ID: 1061726511

View in Genome Browser
Species Human (GRCh38)
Location 9:132584854-132584876
Sequence ATGGAGAAGGGGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061726501_1061726511 22 Left 1061726501 9:132584809-132584831 CCTGCTTAGAGAGGCAAAGAAAA 0: 1
1: 0
2: 2
3: 31
4: 360
Right 1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG No data
1061726500_1061726511 30 Left 1061726500 9:132584801-132584823 CCGGGGGGCCTGCTTAGAGAGGC 0: 1
1: 0
2: 2
3: 17
4: 163
Right 1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061726511 Original CRISPR ATGGAGAAGGGGGAGGAGGA AGG Intronic
No off target data available for this crispr