-810606 CTTTCCTTAACTCTCTAAGCAGG - Intronic
1144105531 17:11981542-11981564 TTTTTTTTGCCTATCAAGGCAGG + Intronic
1144280192 17:13718859-13718881 TGTTGTTTGTGTCTCTAAGCGGG - Intergenic
1144472978 17:15561157-15561179 TTCTCTTATCCTCTCTCAGCTGG - Intronic
1144694941 17:17296854-17296876 TTTTCTTTGTTTCTCTAAGGTGG + Intergenic
1144812540 17:18009884-18009906 TCTGCTTTTCCTCTCAAAGCTGG - Intronic
1144923502 17:18783543-18783565 TTCTCTTATCCTCTCTCAGCTGG + Intronic
1145306496 17:21678321-21678343 GTTTCTTTCCCTCTCTCTGCCGG - Intergenic
1146066894 17:29643154-29643176 TTTTCTTTGCTCTTCTAAGCAGG + Intronic
1146357783 17:32148744-32148766 TTCTCTTTGCCACTTGAAGCAGG + Intronic
1146631076 17:34469747-34469769 TTTTCCTTGCCTCTCCACACTGG + Intergenic
1149400490 17:56290991-56291013 CTTTCTTTGCCTCTCTAGGATGG - Intronic
1150235173 17:63587095-63587117 TTTTCTTCTCCTCACTAATCAGG + Intronic
1152947197 17:83204321-83204343 GTTCCTGTGTCTCTCTAAGCTGG - Intergenic
1153347782 18:4046867-4046889 TTTACCTTTGCTCTCTAAGCTGG + Intronic
1154469555 18:14685966-14685988 TATTCTTTGCCTCTTTAATATGG + Intergenic
1155492026 18:26408800-26408822 TTCTCTTTTCCTTTCCAAGCAGG - Intergenic
1155856687 18:30843618-30843640 TTTTCTTTGACTCTCTGTGTTGG + Intergenic
1155922687 18:31619040-31619062 TTCTCCTTGCCTCTCCAAGACGG - Intergenic
1156139081 18:34083472-34083494 TTTTCTGTACATCTCTAAACTGG - Intronic
1156471879 18:37382323-37382345 CCTTCTCTGCCTCTCTTAGCAGG + Intronic
1156765099 18:40643358-40643380 TTTTCTGAGTCTCTCTGAGCTGG - Intergenic
1156961318 18:43035153-43035175 ATTTCTTTGCTTTTCTCAGCAGG - Intronic
1157023821 18:43818739-43818761 ATTTATTTGCCTCTCTGATCAGG + Intergenic
1157148855 18:45194607-45194629 TTGTCTTTGCATCTCTATGAGGG + Intergenic
1157549626 18:48572488-48572510 TTTAATTTACCTCTCTGAGCCGG - Intronic
1159904169 18:74075468-74075490 CTCTCTCTGCCTCTCTAAGATGG - Intronic
1159932909 18:74332705-74332727 TTTTTTTTTCCCCTCTAAGATGG - Intronic
1160684781 19:428643-428665 TTTTCTTTGCCTCCCTGATCAGG - Intronic
1161306426 19:3571735-3571757 TTTTTTTTGCCTCCATAAGTCGG - Intronic
1165692562 19:37874954-37874976 TTTTCTCTCCCTCTCTCAGGAGG + Intergenic
1166563931 19:43751835-43751857 TTTTCACTGCCTCTCGAAGTAGG - Intronic
1166625665 19:44352497-44352519 TTTTCCTTGCCTCACTACACTGG - Intronic
928559595 2:32466356-32466378 TTTTCTTTACCTATCTCATCTGG + Intronic
928717844 2:34083330-34083352 TTTTCTGTGCCTTTTTAAGAAGG + Intergenic
929479425 2:42290139-42290161 TTTTCTCTTCCTCCCTAAACAGG - Intronic
930223202 2:48766739-48766761 ATTTATTTTCTTCTCTAAGCTGG + Intronic
931774380 2:65527856-65527878 TTTGCTTTGCTTATCTAGGCAGG + Intergenic
932013615 2:68001772-68001794 ATTTATTTTCCTCTCTAAACTGG - Intergenic
933076923 2:77940517-77940539 TTTCCTTGGCCTCTCAAAGATGG - Intergenic
933406486 2:81866518-81866540 TTTGCTATGCCTCTCTAATCTGG - Intergenic
934621657 2:95813533-95813555 TTTTCTTTCCATCTTTCAGCAGG - Intergenic
934684057 2:96307442-96307464 TTTTCTTTTCCTCTCTAATCAGG + Intergenic
934991774 2:98926700-98926722 TTCTCTTTGCCTCTTCAAACAGG - Intronic
935393365 2:102579294-102579316 TTTTCTTTTACCCTCTATGCTGG + Intergenic
935549746 2:104440366-104440388 TTTTCTTTTCCTCTCTCCCCAGG - Intergenic
937570829 2:123358841-123358863 TTTTTTTTGCCTTTCTGAACTGG + Intergenic
938803930 2:134788412-134788434 TTTTCTTTGCATCACCATGCTGG + Intergenic
939206771 2:139115956-139115978 TTTTCTTTGACTCTCTGTGTTGG - Intergenic
939316031 2:140550430-140550452 TTTTCCTTTCCTCTCTAAAAAGG - Intronic
940479794 2:154213600-154213622 TTTTTTTTCACTCTCTAAGCAGG - Intronic
941005121 2:160239984-160240006 TTTTCTCTCCCTCTCTCAGAAGG + Intronic
941194933 2:162437739-162437761 TTTTCTTTCCATCAATAAGCAGG + Intronic
941923760 2:170875848-170875870 TGTTCTGTGCCTTTCTAAGCAGG - Intergenic
943515591 2:188881998-188882020 TTATCTGTGCCTCTATAAACAGG + Intergenic
943953136 2:194156240-194156262 CTTCTCTTGCCTCTCTAAGCAGG - Intergenic
944502946 2:200380527-200380549 TTTTATCTGCCTCTGAAAGCAGG + Intronic
944692637 2:202171586-202171608 TTTTCTTTTCCTCTCTGTGGTGG + Intronic
946678088 2:222183733-222183755 TTTTCTTTGCCTCTTTGCACTGG - Intergenic
1171080526 20:22177873-22177895 TTTTCCTTGACTCTCTATGTTGG - Intergenic
1171097189 20:22343513-22343535 TCCCCTTTGCCTGTCTAAGCTGG - Intergenic
1171531746 20:25857807-25857829 GTTTCTTTCCCTCTCTCAGTGGG - Intronic
1171769076 20:29307684-29307706 TCCTCTCGGCCTCTCTAAGCAGG + Intergenic
1171794836 20:29558708-29558730 TTCTCTTTGTCTCTCCATGCTGG + Intergenic
1171812254 20:29754120-29754142 TCCTCTCGGCCTCTCTAAGCAGG + Intergenic
1171853620 20:30325557-30325579 TTCTCTTTGTCTCTCCATGCTGG - Intergenic
1171907445 20:30911535-30911557 TCCTCTGGGCCTCTCTAAGCAGG - Intergenic
1174742213 20:53026046-53026068 TTTGTTTTTCCTCTCTAAGCAGG + Intronic
1177400926 21:20604691-20604713 TTTTCTTTGCTTTTCTAACTTGG - Intergenic
1179281251 21:39936261-39936283 TTTCATTTTCCTCTCTAAGGAGG + Intergenic
1179480334 21:41672945-41672967 TTTTCTTTTCCTTTCTAGGAAGG + Intergenic
1180301756 22:11042240-11042262 TTTTCTTGGTTTCTCCAAGCAGG - Intergenic
1180314492 22:11265876-11265898 TCCTCTCGGCCTCTCTAAGCAGG + Intergenic
1180340868 22:11617683-11617705 TCCTCTGGGCCTCTCTAAGCAGG - Intergenic
1181756322 22:25027590-25027612 GTTACTTGGCCTCTCTGAGCTGG + Intronic
1181851921 22:25755508-25755530 TTTCCTGTGCCTTTGTAAGCTGG + Intronic
1184326331 22:43790097-43790119 TTTGCTTTCCCTCTCTGGGCAGG + Intronic
1184448844 22:44570957-44570979 TTTTTTTAGCCTCTCCAATCAGG - Intergenic
950434398 3:12969970-12969992 CCTTCTCTGCCTCTCTAGGCTGG - Intronic
951183459 3:19685002-19685024 TTTTCCTTGACTCTCTATGTTGG - Intergenic
951318475 3:21215986-21216008 GTTTCTTTGCATCTCTTAGTTGG + Intergenic
951370032 3:21834589-21834611 TTTTCATTGGCTCACTTAGCTGG - Intronic
952986270 3:38787495-38787517 TTTTCTTTGCTTTACTATGCTGG + Intronic
953038481 3:39234085-39234107 TAGCCTTAGCCTCTCTAAGCTGG - Intergenic
954840009 3:53502882-53502904 TTTTCTTCTCTTCTCTTAGCTGG + Intronic
955229470 3:57085933-57085955 TTTTCTGTGTTTCCCTAAGCAGG - Intergenic
955704574 3:61715016-61715038 TTCACTTTGCCTCTCTATTCTGG - Intronic
956009471 3:64815294-64815316 CTTTCTCTGCCTCTATAAGTTGG - Intergenic
956978766 3:74613473-74613495 CTTTCTTTGCCTCTGAAAGGAGG + Intergenic
957003720 3:74918274-74918296 TTTTCTCTGCCCTTCTAAGGGGG + Intergenic
958515644 3:95112062-95112084 ATTTATGTGCCTCTCTAAACTGG + Intergenic
959452851 3:106524159-106524181 GTTTCTGTTCCTCTCTAAACTGG - Intergenic
960085470 3:113585880-113585902 CTTTCCTTCCCTCTCTCAGCGGG + Intronic
960233599 3:115255946-115255968 ATTTATGTTCCTCTCTAAGCTGG - Intergenic
960579668 3:119265976-119265998 TTTTCTCTTCCTTTCTAATCAGG - Intergenic
960680014 3:120238167-120238189 TTTTATGTTCCTCTCTAAACTGG + Intronic
961147026 3:124602676-124602698 TTTTCTTTGCCTAACTTAGATGG - Intronic
961479051 3:127167800-127167822 CTTTCTTTGGCTTTCTGAGCTGG + Intergenic
962003071 3:131320284-131320306 TTTTCTTTGCTTAACTAAGCAGG - Intronic
962441117 3:135417032-135417054 TTTTCCTTCCCTCTCTGAGAAGG + Intergenic
965390661 3:168099320-168099342 CTTTCTTTACCTCTCAAAACAGG - Intergenic
966009749 3:175060092-175060114 CTTTTTTTCCCTCTCTTAGCAGG - Intronic
966098656 3:176239199-176239221 TTTTCTTTTCCTCTCTAGCACGG - Intergenic
966833107 3:184027935-184027957 TTCTCTTAGCCTCACTCAGCTGG - Intergenic
966847735 3:184143667-184143689 TTTTCCTTGCCTCTGGAAGCTGG + Intronic
967371552 3:188752189-188752211 TTTTCTAGGCTTCTCTAAGAGGG - Intronic
968918072 4:3506001-3506023 TTTTTTTTACTTCCCTAAGCTGG - Intergenic
969042679 4:4313019-4313041 TTTTCTTTTCCTCTTTTTGCAGG + Exonic
969906466 4:10401270-10401292 TTTTTTTTTCCTCTATTAGCTGG - Intergenic
970354141 4:15235724-15235746 GTTTCCTTGACTCTCTAGGCTGG - Intergenic
970666359 4:18342101-18342123 TTTTATGTTCCTCTCTAAACTGG + Intergenic
970710446 4:18855914-18855936 TTTGCTTTTCGTCTCCAAGCTGG - Intergenic
970861122 4:20703705-20703727 TTTTATTTCCCTCTTTAAACAGG + Intronic
970966179 4:21930741-21930763 TTTCCTTAGCTTCTCTAAGTAGG + Intronic
971618238 4:28822126-28822148 ATTTCATTGCCTTTCAAAGCAGG - Intergenic
972336083 4:38108106-38108128 TATTCTTTGACTCTCTATCCTGG + Intronic
972750905 4:41987715-41987737 TTTTCTTTGCCTCTAGGAGTGGG - Intergenic
973710366 4:53624040-53624062 TTTTGCTTGCCTCTCAGAGCTGG + Intronic
974005954 4:56557424-56557446 CTTTCTTTGCCAGTCTAATCTGG - Intronic
974461975 4:62199784-62199806 TTTTTTTTGCCTTTCTAATTTGG - Intergenic
974652440 4:64772378-64772400 GATTCTTTGCCTCTTTAAGCAGG + Intergenic
974932074 4:68371101-68371123 TGTTATTTACCTCTCTGAGCTGG - Intergenic
975317818 4:72975711-72975733 TTTTCTTTTCCTCACAAATCTGG + Intergenic
976737279 4:88323496-88323518 GTTTCATTGCCTCTCTATGAAGG + Intergenic
977202227 4:94130660-94130682 TCTTCTTGGCCTCTCTGTGCAGG - Intergenic
977423912 4:96841006-96841028 TTTACTTTGACTCTAGAAGCTGG + Intergenic
978465491 4:109004407-109004429 TTTTTTTTAACTCTCTAAGGAGG + Intronic
978648768 4:110974818-110974840 TTTTCTCTGTCTCTCTCAACTGG - Intergenic
978668700 4:111219361-111219383 TTTGTTCTGCCTCTCTATGCTGG + Intergenic
979374366 4:119928134-119928156 TATTCCTTGCCTCTCTCATCAGG + Intergenic
979732687 4:124044469-124044491 ATTTATATTCCTCTCTAAGCTGG + Intergenic
982859696 4:160433811-160433833 ATTTATTTTCCTCTCTAAACTGG + Intergenic
983061432 4:163166177-163166199 TATTCGCTGCCTCTCAAAGCAGG - Intronic
983476917 4:168224131-168224153 TTTTTTTTTCCTTTTTAAGCTGG + Intronic
986107605 5:4674912-4674934 TTTTCTTTGCCAGTTTATGCTGG + Intergenic
986748780 5:10766512-10766534 TTTTCTTTTCTTCTCTAAATAGG + Intergenic
988457619 5:31400610-31400632 TTTTATCAGCCTCTCTAAGTGGG - Exonic
988838018 5:35052775-35052797 TTTTCTTAGCCTCTCTGTGTAGG - Intronic
988879770 5:35488625-35488647 TTTTCTTTAGCTCTCCAACCTGG + Intergenic
989226127 5:39031238-39031260 TTTTCAGTGCCTCTTTAAGGCGG - Intronic
989676557 5:43980722-43980744 ATTTATGTTCCTCTCTAAGCTGG + Intergenic
990138947 5:52681529-52681551 ATTTATGTTCCTCTCTAAGCTGG + Intergenic
990527081 5:56638653-56638675 TTTTCTTTGTCTTTCTCAGGTGG - Intergenic
991234848 5:64381656-64381678 CTTTCTTTGACCCTCTCAGCTGG - Intergenic
992055865 5:72988814-72988836 TTCTCTCTGTCTCTGTAAGCTGG - Intronic
992424286 5:76640288-76640310 CTTTCTTTGCATCTCTCATCGGG + Intronic
992877281 5:81069427-81069449 CTTTCTTAGCCACTGTAAGCTGG + Intronic
993284174 5:85968643-85968665 ATTTGTCTGCCTCTTTAAGCAGG - Intergenic
994606121 5:101968963-101968985 TTTTGTTTTCCTTTCTAGGCTGG - Intergenic
994676575 5:102830257-102830279 TTTTCTTTGTCTTTCACAGCAGG + Intronic
995594059 5:113730068-113730090 ATTTATGTTCCTCTCTAAGCTGG + Intergenic
996067623 5:119097145-119097167 TATTCTTTCCTTCTCTCAGCTGG - Intronic
996182014 5:120431252-120431274 TTTTATGTTCCTCTCTAAACTGG + Intergenic
996463089 5:123769909-123769931 GTTTGTTTTCCTCTCTAAACTGG + Intergenic
997097581 5:130930316-130930338 ATTTATTTTCCTCTCTAAACTGG - Intergenic
997756470 5:136404341-136404363 TATTTTTTTCCTCTCTAAGATGG + Intergenic
998158277 5:139798283-139798305 TTTTCCTTGTCCCTCTAAGCCGG + Intronic
998722326 5:144967067-144967089 TTTTCTTTGACTCTCTGTGTTGG - Intergenic
999354485 5:150911953-150911975 TTTTCTTTGACTCTCTATGATGG - Intergenic
1000276038 5:159735556-159735578 TTTGCTTTGCTTCTCTTAGAGGG + Intergenic
1000872725 5:166597378-166597400 TTTTCTTTCTGTCTCTAAACAGG - Intergenic
1003334357 6:5156503-5156525 ATTTCTTTGCCCCTCTATCCTGG - Intronic
1004084994 6:12438390-12438412 ATATCTTTGCATCTCTCAGCAGG + Intergenic
1004989016 6:21116117-21116139 TTTCCTTTGCCTTTTTAAGATGG + Intronic
1005078749 6:21935609-21935631 TTTTTTTTTTTTCTCTAAGCAGG + Intergenic
1007521968 6:42457005-42457027 GTTTCTTAACCTCTCTGAGCTGG + Intergenic
1009706999 6:67265425-67265447 ATTTATTTTCCTCTCTAAACTGG + Intergenic
1010932275 6:81817605-81817627 TTTTCATTGCCTCTGAAGGCAGG + Intergenic
1010955375 6:82084964-82084986 TTTTCTCTGGCTCTTTAATCAGG + Intergenic
1011042777 6:83049126-83049148 TTTTCTTTGCCTCTATTAAAGGG - Intronic
1012425278 6:99107362-99107384 TTTTTCTTGGCTCTCTCAGCTGG - Intergenic
1012943700 6:105443589-105443611 TTTTCCTTGTCTCTAGAAGCAGG + Intergenic
1014189722 6:118480835-118480857 TTTCCTTTTCCTCTAAAAGCAGG + Intronic
1014285428 6:119491853-119491875 CTTGCTTTGCCTATCTATGCAGG - Intergenic
1017446460 6:154510760-154510782 GTTACTTTCCCTCTCTAAGCCGG + Intergenic
1017671892 6:156777427-156777449 TTCTCTTTTCCTCTCTAGCCCGG - Intergenic
1018815537 6:167327894-167327916 TTTTCTTTGGTTCTCTATGTTGG + Intronic
1021329645 7:19320053-19320075 TTTTTTTTGCCTATTTAAGGAGG - Intergenic
1021916889 7:25443179-25443201 GTTTATGTTCCTCTCTAAGCTGG + Intergenic
1022134836 7:27437333-27437355 TTTTCTTTGTCCCCCTAAGCTGG + Intergenic
1023384431 7:39641493-39641515 TTTTCTTTAGCTCTCTGAGTGGG + Intronic
1023919743 7:44618875-44618897 TCTTCTTGGCCTCTCTGTGCAGG - Intronic
1025195208 7:56927178-56927200 TTTTCTCTGCTCCTCTAAGCAGG - Intergenic
1025676744 7:63649765-63649787 TTTTCTCTGCTCCTCTAAGCAGG + Intergenic
1025716972 7:63967520-63967542 TTTTCTTTTCTTCTCAAAGTAGG + Intergenic
1025757080 7:64354374-64354396 TTTTCTTTTCTTCTCAAAGTAGG - Exonic
1026470051 7:70687383-70687405 TTTTCATTGCCTTTCTTTGCAGG + Intronic
1026971516 7:74471338-74471360 ATTTTTTTGGCTGTCTAAGCTGG - Intronic
1028626907 7:92888201-92888223 ATTTATTTTCCTCTCTAAACTGG + Intergenic
1029987548 7:104935832-104935854 TCTTCTTGGCCTCCCTGAGCCGG + Intergenic
1034763226 7:153693318-153693340 TTTTGTTTGCCTCTCTCATGTGG + Intergenic
1035491829 7:159285813-159285835 ATTTCTGTTCCTCTCTAAACTGG - Intergenic
1036091709 8:5672707-5672729 TTTTCTTTGCATCCTTAAGGAGG - Intergenic
1037692407 8:21193177-21193199 TTTACTTTGTTTCTCTGAGCTGG - Intergenic
1039653659 8:39374259-39374281 TTTTCTCTGCCTCTCAATGAAGG + Intergenic
1039877035 8:41595839-41595861 TTTTCTCTGTCTCTCTCTGCTGG + Intronic
1040290979 8:46124429-46124451 TCTTCTTTGCCTCTGGAGGCTGG + Intergenic
1040763238 8:50875344-50875366 GTTTATGTGCCTCTCTAAACTGG - Intergenic
1040892345 8:52330366-52330388 TATTTTTTGTCTCTCAAAGCTGG - Intronic
1042574751 8:70205593-70205615 TTTTTTTTTCCCCTCTCAGCTGG - Intronic
1043864090 8:85355646-85355668 TTGTCTTGGCCTCTCAAAGTAGG + Intronic
1045527226 8:102951345-102951367 TTTCCATTACCTCTCTAACCTGG - Intronic
1045911307 8:107413803-107413825 TTTTCTTTCCCGCTCTAATGTGG - Intronic
1046349828 8:112993300-112993322 TTTTCTATGACCCTTTAAGCTGG + Intronic
1047013833 8:120701375-120701397 TTTTCTTCGCCTGTCAAAGGAGG + Intronic
1047682337 8:127266791-127266813 TTATGTTTGTCTCTCTAAGAAGG - Intergenic
1048467190 8:134675239-134675261 ATTTATTTTCTTCTCTAAGCTGG - Intronic
1049121157 8:140739329-140739351 TGTTCTTTGCCTCTCTATAGAGG - Intronic
1050272782 9:3963630-3963652 TCCTCTTTGACTCTCAAAGCAGG + Intronic
1052007849 9:23371902-23371924 TTTTCTTTTCCTCACAGAGCCGG - Intergenic
1052152440 9:25133620-25133642 TTTTCTTTTCTTCTTTATGCGGG - Intergenic
1052546787 9:29889893-29889915 GTTTATTTTCCTCTCTAAACTGG - Intergenic
1052559235 9:30062434-30062456 TTGGCTTTGACTCTTTAAGCTGG + Intergenic
1052843262 9:33311862-33311884 TTTTTTTAACCTCTCTAAGTGGG + Intronic
1053365640 9:37520709-37520731 TATTTTCTGCCTCTCTAAGAAGG + Intronic
1053791424 9:41688854-41688876 TTCTCTTTGTCTCTCCATGCTGG - Intergenic
1054179773 9:61900547-61900569 TTCTCTTTGTCTCTCCATGCTGG - Intergenic
1054473517 9:65557036-65557058 TTCTCTTTGTCTCTCCATGCTGG + Intergenic
1054657768 9:67680273-67680295 TTCTCTTTGTCTCTCCATGCTGG + Intergenic
1054702611 9:68428498-68428520 TTTTCTTTGCCTCTGTTAACTGG + Intronic
1056367803 9:85923113-85923135 TGTTTCTTGCCTCTCTGAGCTGG + Intergenic
1058555652 9:106163797-106163819 TTTTCTTTTCCTCCCCAAGGCGG - Intergenic
1059364471 9:113775300-113775322 TTTTCTTGGCATTGCTAAGCTGG + Intergenic
1059683040 9:116604971-116604993 TTGTCTTTGTCTCTCTAAGCTGG - Intronic
1060316647 9:122517456-122517478 AATTCTTTGCTTCTTTAAGCTGG - Intergenic
1061726501 9:132584809-132584831 TTTTCTTTGCCTCTCTAAGCAGG - Intronic
1062093904 9:134693132-134693154 CTCTCTGTGCCTCTCTCAGCAGG + Intronic
1062327256 9:136018211-136018233 TTTTCTGTGACTCTCCAAGGTGG - Intronic
1185568052 X:1111777-1111799 TTATTTTTGTCTCTCTAAGGAGG + Intergenic
1186016664 X:5203393-5203415 TTTTTTTTGGCTTTCTAGGCAGG + Intergenic
1186425222 X:9459097-9459119 TTTTGTATACCTCTCTAAGTAGG + Intergenic
1186826590 X:13346499-13346521 CTTCCTTTGCTCCTCTAAGCTGG - Intergenic
1187669173 X:21651502-21651524 TTTTCTTTGCCTCCCAACTCTGG + Intronic
1187811132 X:23178587-23178609 TTTTCCTTTCCTCTTTAAGAAGG + Intergenic
1188243595 X:27816378-27816400 TTTTCTTTTCTTATCAAAGCTGG - Intronic
1189586042 X:42463122-42463144 TTACCTCTGCCTCTCTAGGCTGG - Intergenic
1189686797 X:43572989-43573011 TTTTTTTTTCATCTCTAAACAGG + Intergenic
1190162813 X:48046051-48046073 TTTTTCTTGGCTCTCTAAACTGG - Intronic
1193720804 X:84984997-84985019 TATACTTTGCCTTGCTAAGCTGG + Intergenic
1194100429 X:89696814-89696836 TTTTCTTTGCCTTCAAAAGCTGG + Intergenic
1194958058 X:100204136-100204158 TTTTTTTTTCTTCTCTAAGAGGG - Intergenic
1195084135 X:101398360-101398382 TCTTATTTACCTGTCTAAGCTGG + Exonic
1195800501 X:108703398-108703420 TTTTCTTTTATTCTCTGAGCAGG + Intergenic
1195820732 X:108943257-108943279 ATTTATGTTCCTCTCTAAGCTGG + Intergenic
1195946626 X:110221149-110221171 TTCTCTTTGCCTGTCCAAACAGG - Intronic
1195985723 X:110627603-110627625 ATTTATTTTCTTCTCTAAGCTGG - Intergenic
1197133187 X:123029867-123029889 TGTTCTGTGCCTCTAGAAGCAGG - Intergenic
1198868312 X:141148945-141148967 TTTTCTTTCTCCCTCTCAGCTGG + Intergenic
1199278650 X:145974470-145974492 TTTTCTTCCCTTCTTTAAGCCGG + Intergenic
1199546812 X:149014594-149014616 TTTTCTTGGCTTGTCTATGCAGG + Intergenic
1199712328 X:150478199-150478221 TTCTCTTGGCCTCACTAACCTGG - Intronic
1200453433 Y:3358175-3358197 TTTTCTTTGCCTTCAAAAGCTGG + Intergenic
1201075455 Y:10184221-10184243 TCCTCTCGGCCTCTCTAAGCAGG - Intergenic
1201589429 Y:15598459-15598481 TTTACTTTGTCTCTATAAGGAGG - Intergenic
1202250158 Y:22862553-22862575 TTTTCTTTGCTTCTCAAAGTAGG + Intergenic
1202266539 Y:23024893-23024915 TTTTCTTTTCTTCTCAAAGTAGG - Intergenic
1202274544 Y:23101978-23102000 TTTTTTTTTCCTCTCTGAGATGG - Intergenic
1202291483 Y:23318708-23318730 TTTTTTTTTCCTCTCTGAGATGG + Intergenic
1202403147 Y:24496301-24496323 TTTTCTTTGCTTCTCAAAGTAGG + Intergenic
1202419532 Y:24658636-24658658 TTTTCTTTTCTTCTCAAAGTAGG - Intergenic
1202427537 Y:24735713-24735735 TTTTTTTTTCCTCTCTGAGATGG - Intergenic
1202443254 Y:24934381-24934403 TTTTTTTTTCCTCTCTGAGATGG + Intergenic
1202451254 Y:25011448-25011470 TTTTCTTTTCTTCTCAAAGTAGG + Intergenic
1202467634 Y:25173780-25173802 TTTTCTTTGCTTCTCAAAGTAGG - Intergenic