ID: 1061730777

View in Genome Browser
Species Human (GRCh38)
Location 9:132612164-132612186
Sequence CGCCACATGCCCAAGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061730772_1061730777 7 Left 1061730772 9:132612134-132612156 CCTGGGGGCATCTCTTAGTCCGA 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1061730777 9:132612164-132612186 CGCCACATGCCCAAGGTGGAGGG 0: 1
1: 0
2: 3
3: 13
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061730777 Original CRISPR CGCCACATGCCCAAGGTGGA GGG Exonic
900799547 1:4728802-4728824 AGCCCCAGGCCCAGGGTGGAGGG - Intronic
902025924 1:13383459-13383481 GAACACATGCCCAAGGTGGTTGG + Intergenic
910577190 1:88778175-88778197 CAACACGTGCCCAAGGTGGTTGG - Intronic
912326422 1:108767622-108767644 CTGCACATGCGCAAGGTGGGCGG + Intronic
913487252 1:119342859-119342881 CAACACATGCCCAGGGTGGCCGG + Intergenic
915215831 1:154340314-154340336 TGCCCCAAGCCCAGGGTGGAAGG + Intronic
915400626 1:155619192-155619214 CACCAGTGGCCCAAGGTGGATGG - Intergenic
915418151 1:155758198-155758220 CACCAGTGGCCCAAGGTGGATGG - Intronic
915562078 1:156693270-156693292 CGCCACAGGCGCAAGATGGATGG - Intergenic
916762623 1:167831045-167831067 CGACATGTGCCCAAGGTGGTCGG - Intronic
918690329 1:187470926-187470948 CGACATATGCCCAACGTGGTTGG - Intergenic
918870707 1:189970173-189970195 CGACATGTGCCCAAGGTGGACGG - Intergenic
921421795 1:214957244-214957266 CTCAAAATGGCCAAGGTGGAAGG - Intergenic
921680337 1:218023552-218023574 CAACATATGCCCAAGGTGGTCGG - Intergenic
921795850 1:219344043-219344065 ATCCACAAGCCCTAGGTGGAGGG - Intergenic
923033310 1:230266708-230266730 TGCCCCATGCCCATGCTGGATGG - Intronic
923616677 1:235544186-235544208 CAACATATGCCCAAGGTGGTCGG + Intergenic
923755725 1:236789499-236789521 CGACATGTGCCCAAGGTGGTGGG + Intergenic
1063186893 10:3659901-3659923 CGACATGTGCCCAAGGTGGTCGG - Intergenic
1064637130 10:17379761-17379783 TGACACGTGCCCAAGGTGGTCGG - Intronic
1065156236 10:22872890-22872912 CGACATGTGCCCAAGGTGGTCGG + Intergenic
1067705925 10:48606371-48606393 AGCCACATGGCCAAGCTGGTGGG + Intronic
1068147385 10:53088788-53088810 CGCCACAGGCCTGGGGTGGAAGG - Intergenic
1069178673 10:65327399-65327421 GAACACATGCCCAAGGTGGTTGG - Intergenic
1069953960 10:72038398-72038420 GGACACATGCCCAAGGTAGTCGG - Intergenic
1073119574 10:101113358-101113380 GGCCAGATTCCCAAGGGGGAGGG + Intronic
1073483769 10:103803819-103803841 TGACATGTGCCCAAGGTGGATGG + Intronic
1074420565 10:113305197-113305219 CCCCAAGTTCCCAAGGTGGATGG + Intergenic
1075468436 10:122670056-122670078 CGCCACCTGCCCAAGCTGTTTGG + Intergenic
1075924202 10:126236894-126236916 CTGCCCATGCCCAGGGTGGATGG - Intronic
1079070989 11:17347042-17347064 CGACATGTGCCCAAGGTGGTCGG + Intronic
1082942084 11:58716801-58716823 CGACACATGCCCAAGGTGGCTGG + Intronic
1083048657 11:59757572-59757594 CACCACATCCCCAAGAGGGAAGG - Intronic
1083320114 11:61840616-61840638 CTCCCCAGGCCCAAGCTGGATGG + Exonic
1084766064 11:71309320-71309342 TGACATATGCCCAAGGTGGTCGG + Intergenic
1084768464 11:71327329-71327351 TGCCACCTGCACCAGGTGGAAGG - Intergenic
1085987283 11:81802177-81802199 TGAAACATGCCCAAGGTGGTTGG + Intergenic
1089582750 11:119491710-119491732 CGCCACAGGCCCCAGCTGCACGG + Intergenic
1091346192 11:134855861-134855883 CGACACATGCCCAAGGTGGTCGG - Intergenic
1091365766 11:135019154-135019176 CGACACATGCCCAAGGTGGTCGG + Intergenic
1092630701 12:10372851-10372873 CACCACAAGCCCAGAGTGGATGG - Exonic
1093462399 12:19418719-19418741 CCACACATGCCCAAGGTAGTTGG - Intronic
1093535052 12:20212833-20212855 CGCCTCCTGCCAAATGTGGAGGG - Intergenic
1094011993 12:25819814-25819836 CGCGACATGGGCACGGTGGAGGG + Intergenic
1094614470 12:32023670-32023692 CGACATGTGCCCAAGGTGGTCGG + Intergenic
1104347888 12:128019058-128019080 TGACACATGCCCAAGGTGGTCGG - Intergenic
1104538900 12:129644197-129644219 TGACATATGCCCAAGGTGGTTGG - Intronic
1104680896 12:130750860-130750882 TGACACATGCCCAAGGTGGTCGG + Intergenic
1104796815 12:131525993-131526015 AGCCACATCCCCCAGGTGTATGG - Intergenic
1104852827 12:131886010-131886032 GAACACATGCCCAAGGTGGTCGG + Intergenic
1104925318 12:132310942-132310964 CGCCACATGCCCAGGGAGAGCGG - Intronic
1107015079 13:35701836-35701858 AGCCCCATGCCCAAGGCAGAGGG + Intergenic
1108190541 13:47934006-47934028 CGACATGTGCCCAAGGTGGCTGG + Intergenic
1108200137 13:48035030-48035052 CAACATATGCCCAAGGTGGTTGG + Intergenic
1108918974 13:55654130-55654152 CCACACGTGCCCAAGGTGGTCGG + Intergenic
1110124814 13:71929662-71929684 CGACATGTGCCCAAGGTGGTTGG + Intergenic
1110869676 13:80435669-80435691 TGACATGTGCCCAAGGTGGATGG - Intergenic
1110976434 13:81841597-81841619 CGACATGTGCCCAAGGTGGTCGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1114407154 14:22467564-22467586 AGCCACATGCCCAAGGTCTTTGG + Intergenic
1118718261 14:68575600-68575622 CGCCACACACCCATGGTGAATGG + Intronic
1119450364 14:74704322-74704344 CGACATGTGCCCAAGGTGGTTGG + Intronic
1119614641 14:76091116-76091138 TGCCAGGTGCCCAACGTGGATGG + Intergenic
1122073242 14:99218976-99218998 GGCCACAGGTCCAAGATGGAGGG - Intronic
1122434445 14:101684866-101684888 TGACATATGCCCAAGGTGGTCGG + Intergenic
1122932659 14:104941829-104941851 GGCCACATGCCCGAGGTAGCCGG - Exonic
1123200553 14:106659578-106659600 CGATATATGCCCAAGGTGGTGGG + Intergenic
1126462583 15:48929027-48929049 CAACACATGCCCACAGTGGAAGG - Intronic
1126985595 15:54303714-54303736 CGACATGTGCCCAAGGTGGTCGG + Intronic
1128092536 15:64928746-64928768 CTGGACATCCCCAAGGTGGAGGG + Intronic
1133576827 16:7099607-7099629 GGACACGTGCCCAAGGTGGTTGG + Intronic
1134313665 16:13098704-13098726 AGCCACATGCACAGAGTGGATGG - Intronic
1134818866 16:17229315-17229337 GGTCACATGCACAAGGAGGATGG - Intronic
1135405132 16:22192000-22192022 CACCACAAGCCTGAGGTGGATGG + Intergenic
1137572428 16:49575600-49575622 GGCCACATCCCCAAGCTGTATGG + Intronic
1138205160 16:55119160-55119182 CCCCAGCTGCCCAAGGTTGAGGG - Intergenic
1138610651 16:58121159-58121181 AGCCACATGGCCAGGGTGGTGGG - Intronic
1141747461 16:85935345-85935367 CGACATGTGCCCAAGGTGGTCGG + Intergenic
1144419618 17:15084225-15084247 TGACACATGCCTAAGGTGGTTGG + Intergenic
1144765051 17:17728009-17728031 CAACACATGCCCAAGCTGGAAGG - Intronic
1146579781 17:34026695-34026717 CCCCAAATGCCAAAGGTGGATGG + Intronic
1147238354 17:39074175-39074197 CCCCACATGCCCAACTTGCAAGG - Intronic
1147258075 17:39193999-39194021 CGCTCCTGGCCCAAGGTGGAAGG + Intronic
1147671119 17:42177537-42177559 CGGCACATGCCCTAGCTTGAGGG + Intronic
1148221491 17:45865454-45865476 TGACACATGCCCCAGGTGGTCGG + Intergenic
1150210709 17:63440018-63440040 ATCCACATTCCCAGGGTGGACGG + Intronic
1150625920 17:66841082-66841104 CGACATGTGCCCAAGGTGGTTGG + Intronic
1152754339 17:82080892-82080914 TGCCCCACGCCCAAGGAGGATGG - Exonic
1152945130 17:83193942-83193964 TGTCACCTGCCCCAGGTGGAAGG + Intergenic
1152969054 18:143630-143652 CGACATGTGCCCAAGGTGTATGG - Intergenic
1153677446 18:7468202-7468224 CGCCACATGCCCAGGCAGGTGGG - Intergenic
1154375835 18:13808985-13809007 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1155050184 18:22139831-22139853 CCCCAGATACCCATGGTGGAGGG + Intergenic
1156261551 18:35449036-35449058 CCCCACCTGACCATGGTGGATGG - Intronic
1156494265 18:37515702-37515724 CTCCCCATGCCCCAGCTGGAGGG - Intronic
1157158357 18:45289270-45289292 CCCCACCAGCCCAAGGTGGGAGG + Intronic
1160402874 18:78623648-78623670 CGACATGTGCCCAAGGTGGCCGG + Intergenic
1160764673 19:802177-802199 CGGCACCTGCTCAAGGAGGATGG - Intronic
1161283262 19:3456816-3456838 CCCCCCAGGACCAAGGTGGAGGG - Intronic
1163860758 19:19741611-19741633 CGACATGTGCCCAAGGTGGTTGG + Intergenic
1165074273 19:33272276-33272298 CTCAACCTGCCCAAGGTGGTGGG + Intergenic
1166515500 19:43443740-43443762 TGACACGTGCCCAAGGTGGTAGG + Intergenic
1167750510 19:51376738-51376760 CGACATGTGCCCAAGGTGGTCGG - Intergenic
1167922480 19:52793249-52793271 TGACATGTGCCCAAGGTGGACGG - Intronic
1167937629 19:52920843-52920865 GAACACATGCCCAAGGTGGTCGG - Intergenic
1168613297 19:57818142-57818164 CGGCACGTGCCCAAGGTGGTTGG + Intronic
925160076 2:1677535-1677557 CTCCCCTTGCCCAGGGTGGAGGG - Intronic
925230228 2:2226473-2226495 CAGCACATCCCCAGGGTGGACGG - Intronic
925308133 2:2864739-2864761 CGACACGTGCCCAGGGTGGTCGG - Intergenic
926250189 2:11151256-11151278 CGACACGTCCCCAAGGTGGCTGG - Intergenic
927132613 2:20073227-20073249 CACCACATGCTCAAGCTGAAAGG + Intergenic
927468758 2:23356773-23356795 GGCCCAACGCCCAAGGTGGACGG + Intergenic
927711457 2:25328835-25328857 CCCCAGATCCCCAAGGTGAAGGG + Intronic
928177939 2:29047664-29047686 AGCCACATTCCCCAGGTGCAAGG - Intronic
930574610 2:53130960-53130982 AGACAAATGCCAAAGGTGGAAGG - Intergenic
931324754 2:61208413-61208435 TGGCACGTGCCCAAGGTGGTTGG - Intronic
932817596 2:74874301-74874323 CGCCACATCGACATGGTGGAAGG + Exonic
934547351 2:95229123-95229145 CGACACATGCCCAAGGTGATCGG - Intronic
941986349 2:171515335-171515357 CGACATGTGCCCAAGGTGGTTGG - Intergenic
942316244 2:174699010-174699032 CACCATATGCCCAAGGTGGTTGG - Intergenic
946467246 2:219922821-219922843 GGCCAGATGCCCAAGGAAGAAGG - Intergenic
1169149084 20:3275223-3275245 TGCCAGATTCCCAGGGTGGAAGG + Intronic
1169247844 20:4037931-4037953 CACCACATGCCCATGGTCCAGGG + Intergenic
1171022907 20:21602842-21602864 CCCCAAATTCCCAAGCTGGAAGG + Intergenic
1171115333 20:22520491-22520513 CACCACTTGCCCAAGGGAGACGG + Intergenic
1173525939 20:43732668-43732690 CGACATGTGCCCAAGGTGGTCGG + Intergenic
1173890822 20:46508613-46508635 TGCCACATGCCCCTGATGGAAGG - Intronic
1174095443 20:48085496-48085518 TGACACATGCCCAAGGTTGTCGG - Intergenic
1174333184 20:49837284-49837306 CGACATGTGCCCAAGGTGGTCGG - Intronic
1174333405 20:49839427-49839449 CGACATGTGCCCAAGGTGGTTGG - Intronic
1174338032 20:49877581-49877603 CGCCACATGACAAATGTGAAGGG - Intronic
1175916189 20:62427114-62427136 CGGGACAGGCCCAGGGTGGAGGG + Intronic
1179648880 21:42793750-42793772 CAACACGTGCCCAAGGTGGTCGG + Intergenic
1182450010 22:30414278-30414300 CGTCTCATGCCCATGGTGGGTGG - Intronic
1182708251 22:32303178-32303200 CGACACGTGTCCAAGGTGGCTGG + Intergenic
1183220945 22:36512638-36512660 CTCCAAATGCCCAAGGTGCTGGG + Intronic
1183378850 22:37480601-37480623 CTCCACATGCCAAGGGTGGGCGG + Intronic
1183634817 22:39054927-39054949 GGCTACAAGTCCAAGGTGGAGGG + Intronic
1184233186 22:43169310-43169332 CCACAAATGCCCAGGGTGGAAGG + Intronic
1184817007 22:46880150-46880172 CGACATGTGCCCAAGGTGGTCGG + Intronic
949293537 3:2494215-2494237 GAACACATGCCCAAGGTGGTTGG + Intronic
950470931 3:13185916-13185938 GGGCACCTGCCCAAGGTGGGCGG + Intergenic
953683450 3:45057742-45057764 CGACATATGCCCAAGGTGGTCGG + Intergenic
953890419 3:46748245-46748267 CGCTCCATGCCTAAGGTGTAAGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954923455 3:54212200-54212222 TGACATATGCCCAAGGTGGTCGG + Intronic
955479074 3:59370772-59370794 TGCCACATTCCCCAGTTGGAAGG - Intergenic
958005159 3:87801454-87801476 CGACATGTGCCCAAGGTGGTCGG + Intergenic
962120144 3:132552650-132552672 CGACATGTGCCCAAGGTGGTTGG - Intergenic
963058036 3:141203396-141203418 GAACATATGCCCAAGGTGGATGG + Intergenic
966257165 3:177930221-177930243 CAGCAGAAGCCCAAGGTGGAAGG + Intergenic
968561903 4:1288200-1288222 GAACACATGCCCAAGGTGGTTGG - Intergenic
969655173 4:8492929-8492951 CGACATGTGCCCAAGGTGGTCGG - Intronic
970004670 4:11399356-11399378 CGCCACATCCACATTGTGGACGG - Exonic
970971342 4:21987851-21987873 CGACATGTGCCCAAGGTGGTTGG - Intergenic
971019800 4:22523154-22523176 CGACACGTGCCCAAGGTGGTCGG + Intergenic
971732410 4:30402221-30402243 TGCCTGAGGCCCAAGGTGGATGG + Intergenic
974789111 4:66663022-66663044 CGACATACGCCCAAGGTGGTTGG - Intergenic
976740282 4:88349397-88349419 CAACACATGCCCAAAGTGGTTGG + Intergenic
982008888 4:151088011-151088033 CGACATGTGCCCAAGGTGGTTGG + Intergenic
984955889 4:185045191-185045213 CCCCTAATGCCCAAGCTGGAAGG - Intergenic
987374947 5:17225348-17225370 CCACACATGCCCCAGGGGGACGG + Intronic
989204630 5:38798423-38798445 CGACATATACCCAAGGTGGTCGG + Intergenic
991117083 5:62966823-62966845 TGACACATGCCGAAGGTGGTCGG + Intergenic
991546645 5:67789399-67789421 GGACACATACCCAAGGTGGTTGG - Intergenic
994567314 5:101466629-101466651 AGCCACATGCAGAAGATGGAAGG + Intergenic
999545695 5:152626125-152626147 AGACATATGCCCAAGGTGGTCGG - Intergenic
1004286361 6:14324596-14324618 ACCCACATCCTCAAGGTGGAAGG + Intergenic
1006404161 6:33834400-33834422 CCCCACATGGCTAAGGGGGAGGG - Intergenic
1007483161 6:42163220-42163242 CGCCACAAGACCAAGTTGGCAGG - Exonic
1008291727 6:49723919-49723941 CGACATATGCCCAAAGTGGTAGG - Intergenic
1015614886 6:135064351-135064373 AGACACATGCCCAAGGTGTTCGG - Intronic
1018801177 6:167223435-167223457 CGACATGTGCCCAAGGTGGCCGG + Intergenic
1018978914 6:168587394-168587416 CGACGCGTGCCCAAGGTGGTCGG + Intronic
1019481990 7:1271110-1271132 AGCCACTTGCCCAAGGCTGAGGG + Intergenic
1020024815 7:4892025-4892047 CGACACGCGCCCAAGGTGGCTGG - Intergenic
1021102049 7:16595498-16595520 GACCACGTGCCCAAGGTGGTTGG + Intergenic
1022679231 7:32528306-32528328 GGACACATGCCCAAGGTGGTTGG - Intronic
1024888167 7:54168331-54168353 CGACAGGTGCCCAAGGTGGTTGG + Intergenic
1024938835 7:54740979-54741001 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1026346638 7:69480320-69480342 TGACACATGCCCAAGATGGTCGG + Intergenic
1026562559 7:71462536-71462558 CGGCATGTGCCCAAGGTGGTCGG + Intronic
1026869948 7:73844455-73844477 CGTCATGTGCCCAAGGTGGTCGG - Intergenic
1028318447 7:89433501-89433523 CGACATGTGCCCAAGGTGGTTGG + Intergenic
1031176137 7:118353641-118353663 TGACATATGCCCAAGGTGGCTGG + Intergenic
1032054394 7:128672843-128672865 GGCCACTTGTCCAAAGTGGATGG + Intronic
1032077758 7:128844153-128844175 CGCTACATGCCCCCGGAGGAGGG + Exonic
1033801226 7:144904880-144904902 CGACATATGCCTAAGGTGGTTGG + Intergenic
1035644894 8:1211049-1211071 CTCCACATGCCCAAGGCTGGCGG - Intergenic
1036213557 8:6861909-6861931 CGTCATGTGCCCAAGGTGGTTGG - Intergenic
1037487217 8:19358903-19358925 ATCCAGATGCCCAGGGTGGAAGG - Intronic
1038009638 8:23464831-23464853 CGCCATGTGCCCAAGGTGGCTGG + Intergenic
1038868444 8:31465688-31465710 CGGCATGTGCCCAAGGTGGTCGG - Intergenic
1039351686 8:36770496-36770518 CGACATGTGCCCAAGGTGGCCGG + Intergenic
1040396740 8:47007800-47007822 ACCCACATGCCAAAGGTGAAGGG - Intergenic
1040898105 8:52389550-52389572 TGCCTCATGCCTAGGGTGGAAGG - Intronic
1043765328 8:84123708-84123730 GAACATATGCCCAAGGTGGATGG - Intergenic
1047252277 8:123189815-123189837 CGACATGTGCCCAAGGTGGTCGG - Intronic
1048892890 8:138963654-138963676 CGACACGTGCTCAAGGTGGTCGG + Intergenic
1049849327 8:144822423-144822445 AGCCACAAGCCCAAGGCTGATGG + Intergenic
1049940859 9:544941-544963 CCTCACATACCCAAGCTGGAGGG - Intronic
1052183534 9:25561977-25561999 CGACATGTGCCCAAGGTGGTTGG + Intergenic
1053483525 9:38434236-38434258 CGACATGTGCCCAAGGTGGTCGG + Intergenic
1054911541 9:70459696-70459718 TGACATGTGCCCAAGGTGGATGG - Intergenic
1057266667 9:93621991-93622013 CCCCAAATGCCCCAGGTGGTTGG - Intronic
1057503907 9:95617304-95617326 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1059529924 9:115026551-115026573 CGCTACAAGCTGAAGGTGGAGGG - Exonic
1060129207 9:121078594-121078616 CGTCACATCCCTAAGGTTGAAGG + Intronic
1061730777 9:132612164-132612186 CGCCACATGCCCAAGGTGGAGGG + Exonic
1062202983 9:135317150-135317172 CAACACGTGCCCAAGGTGGCCGG - Intergenic
1062238309 9:135523110-135523132 TGCCACAGGCCCATGGAGGAGGG - Intronic
1062492211 9:136811173-136811195 GGACATGTGCCCAAGGTGGAGGG + Intronic
1185812228 X:3121286-3121308 CGACATGTGCCCAAGGTGGTTGG + Intergenic
1185917183 X:4048329-4048351 CGACATGTGCCCAAGGTGGCCGG + Intergenic
1185951916 X:4446743-4446765 GAACACATGCCCAAGGTGGTTGG - Intergenic
1186020823 X:5253119-5253141 CGACATGTGCCCAAGGTGGTCGG - Intergenic
1186779714 X:12900366-12900388 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1186857275 X:13638349-13638371 AGCCACATGACCAAGGAGAAGGG + Intergenic
1187057178 X:15752075-15752097 GAACACATGCCCAAGGTGGTTGG + Intronic
1187139904 X:16583594-16583616 CGACATGTGCCCAAGGTGGTAGG - Intergenic
1187806788 X:23129335-23129357 GGACACGTGCCCAAGGTGGTTGG - Intergenic
1188375520 X:29423351-29423373 CAATACATGCCCAAGGTGGTTGG - Intronic
1188643014 X:32529299-32529321 CGACATGTGCCCAAGGTGGTTGG - Intronic
1189758791 X:44299642-44299664 CGACATGTGCCCAAGGTGGTCGG - Intronic
1194541069 X:95173041-95173063 CGACATTTGCCCAAGGTGGTTGG - Intergenic
1194841063 X:98742708-98742730 CACAAAATTCCCAAGGTGGAAGG - Intergenic
1196884966 X:120235675-120235697 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1199398375 X:147367373-147367395 TGACACGTGCCCAAGGTGGCTGG + Intergenic
1200354505 X:155534241-155534263 CACCACAGGCCCAAGGGGCAGGG + Intronic
1201269125 Y:12237318-12237340 CGACATGTGCCCAAGGTGGTTGG - Intergenic
1201320024 Y:12688184-12688206 CGACATGTGCCCAAGGTGGTTGG - Intergenic