ID: 1061734576

View in Genome Browser
Species Human (GRCh38)
Location 9:132645219-132645241
Sequence CGTTTGTTATGGAGTCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061734576_1061734585 30 Left 1061734576 9:132645219-132645241 CCACCCCGACTCCATAACAAACG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1061734585 9:132645272-132645294 CATAGCCAAGTCCCTAAAATAGG No data
1061734576_1061734583 -4 Left 1061734576 9:132645219-132645241 CCACCCCGACTCCATAACAAACG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG No data
1061734576_1061734582 -7 Left 1061734576 9:132645219-132645241 CCACCCCGACTCCATAACAAACG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1061734582 9:132645235-132645257 ACAAACGGCCTAGTTAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061734576 Original CRISPR CGTTTGTTATGGAGTCGGGG TGG (reversed) Intronic
902227803 1:15007680-15007702 CATCTGTTATGGAGGCGGGCAGG - Intronic
912208837 1:107536486-107536508 GGTTTGTTATGGGGTTGGGCTGG - Intergenic
919225273 1:194690490-194690512 TATTTTTTATGGAGCCGGGGCGG + Intergenic
1073673180 10:105615092-105615114 CTTTTATTTTGGATTCGGGGGGG - Intergenic
1077922927 11:6655345-6655367 CGTGTGTCATCGAGTCGGGGAGG - Intronic
1083627934 11:64081529-64081551 GGTTTGCGATGGGGTCGGGGGGG - Intronic
1085032862 11:73283254-73283276 CGTTGCTTATGGAGTAGGTGAGG - Intronic
1090603739 11:128399731-128399753 TGTCTGTTATGGAGTTAGGGTGG - Intergenic
1091870177 12:3883271-3883293 AGTTTGTGAGGGAGTAGGGGTGG + Intergenic
1092038282 12:5360698-5360720 AGTTTGTTAAGGAGGCTGGGGGG + Intergenic
1095708963 12:45268187-45268209 TGTTTGTAATGGAGTAGTGGGGG - Intronic
1118603769 14:67488450-67488472 CGTTTGTGAAGGAGCTGGGGAGG - Intronic
1118793928 14:69122459-69122481 CGAATCTTATGGAGTTGGGGAGG - Intronic
1121924740 14:97917233-97917255 CCTTTGTTGTGGAGTGGGTGAGG + Intergenic
1122321345 14:100857813-100857835 CGTTTGTTAGGGAGAAGGAGTGG + Intergenic
1149495494 17:57114758-57114780 CCATTGTTATGGAGCTGGGGTGG + Intronic
1157470637 18:47985404-47985426 GGTGTGTTTTGGAGTCAGGGAGG + Intergenic
1157877514 18:51287573-51287595 CGTGTGTGATGGGGTGGGGGTGG + Intergenic
1159097016 18:63914707-63914729 TGTTTGTGATGGAGTGGTGGTGG + Intronic
1160839352 19:1138688-1138710 CGTCTGTGATGGAGGCGTGGAGG - Intronic
1163432012 19:17273895-17273917 CGTTGGTTTTGGAGCTGGGGAGG - Exonic
1164302111 19:23971907-23971929 CGTTTGTTAAGGAGCAGGGGAGG - Intergenic
1166026188 19:40087370-40087392 CGGTTGTCATGCTGTCGGGGAGG - Intronic
930691672 2:54371531-54371553 CCTTTGGTGTGGAGTGGGGGTGG - Intronic
939581278 2:143949681-143949703 CTTTTCTTATGCAGTCGGAGAGG - Intronic
945015167 2:205507580-205507602 CCTTATTTATGGAGTCTGGGTGG - Intronic
946408918 2:219506953-219506975 GGTTTATTAGGGAGTCGGGAGGG - Exonic
1168859660 20:1036868-1036890 GGTGGGGTATGGAGTCGGGGTGG + Intergenic
1170491989 20:16886549-16886571 CCTTTGTCCTGGAGTCGGGGAGG + Intergenic
1171073052 20:22094038-22094060 GGTTTGTCATGCAGTGGGGGTGG - Intergenic
1181083937 22:20430627-20430649 CCTTTGTTAGGGAGGCAGGGCGG + Intronic
1181852981 22:25763141-25763163 AGTTTGTGATGGAGCCTGGGAGG - Intronic
952857957 3:37787849-37787871 CATTTGGTATCGAGTGGGGGAGG + Intronic
961716710 3:128862578-128862600 GGCCTGTCATGGAGTCGGGGGGG + Intergenic
962230549 3:133661881-133661903 CGTTTGCTTTGGGGTAGGGGCGG - Exonic
962367755 3:134797072-134797094 CGTTTGTTCTGGTGGCGGCGTGG + Intronic
972565750 4:40267620-40267642 CATTTGATAAGGAGTAGGGGTGG - Intergenic
984149478 4:176108651-176108673 CTTGTGTTATGGGGTGGGGGAGG + Intronic
985696896 5:1345717-1345739 CGCTTCTGATGGAGTCGGGGAGG - Intergenic
990012357 5:51014969-51014991 GGTGTGTTCTGGAGTCGGGGGGG - Intergenic
1007302798 6:40880911-40880933 TGTTTGTGTTGGAGTGGGGGCGG - Intergenic
1008890038 6:56477386-56477408 TGGTAGTGATGGAGTCGGGGTGG + Exonic
1014580421 6:123129870-123129892 GGTCTGTTGTGGGGTCGGGGTGG + Intergenic
1015685733 6:135857453-135857475 CTTTTGTTCTGGCGTGGGGGTGG + Intronic
1018795403 6:167181507-167181529 TGTTTGGTCTGGAGTCAGGGTGG - Intronic
1018820920 6:167373556-167373578 TGTTTGGTCTGGAGTCAGGGTGG + Intronic
1023793186 7:43769996-43770018 TGTTTGTTTTGGAATGGGGGTGG + Intronic
1027668368 7:81067576-81067598 CCTTTGTTTTGGAGTGGGGGGGG - Intergenic
1032772419 7:135072755-135072777 GGCTTGTTGTGGAGTGGGGGAGG + Intronic
1046978807 8:120313621-120313643 AATTTGTTATGGAGTGTGGGGGG + Intronic
1051554771 9:18370443-18370465 TTTTTATTATGGATTCGGGGGGG - Intergenic
1052245436 9:26328619-26328641 ATTTTGTAATGGAGGCGGGGTGG - Intergenic
1061734576 9:132645219-132645241 CGTTTGTTATGGAGTCGGGGTGG - Intronic
1186224721 X:7386513-7386535 CGTTTGAGATGGAGTGGAGGAGG - Intergenic
1188306433 X:28565176-28565198 CTTTTGTTTGGGAGTTGGGGTGG + Intergenic
1199434120 X:147794100-147794122 GGTTGGTTTTGGAGTCTGGGAGG - Intergenic
1202048390 Y:20756599-20756621 GGTTTGTTCTGGAGTCTGGCAGG + Intronic
1202327844 Y:23710433-23710455 GGACTGTTGTGGAGTCGGGGAGG + Intergenic
1202542926 Y:25959619-25959641 GGACTGTTGTGGAGTCGGGGAGG - Intergenic