ID: 1061734583

View in Genome Browser
Species Human (GRCh38)
Location 9:132645238-132645260
Sequence AACGGCCTAGTTAAGAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061734580_1061734583 -9 Left 1061734580 9:132645224-132645246 CCGACTCCATAACAAACGGCCTA 0: 1
1: 0
2: 1
3: 2
4: 45
Right 1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG No data
1061734573_1061734583 23 Left 1061734573 9:132645192-132645214 CCAGTGAGTATATCTCACTCCCA 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG No data
1061734576_1061734583 -4 Left 1061734576 9:132645219-132645241 CCACCCCGACTCCATAACAAACG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG No data
1061734575_1061734583 3 Left 1061734575 9:132645212-132645234 CCATATTCCACCCCGACTCCATA 0: 1
1: 0
2: 1
3: 8
4: 79
Right 1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG No data
1061734574_1061734583 4 Left 1061734574 9:132645211-132645233 CCCATATTCCACCCCGACTCCAT 0: 1
1: 0
2: 1
3: 10
4: 87
Right 1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG No data
1061734571_1061734583 30 Left 1061734571 9:132645185-132645207 CCCAATTCCAGTGAGTATATCTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG No data
1061734579_1061734583 -8 Left 1061734579 9:132645223-132645245 CCCGACTCCATAACAAACGGCCT 0: 1
1: 0
2: 0
3: 7
4: 45
Right 1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG No data
1061734572_1061734583 29 Left 1061734572 9:132645186-132645208 CCAATTCCAGTGAGTATATCTCA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG No data
1061734578_1061734583 -7 Left 1061734578 9:132645222-132645244 CCCCGACTCCATAACAAACGGCC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1061734583 9:132645238-132645260 AACGGCCTAGTTAAGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061734583 Original CRISPR AACGGCCTAGTTAAGAGTGG AGG Intronic
No off target data available for this crispr