ID: 1061727369

View in Genome Browser
Species Human (GRCh38)
Location 9:132589221-132589243
Sequence TCGCTTCCATTTAGTCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061727369_1061727379 8 Left 1061727369 9:132589221-132589243 CCCCCAGGACTAAATGGAAGCGA 0: 1
1: 0
2: 1
3: 1
4: 71
Right 1061727379 9:132589252-132589274 CGTCGGGTTGGAGCTGCTGGCGG 0: 1
1: 0
2: 0
3: 13
4: 168
1061727369_1061727380 11 Left 1061727369 9:132589221-132589243 CCCCCAGGACTAAATGGAAGCGA 0: 1
1: 0
2: 1
3: 1
4: 71
Right 1061727380 9:132589255-132589277 CGGGTTGGAGCTGCTGGCGGAGG 0: 1
1: 0
2: 2
3: 70
4: 569
1061727369_1061727377 5 Left 1061727369 9:132589221-132589243 CCCCCAGGACTAAATGGAAGCGA 0: 1
1: 0
2: 1
3: 1
4: 71
Right 1061727377 9:132589249-132589271 GGCCGTCGGGTTGGAGCTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 195
1061727369_1061727381 15 Left 1061727369 9:132589221-132589243 CCCCCAGGACTAAATGGAAGCGA 0: 1
1: 0
2: 1
3: 1
4: 71
Right 1061727381 9:132589259-132589281 TTGGAGCTGCTGGCGGAGGCAGG 0: 1
1: 0
2: 2
3: 31
4: 327
1061727369_1061727376 -4 Left 1061727369 9:132589221-132589243 CCCCCAGGACTAAATGGAAGCGA 0: 1
1: 0
2: 1
3: 1
4: 71
Right 1061727376 9:132589240-132589262 GCGACAGACGGCCGTCGGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 14
1061727369_1061727375 -8 Left 1061727369 9:132589221-132589243 CCCCCAGGACTAAATGGAAGCGA 0: 1
1: 0
2: 1
3: 1
4: 71
Right 1061727375 9:132589236-132589258 GGAAGCGACAGACGGCCGTCGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1061727369_1061727374 -9 Left 1061727369 9:132589221-132589243 CCCCCAGGACTAAATGGAAGCGA 0: 1
1: 0
2: 1
3: 1
4: 71
Right 1061727374 9:132589235-132589257 TGGAAGCGACAGACGGCCGTCGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061727369 Original CRISPR TCGCTTCCATTTAGTCCTGG GGG (reversed) Exonic