ID: 1061737248

View in Genome Browser
Species Human (GRCh38)
Location 9:132670071-132670093
Sequence GTCCCGAGGGGAGCCGGGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 264}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061737232_1061737248 22 Left 1061737232 9:132670026-132670048 CCACCGCCCCTTCCGGGTCCGGA 0: 1
1: 0
2: 0
3: 25
4: 133
Right 1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG 0: 1
1: 0
2: 1
3: 26
4: 264
1061737238_1061737248 10 Left 1061737238 9:132670038-132670060 CCGGGTCCGGAACGGCTCCAGCT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG 0: 1
1: 0
2: 1
3: 26
4: 264
1061737239_1061737248 4 Left 1061737239 9:132670044-132670066 CCGGAACGGCTCCAGCTGTACGG 0: 1
1: 0
2: 0
3: 6
4: 31
Right 1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG 0: 1
1: 0
2: 1
3: 26
4: 264
1061737237_1061737248 14 Left 1061737237 9:132670034-132670056 CCTTCCGGGTCCGGAACGGCTCC 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG 0: 1
1: 0
2: 1
3: 26
4: 264
1061737233_1061737248 19 Left 1061737233 9:132670029-132670051 CCGCCCCTTCCGGGTCCGGAACG 0: 1
1: 0
2: 1
3: 3
4: 50
Right 1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG 0: 1
1: 0
2: 1
3: 26
4: 264
1061737241_1061737248 -7 Left 1061737241 9:132670055-132670077 CCAGCTGTACGGACTCGTCCCGA 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG 0: 1
1: 0
2: 1
3: 26
4: 264
1061737236_1061737248 15 Left 1061737236 9:132670033-132670055 CCCTTCCGGGTCCGGAACGGCTC 0: 1
1: 0
2: 0
3: 0
4: 22
Right 1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG 0: 1
1: 0
2: 1
3: 26
4: 264
1061737235_1061737248 16 Left 1061737235 9:132670032-132670054 CCCCTTCCGGGTCCGGAACGGCT 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG 0: 1
1: 0
2: 1
3: 26
4: 264
1061737229_1061737248 28 Left 1061737229 9:132670020-132670042 CCTGCGCCACCGCCCCTTCCGGG 0: 1
1: 0
2: 1
3: 28
4: 386
Right 1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG 0: 1
1: 0
2: 1
3: 26
4: 264
1061737227_1061737248 29 Left 1061737227 9:132670019-132670041 CCCTGCGCCACCGCCCCTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG 0: 1
1: 0
2: 1
3: 26
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061737248 Original CRISPR GTCCCGAGGGGAGCCGGGGA CGG Exonic
900244651 1:1631519-1631541 GTCTCCCGGGGAGCCGGGAAGGG - Intergenic
900780378 1:4614036-4614058 GCCCTGAGGGCAGCTGGGGAGGG + Intergenic
901194874 1:7434748-7434770 GTGGGGAGGGGAGCCGGGCATGG + Intronic
902698442 1:18155729-18155751 GTGTTGAGGGGAGCCGGGAAGGG + Intronic
902869264 1:19303822-19303844 GGCCCGAGGAGACCCTGGGAGGG + Intergenic
902937102 1:19772428-19772450 GTCCCCAGGGGAGGATGGGATGG + Intronic
903220855 1:21868993-21869015 GAGCCGAGGGGAGCAGGGGTGGG + Intronic
903502901 1:23811558-23811580 GAGCCGAGAGGAGCCGGGGGTGG + Intronic
903546115 1:24124324-24124346 GTCAAGAAGGGAGCCTGGGAAGG + Intronic
903876030 1:26473262-26473284 GACCGGAGCGCAGCCGGGGAGGG - Intronic
904359804 1:29963951-29963973 GTGCCGTGGGGAGCCCTGGAGGG + Intergenic
904383293 1:30125576-30125598 GTCAGGAGGGGAGCGGGGAAGGG + Intergenic
904413743 1:30342363-30342385 TTCCCCAAGGGAGCCGGGGAAGG - Intergenic
905734814 1:40317512-40317534 GTCCCGAGGGGAACCTCAGACGG - Intronic
905887695 1:41500525-41500547 GTCCTGAGAGGAGGCGGGGCAGG + Intergenic
907352889 1:53848057-53848079 GTCCAGATGAGAGTCGGGGAGGG - Intergenic
911073051 1:93847242-93847264 GGCAGGAAGGGAGCCGGGGAGGG + Intergenic
912204499 1:107494982-107495004 GTCCGAAGGGGAGTCAGGGAGGG - Intergenic
914319301 1:146544225-146544247 GGCCAGAGGGGAGCAAGGGAAGG - Intergenic
917289786 1:173460659-173460681 TGCCCGAGGGGAGGCGAGGAGGG + Intergenic
917415470 1:174804601-174804623 ATCCCGAGGGAGGCCGGGCACGG - Intronic
917450837 1:175146120-175146142 GCCCCCAGGGAAGCTGGGGAGGG + Intronic
919775982 1:201194278-201194300 GCCCAGAGGGGAGCTGCGGAGGG + Intronic
919920434 1:202163798-202163820 CTCCAGAGAGGAGCCGAGGAGGG - Intergenic
920459880 1:206131305-206131327 GTGTGGAGGGGAGCCAGGGATGG - Intergenic
922706996 1:227795260-227795282 CTCCTGAGGGAAGCCGGGGGTGG - Intergenic
922784614 1:228276762-228276784 GTCCCGAGGGGGCCCCGGGAAGG + Intronic
1062833913 10:623774-623796 GGGCTGAGGGGAGCAGGGGAGGG + Intronic
1064380700 10:14838793-14838815 GTCCCGGGGGGTCCCGGGGACGG + Intronic
1065925844 10:30433661-30433683 CTCCCGGGGGGCGGCGGGGAGGG - Intergenic
1067481124 10:46598193-46598215 GCCGCGAGGGGAGCCGCGGAAGG + Intergenic
1067613628 10:47743629-47743651 GCCGCGAGGGGAGCCGCGGAAGG - Intergenic
1067796518 10:49325715-49325737 CTCCCCGGGGGAGCCGGGGTTGG - Exonic
1069651604 10:70053441-70053463 GGCCCGAGGGAGCCCGGGGAGGG + Intronic
1069757800 10:70784224-70784246 TTTCCGAGGGAAGGCGGGGAGGG + Intronic
1069763071 10:70828966-70828988 GTCCTGAAGGGCGCTGGGGAGGG + Intronic
1069877786 10:71573805-71573827 GGCCCCAGGGGAGCCGGGCCAGG - Intronic
1071559444 10:86633504-86633526 CTGCAGAGGGGAGCTGGGGAGGG + Intergenic
1071629036 10:87203601-87203623 GCCGCGAGGGGAGCCGCGGAAGG - Intergenic
1072667023 10:97401057-97401079 GACCCGAGCGCAGCCGGGGGCGG - Intronic
1074208121 10:111302116-111302138 TTCACAAGGGGAGCCAGGGAAGG - Intergenic
1076192657 10:128493818-128493840 GTCCCAAGGGGTGCCCGGCAAGG + Intergenic
1076364975 10:129915896-129915918 GGCCCCTGGGGAGACGGGGAGGG + Intronic
1076761246 10:132606792-132606814 GTCCCGATGGGAGCGGGGGCAGG + Intronic
1076899198 10:133328806-133328828 GTTCCCAGGGGAGCCTGAGAAGG + Intronic
1078057417 11:8019278-8019300 GCCCCGAGCGGAGCCGGAGGCGG + Intronic
1079583711 11:22098491-22098513 CTGCCCAGGGGAGCCAGGGAGGG - Intergenic
1080418828 11:32092605-32092627 TTCCTCAGGGGACCCGGGGAGGG - Intronic
1081741475 11:45444007-45444029 GTCCCCAGGCCAGCCTGGGAAGG - Intergenic
1081807846 11:45900013-45900035 GGCACGAGGGGAGCCGAGCAGGG - Intronic
1081998044 11:47377352-47377374 GGCTTGAGGGGAGCCGGGAAGGG - Intronic
1083733871 11:64668688-64668710 GGCCAGAGGGCAGCAGGGGAGGG + Intronic
1083862553 11:65430219-65430241 GGCACCAGGGGAGGCGGGGAAGG - Intergenic
1084174348 11:67415783-67415805 GCCCCGGGGAGAGCCAGGGAGGG + Intronic
1084285615 11:68128660-68128682 GTCCCAAGGGGGGGCGGGGGTGG - Intergenic
1085411120 11:76291329-76291351 GGCCAGAGGGGAGCAGGGGAAGG - Intergenic
1085825107 11:79838978-79839000 GTCCCCAGGTGTTCCGGGGAGGG + Intergenic
1087855930 11:103091893-103091915 GTGGGCAGGGGAGCCGGGGAAGG + Exonic
1088689219 11:112311091-112311113 GGGCCGAGGGGAGCCTGGGCTGG + Intergenic
1088823467 11:113475263-113475285 GGCCCGCGGGGAGCAGTGGACGG + Exonic
1088893283 11:114060518-114060540 GTCCCGCCGAGAGCCGAGGAGGG - Intronic
1089256968 11:117199236-117199258 GTCACTGGGGGAGCCGGGGGTGG + Intergenic
1091551587 12:1539159-1539181 GTCCCGTGGGGAGAGCGGGAGGG + Intronic
1092803144 12:12191235-12191257 GTCTGGAAGGGAGCCCGGGAAGG - Intronic
1096528998 12:52231815-52231837 GTCAGGAGGGGAGGCAGGGAGGG + Intergenic
1097015192 12:55981038-55981060 GACACCGGGGGAGCCGGGGAAGG + Intronic
1102467431 12:113138048-113138070 TCCCCGTGGGGAGCTGGGGAAGG - Intergenic
1103308895 12:119989212-119989234 GAGCCGGGAGGAGCCGGGGAAGG + Intergenic
1103779502 12:123389399-123389421 GACCCGGGGGAAGCGGGGGAGGG - Intronic
1104423140 12:128653557-128653579 GTCAGGAGGGGAGCCAGGGATGG - Intronic
1105202984 13:18195020-18195042 GTCCCGAGGAGGGCAGGGGCAGG + Intergenic
1107919458 13:45189044-45189066 GTGGGGTGGGGAGCCGGGGAGGG - Intronic
1112070719 13:95846412-95846434 GTGCAGAGGGGAGGAGGGGAGGG + Intronic
1113805947 13:113110101-113110123 GCCCCAAGCGGAGGCGGGGAAGG + Intronic
1114265349 14:21070166-21070188 GTCCCGCGCGGAGGCGGGGGCGG + Intronic
1115724138 14:36194641-36194663 GTACAGAGGGGAGAGGGGGAGGG + Intergenic
1119021682 14:71121589-71121611 GTCGAGAGGGGAGCTGGAGAGGG - Intergenic
1119494779 14:75069430-75069452 TGCCCTTGGGGAGCCGGGGAGGG - Exonic
1119535057 14:75396117-75396139 GTCCCCAGGGAAGCCCAGGAAGG - Intergenic
1119743401 14:77028109-77028131 GGCCCGAGGGGAGGGGGCGAGGG + Exonic
1121199673 14:92106637-92106659 GTACCGGGGCGGGCCGGGGAGGG - Intergenic
1122609988 14:102975760-102975782 GGCCCGAGATGAGCCGTGGAGGG + Exonic
1122886407 14:104712343-104712365 GTGCCGGGGGGTGCAGGGGAGGG + Intronic
1124813928 15:32969048-32969070 GTCCTGAGGGGAGGGGCGGAGGG + Exonic
1125928489 15:43582939-43582961 GTCCAGAGGAAAGCCTGGGATGG + Exonic
1125941655 15:43682774-43682796 GTCCAGAGGAAAGCCTGGGATGG + Intergenic
1126350261 15:47738683-47738705 GTGCTGAGGGGATCCAGGGAAGG + Intronic
1128495461 15:68195936-68195958 GTCCTGGGGGGAGTCTGGGAGGG + Intronic
1132381245 15:101368271-101368293 GGCCCCAGGGGAGCGGGAGAGGG + Intronic
1132602569 16:780186-780208 GTCCCGGCGGGAGCAGGGGCCGG + Intronic
1133021258 16:2967911-2967933 GTCCCCGGGGGAGCAGGGCAAGG - Exonic
1136275920 16:29179557-29179579 GCCCCTAGGGGAGCCAGAGAGGG - Intergenic
1136716513 16:32287301-32287323 GTCCTGAGGGGCGGCAGGGATGG - Intergenic
1136834901 16:33493579-33493601 GTCCTGAGGGGCGGCAGGGATGG - Intergenic
1137487414 16:48903175-48903197 GTCCCTAGGGAAGCCTGGGGAGG + Intergenic
1140014223 16:71165859-71165881 GGCCAGAGGGGAGCAAGGGAAGG + Intronic
1140410918 16:74739901-74739923 GTGCCCAGGGGAGAAGGGGAAGG - Intronic
1141172236 16:81698567-81698589 CTCCCGAGGGGAGCAGGGGAGGG + Intronic
1141419633 16:83904908-83904930 GACCCCATGGGGGCCGGGGAAGG - Intronic
1141424093 16:83934405-83934427 GCCCCGAGGGGGGCTGGGGCTGG - Intronic
1141921893 16:87141011-87141033 GTCGCGCAGGGAGCCGGGCAGGG - Intronic
1142130468 16:88429551-88429573 GCCCCGAGGTGGGTCGGGGAGGG + Exonic
1142212176 16:88813442-88813464 GGCCCGAGGGGGGCCTGGGAAGG + Intergenic
1142222640 16:88863197-88863219 GTCCCACGGGGAGACGCGGAGGG + Intergenic
1142222652 16:88863233-88863255 GTCCCACGGGGAGACGCGGAGGG + Intergenic
1203009902 16_KI270728v1_random:230453-230475 GTCCTGAGGGGCGGCAGGGATGG + Intergenic
1142607120 17:1088076-1088098 GGCCCGGGGGGAGCCGGGTCAGG - Intronic
1142753451 17:2001887-2001909 CCCCTCAGGGGAGCCGGGGACGG - Intronic
1142805623 17:2369751-2369773 GTCCCGGGAGGAGCCGGGGTGGG - Intronic
1143325428 17:6095325-6095347 GTCCAGATGGGAGCAGAGGAAGG + Intronic
1143416638 17:6755679-6755701 GACCAGAAGGGAGCCGGAGATGG + Intronic
1143564808 17:7715086-7715108 GTCCCCAGGGGAGATGGGGATGG + Intergenic
1143756561 17:9072040-9072062 GTCGGGAGGGAAGCCGGGGCTGG + Intronic
1143972721 17:10807111-10807133 GTCCCCAGGAGAGACAGGGAGGG - Intergenic
1144658082 17:17050814-17050836 GTCCTGTGGGGAGCCGGTGAGGG + Intronic
1144783869 17:17821321-17821343 GCCCCAAGTGGAGCCAGGGAAGG - Intronic
1146891213 17:36507572-36507594 GTACCGAGGCCAGCCGTGGATGG - Intronic
1148063522 17:44852517-44852539 GTACAGAGGGGAGCCTGGGATGG + Exonic
1148857051 17:50584581-50584603 GGGCCCAGGGGAGCCGGGGGCGG + Intronic
1149772401 17:59331975-59331997 GTCCCCGTGGGCGCCGGGGACGG + Intronic
1151188866 17:72383166-72383188 GTCAGGAGGGTAGCGGGGGAAGG - Intergenic
1152356052 17:79807982-79808004 GCACCTAGGGGAGCCGGGCATGG + Intergenic
1152362484 17:79839123-79839145 GGCCCGCGAGGAGGCGGGGAGGG - Intronic
1152806144 17:82357294-82357316 GGCCAGAAGGGGGCCGGGGAGGG - Intergenic
1152928603 17:83099085-83099107 TTCCCGAGGGCAGCCAGGGCCGG - Intergenic
1155579787 18:27290277-27290299 GTGCCCAGGGGAGGCTGGGAAGG + Intergenic
1157544858 18:48540071-48540093 GCCGCGGGGGGAGCGGGGGATGG + Intronic
1157550217 18:48576129-48576151 GGCCCGAGAGGCGCCGAGGATGG + Intronic
1160679127 19:404883-404905 GTCCCGAGGGGTGTGGGGGGGGG + Intergenic
1160874115 19:1289479-1289501 GTCCCCAGGGGAGGAGGAGAGGG - Intronic
1161112348 19:2477364-2477386 GTCCCGTGGGCAGCCGGGCTGGG + Intronic
1161290428 19:3491060-3491082 ATCGCGAGGGGAGCCAGGGGAGG - Exonic
1161353042 19:3804334-3804356 GTGCCTGGGGGACCCGGGGAGGG - Exonic
1161383145 19:3977101-3977123 GTCCTGATGGGAGCAGGTGATGG - Intronic
1161401042 19:4066373-4066395 GGCGCGCGGGGAGCGGGGGAGGG - Intronic
1161579014 19:5070642-5070664 GTGGCGAGGGGACCCTGGGAGGG - Intronic
1161978749 19:7619885-7619907 GTCCCAAGGGGGCCCGGGGTGGG - Intronic
1161980830 19:7629450-7629472 GTCCACAGAGGAGCCGGGGGTGG - Intronic
1162780222 19:13002794-13002816 ACCCTGAGGGGAGCCGGGGGTGG + Intronic
1162793896 19:13076956-13076978 GCCACGAGGAGAGCCTGGGAGGG - Intronic
1162799530 19:13103050-13103072 GGCCCCAGGGCAGCCGGGGAGGG + Intronic
1162954435 19:14090478-14090500 GGAGGGAGGGGAGCCGGGGAGGG - Exonic
1163118008 19:15200016-15200038 GTCCCGAGCGGGGGAGGGGAGGG + Intronic
1163441208 19:17323584-17323606 GTCTCGAGGGGATCCGAGGTGGG + Exonic
1163597058 19:18226362-18226384 TCCCCGAGGGGAGCCGGGCCCGG + Intronic
1163701743 19:18789745-18789767 GTCCCGGGTGGTGACGGGGATGG + Intronic
1165317586 19:35066044-35066066 GTCCAGATGGGAGCCAGGGTGGG + Intronic
1166735195 19:45079748-45079770 GGCCCCAGGGGAGAAGGGGAGGG + Intronic
1166826564 19:45613514-45613536 GTCCCTTGGGGAGATGGGGATGG - Intronic
1166959534 19:46489361-46489383 GGCCCGAGGAGGGCCGGGGCAGG - Intronic
1167109378 19:47449981-47450003 GTAATGGGGGGAGCCGGGGAGGG + Intronic
1167162795 19:47778838-47778860 GTCCCGGCGGGGGTCGGGGACGG - Intronic
1167293185 19:48635600-48635622 GTCCCGAGGGCAGCCCGGGCGGG + Exonic
1168011685 19:53538315-53538337 GCTCCGAGGGGAGACGGGCACGG + Intronic
1168309343 19:55452690-55452712 GACCCTTGGGGAGCCGGGGGTGG + Intergenic
1168687469 19:58357475-58357497 GTTCCGAGGGAGGCAGGGGACGG - Exonic
1168696863 19:58408671-58408693 GCCGCGAGGAGAGCCGGGAATGG + Exonic
926047115 2:9717885-9717907 CTCCCCAGAGGAGCTGGGGAGGG - Intergenic
926251014 2:11155440-11155462 GTCCCGGGCGGATCCCGGGAAGG + Exonic
927186219 2:20484419-20484441 CTCCCGAGGGAGGCCAGGGATGG + Intergenic
928453426 2:31398740-31398762 GTCCTTTGGGGAGCCTGGGAGGG - Intronic
928615427 2:33033987-33034009 GTCCCCCAGGGAGCCGGGGAGGG - Intronic
934559386 2:95304804-95304826 GGCCTGTGGGGAGCCAGGGAGGG - Intronic
934775928 2:96937465-96937487 GGCGAGAGGGGAGCCGGGGCTGG - Intronic
935275714 2:101474114-101474136 GTCCCGAGGGCAGCCGTAGCGGG + Intronic
935746416 2:106193811-106193833 GTCGCGCTGGGAGCCGGCGAGGG - Intronic
938319796 2:130355530-130355552 GGCCCAAGGGAGGCCGGGGAGGG - Intergenic
942454858 2:176130586-176130608 GTCCCGGAGGGCGGCGGGGACGG - Exonic
944517363 2:200526029-200526051 GTGCCCAGGCGAGCCGGGGGCGG - Intronic
945179273 2:207075468-207075490 GTGACGGGGGGAGGCGGGGAAGG + Exonic
947530131 2:230903785-230903807 GTCCAAAGGTCAGCCGGGGAAGG + Intergenic
948426004 2:237886918-237886940 GTCCACAGGGGAGGCGGGGGTGG - Intronic
948728949 2:239951540-239951562 GTGCTGAGGGGACCCAGGGAGGG - Intronic
949040175 2:241844306-241844328 GGCCCGGGGCCAGCCGGGGACGG + Intergenic
1169116856 20:3071793-3071815 GTCCCGCGGCGCTCCGGGGAGGG + Intronic
1170684125 20:18553732-18553754 GGCCCAGGGGGAGCAGGGGATGG + Intronic
1170816802 20:19720901-19720923 GAACCCAGGGGACCCGGGGAAGG - Intronic
1171091996 20:22294092-22294114 GTCGAGAGTGGGGCCGGGGAGGG + Intergenic
1175256640 20:57652029-57652051 GTCCCCAGGGGGGCCGGGCTGGG - Exonic
1176714975 21:10342985-10343007 GTCCCGAGGAGGGCAGGGGCAGG - Intergenic
1177157455 21:17513357-17513379 GTCCCGTAGGGAGCCGCGCAGGG + Intronic
1178875993 21:36414247-36414269 GTCACGAGGAGAGCTGGGAAGGG + Intronic
1178892260 21:36530089-36530111 GTTCCGAGGCGGGCCGGGAAGGG + Intronic
1179783907 21:43719184-43719206 CAGCCGAGGGGAGCCGGGGCCGG + Exonic
1179807033 21:43845940-43845962 GTGGCCAGGGGAACCGGGGAGGG + Intergenic
1179895303 21:44358441-44358463 TTCCCGTGGGGTGCCGGGGGTGG + Intronic
1179947135 21:44686172-44686194 GAGCCGAGGGGAGCTGGTGAAGG - Intronic
1180603375 22:17036953-17036975 GTCCCGAGGAGGGCAGGGGCAGG + Intergenic
1181162149 22:20965417-20965439 GCCCCGCGGCGAGCCGGGAAGGG - Intronic
1181808562 22:25390188-25390210 GTCCTGAGGGGACCCAGTGAAGG - Intronic
1182080062 22:27522530-27522552 GTCCCGTGGGGACTCGGGAAGGG + Intergenic
1183831112 22:40418720-40418742 GTGCCGAGGGGGGCGGGGGCGGG + Exonic
1184067453 22:42128723-42128745 CTCCCGAGAGGTGCCGGGGCTGG - Intronic
1184130885 22:42515732-42515754 AGCAGGAGGGGAGCCGGGGAAGG + Intronic
1184141061 22:42577562-42577584 AGCAGGAGGGGAGCCGGGGAAGG + Intergenic
1184491315 22:44810791-44810813 TTCCCGTGGGGAGCCGTGGAGGG + Intronic
1184523568 22:45009135-45009157 GGCCCGAGGGGAGGCCGGAAGGG + Intronic
1185046832 22:48532795-48532817 TTCCCGATGGGAGCCGGGGCAGG - Intronic
1185289167 22:50015365-50015387 GTCCCGGGGCGCGCCGGGGCGGG - Intronic
952126428 3:30305971-30305993 TTCCAGAGGGAAGCCTGGGAGGG - Intergenic
954966057 3:54612095-54612117 TTCCCAAGGGGAGCAGAGGAAGG - Intronic
960702493 3:120451345-120451367 GTGCCGTGGGGGGCCCGGGAAGG + Intergenic
961621296 3:128226998-128227020 GGCCCGAGAGGGGCCGGGGCAGG - Intronic
961652959 3:128426455-128426477 GTCCCGCGGCGGGCCGAGGAGGG - Intergenic
962275849 3:134012824-134012846 GTGCCGAGGAGAGTCAGGGATGG - Intronic
963116410 3:141733778-141733800 CTGCAGAGGGGTGCCGGGGATGG + Intergenic
967016725 3:185488939-185488961 GACCAGAGGGGAGCCAGGTAAGG - Exonic
968579128 4:1381566-1381588 GGCCCGAGGGGAGGCAGGGCGGG - Intronic
968616360 4:1579344-1579366 GGCCCGAGGGCGGCCGGGGTAGG - Intergenic
969395244 4:6916289-6916311 GTCCAGAGAGGAGCCGGGACAGG + Intronic
970156977 4:13151551-13151573 GTAAGGAGGGGAGCCAGGGAGGG + Intergenic
975166785 4:71186816-71186838 CTCCCGAGGGGCGCCTGGGCTGG + Intergenic
975486244 4:74936373-74936395 ATCCCGAGGGGAGCAGGAGAGGG - Intronic
977406032 4:96599907-96599929 GATCGGAGGGGAGCAGGGGAGGG + Intergenic
979607295 4:122652168-122652190 CTCCCCAGGGGAGCCAGGGTAGG - Intergenic
981474999 4:145179769-145179791 GCTTCGAGGGGAGGCGGGGACGG - Intronic
982044087 4:151424388-151424410 CTCCCGAGGGGAGAAGAGGAGGG + Intronic
982070281 4:151688218-151688240 CTCCCGAGGGGAGCCCTGGTTGG + Intronic
983927715 4:173419669-173419691 GCCCCGAAGGGAGCTGTGGATGG - Intergenic
984206553 4:176793073-176793095 ATCCAGAGGGGGGCCGGGGGAGG - Intergenic
984937668 4:184903400-184903422 GTCCCCAGCGGAGCCGCTGAGGG - Intergenic
985538412 5:476837-476859 GCCCCGAGGGGAGAAGGGGCTGG - Intronic
985652198 5:1112354-1112376 GACAAGAGGGGAGGCGGGGAGGG - Intergenic
985803608 5:2022107-2022129 ATCCCAAGGGGAGCCGGGGCGGG - Intergenic
985962645 5:3314376-3314398 GGCCCAAGGAGAGCCAGGGAGGG - Intergenic
994398651 5:99251031-99251053 GGCTCGGGGGGAGCAGGGGAAGG - Intergenic
996322832 5:122238735-122238757 GTGTCGGGGGGAGGCGGGGAGGG - Intergenic
997470775 5:134115605-134115627 GGCAGGAGGGGAGGCGGGGATGG - Intronic
1000039867 5:157477584-157477606 TTCCCCAGGGGAGCCTGCGAAGG - Exonic
1001310799 5:170608912-170608934 GTCCCGGGCGGAGGCAGGGAAGG + Intronic
1001837366 5:174843636-174843658 ATCCCGCTGGGAGCTGGGGAGGG + Intergenic
1001972325 5:175966834-175966856 CTGCCTAGGGGAGCCAGGGAAGG - Intronic
1002185851 5:177454587-177454609 GCGCCGAGGGGAGCCGAGGCGGG - Intronic
1002245113 5:177876943-177876965 CTGCCTAGGGGAGCCAGGGAAGG + Intergenic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1002771239 6:292297-292319 TTCCCGGCGGGAGCCGGGCAGGG - Intronic
1003169910 6:3712979-3713001 GTCCCCAGGGGAGCCTGGCAGGG + Intergenic
1006496368 6:34426128-34426150 GACCCGCGGGGAGCCTGGGGTGG + Intergenic
1006642662 6:35496953-35496975 GCCGCAAGGGGGGCCGGGGAAGG + Exonic
1007398014 6:41588179-41588201 GGCTGGAGGGGAGCAGGGGAGGG - Intronic
1010012197 6:71061196-71061218 GCACCAAGGGGAGCAGGGGAAGG - Intergenic
1011626371 6:89286837-89286859 TTCCAGAGGGAAGCTGGGGAAGG + Intronic
1012506183 6:99948964-99948986 CTCCTGTGGGGAGCCGGGGGTGG + Intronic
1013232133 6:108168584-108168606 GTCCCGACCTGAGCCGGGGCTGG - Intronic
1015262916 6:131259048-131259070 GTCAGGAGAGAAGCCGGGGAGGG - Intronic
1018977909 6:168579604-168579626 GTCCTGAGGGGAGCTGGTGAGGG + Intronic
1019153351 6:170023444-170023466 GGCCTGAGGAGAGCCGGAGAAGG - Intergenic
1019477680 7:1251881-1251903 GTGCCTAGGGGAGCTGGGGGCGG - Intergenic
1019532515 7:1510861-1510883 GGCCCGAGGGGAGACGGGTGCGG + Intergenic
1019552493 7:1610162-1610184 GTCATGCTGGGAGCCGGGGAAGG - Intergenic
1021735800 7:23637781-23637803 GTCCGGGAGGGAGGCGGGGAGGG + Intronic
1022637452 7:32150382-32150404 GGCCAGAGGGGAGCCCAGGAGGG - Intronic
1023147004 7:37161212-37161234 GTCTTGAGGGGAGCCAGGCATGG - Intronic
1023810227 7:43906282-43906304 GGGCCTAGGGGATCCGGGGAGGG - Intronic
1025078752 7:55964718-55964740 TTCCCGGGAGGTGCCGGGGAGGG + Intronic
1025731734 7:64114051-64114073 GTCCCGGGGTCAGCCAGGGAAGG + Intronic
1026361030 7:69600457-69600479 GTCCCGAGGACACCCGGGAAAGG - Intronic
1026824512 7:73573124-73573146 GTCCCTAGGGAAGGTGGGGAAGG - Intronic
1027230100 7:76267564-76267586 GCCCAGCGGGGAGCCGAGGAGGG - Intronic
1029437240 7:100570105-100570127 GCCCCGGGGAGAGCCGGGAATGG + Intergenic
1029515143 7:101019092-101019114 GTCCTGACTGGAGCCGGGGAGGG - Intergenic
1029821282 7:103149653-103149675 GTCGCGAGGCGGGCCGGGGCAGG - Intergenic
1032298926 7:130668809-130668831 GGGCCGAGGGCGGCCGGGGAGGG - Exonic
1033030450 7:137820938-137820960 GGCCCCAGGGGAGGAGGGGAGGG - Intronic
1033218466 7:139511515-139511537 GTTGCCAAGGGAGCCGGGGAAGG + Intergenic
1033390771 7:140924944-140924966 GTGCGGGGGGGAGCGGGGGAAGG + Intergenic
1034969252 7:155408931-155408953 GTCCCGAGGGGCGCCGGGCCAGG - Intergenic
1035277880 7:157758744-157758766 GTAGCGTGGGGAGCTGGGGAAGG - Intronic
1035435448 7:158856308-158856330 GTCCCGTGGGAACCCGGGGCGGG + Intergenic
1037977294 8:23222845-23222867 ATCCGGAAGGGAGACGGGGAGGG - Intronic
1039782174 8:40796645-40796667 GTGCGGGGCGGAGCCGGGGAGGG - Intronic
1039870357 8:41540507-41540529 GGAGGGAGGGGAGCCGGGGAAGG + Intronic
1040567851 8:48582812-48582834 GTCCGGGTGGGAGCCAGGGATGG + Intergenic
1047732045 8:127736114-127736136 GGCAGGAGGGGAGCCAGGGACGG - Exonic
1049156126 8:141067806-141067828 GTCCCTAGGGGAGGAGGGGCAGG + Intergenic
1049707767 8:144050776-144050798 GTCCCTGGGGGATCCGGGGGAGG - Intergenic
1051996130 9:23219947-23219969 GTGGAGAGGGGAGCTGGGGAGGG + Intergenic
1056499788 9:87197479-87197501 GTCCTGCTAGGAGCCGGGGAAGG + Intergenic
1057276311 9:93677569-93677591 TTTCCTAGGGGAGTCGGGGAGGG - Exonic
1059191797 9:112333720-112333742 GCCCCGAGGGAGGGCGGGGACGG - Intergenic
1060779608 9:126401757-126401779 GTCCAGAGGGAAGGCGGGGTTGG - Intronic
1060978345 9:127778538-127778560 GCCCAGAGGAGAGCCAGGGATGG + Intronic
1061714983 9:132513442-132513464 GTCCTCAGGGAAGACGGGGAGGG - Intronic
1061737248 9:132670071-132670093 GTCCCGAGGGGAGCCGGGGACGG + Exonic
1185432623 X:18658-18680 GTCCCGAGGGGAGGAGCGGGGGG - Intergenic
1189033726 X:37475095-37475117 GTCTGGAGGGGAGGTGGGGATGG + Intronic
1189262594 X:39689066-39689088 CTCCGGCGCGGAGCCGGGGAGGG + Intergenic
1191184006 X:57591465-57591487 GTCCCGCGGGGAGGTGGGAAGGG + Intergenic
1196804858 X:119574809-119574831 GTCCCGAGGCGCGCCGGGCGGGG + Intronic
1198275770 X:135096158-135096180 GCCCAGAGGGGAGCCAGGAAGGG - Intergenic
1198310748 X:135424575-135424597 GCCCAGAGGGGAGCCGGGAAGGG + Intergenic
1199737226 X:150695432-150695454 GTCCAGAGTGGAGCGGAGGAGGG + Intronic