ID: 1061742786

View in Genome Browser
Species Human (GRCh38)
Location 9:132719354-132719376
Sequence CTGTAGTTTTTGAAGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061742786_1061742790 24 Left 1061742786 9:132719354-132719376 CCCTGTTTCTTCAAAAACTACAG No data
Right 1061742790 9:132719401-132719423 TGCCTGTAGTCCCAGCTACTTGG 0: 31791
1: 131261
2: 147110
3: 126565
4: 181119
1061742786_1061742788 -3 Left 1061742786 9:132719354-132719376 CCCTGTTTCTTCAAAAACTACAG No data
Right 1061742788 9:132719374-132719396 CAGAAAGTAGCCAAGCATGATGG No data
1061742786_1061742793 28 Left 1061742786 9:132719354-132719376 CCCTGTTTCTTCAAAAACTACAG No data
Right 1061742793 9:132719405-132719427 TGTAGTCCCAGCTACTTGGGAGG 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875
1061742786_1061742791 25 Left 1061742786 9:132719354-132719376 CCCTGTTTCTTCAAAAACTACAG No data
Right 1061742791 9:132719402-132719424 GCCTGTAGTCCCAGCTACTTGGG 0: 29903
1: 154936
2: 253675
3: 221513
4: 364385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061742786 Original CRISPR CTGTAGTTTTTGAAGAAACA GGG (reversed) Intergenic
No off target data available for this crispr