ID: 1061744234

View in Genome Browser
Species Human (GRCh38)
Location 9:132727974-132727996
Sequence TACTCACAGCTCCCAGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 391}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061744234_1061744236 -3 Left 1061744234 9:132727974-132727996 CCTTTTCCTGGGAGCTGTGAGTA 0: 1
1: 0
2: 5
3: 47
4: 391
Right 1061744236 9:132727994-132728016 GTAACAAACTCTTCTTTCAGTGG No data
1061744234_1061744238 24 Left 1061744234 9:132727974-132727996 CCTTTTCCTGGGAGCTGTGAGTA 0: 1
1: 0
2: 5
3: 47
4: 391
Right 1061744238 9:132728021-132728043 GACCTCTCTGTATCATCACCTGG No data
1061744234_1061744237 -2 Left 1061744234 9:132727974-132727996 CCTTTTCCTGGGAGCTGTGAGTA 0: 1
1: 0
2: 5
3: 47
4: 391
Right 1061744237 9:132727995-132728017 TAACAAACTCTTCTTTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061744234 Original CRISPR TACTCACAGCTCCCAGGAAA AGG (reversed) Intronic
900389984 1:2429578-2429600 TTCTCACTGCTCCCAAGAAGGGG - Intronic
900436624 1:2634114-2634136 CACTCCCAGCTCCCCAGAAAGGG - Intergenic
900668325 1:3831520-3831542 TATTCTCAGCTTCAAGGAAAAGG + Intronic
900898955 1:5503942-5503964 TACTCACAGATCCCATGAGGAGG - Intergenic
902725680 1:18334578-18334600 TCCTCACGGCTCCCTGGAAGTGG + Intronic
902741396 1:18441017-18441039 TACTCACAGGTCCCAGGAGAAGG - Intergenic
902746184 1:18476092-18476114 TACTCACGGGTCCCAAGAGAAGG - Intergenic
902917640 1:19648322-19648344 GCCTCCCAGCCCCCAGGAAAGGG - Intronic
902974882 1:20081420-20081442 TATTTACAGCTCCCAGAAGAAGG + Intronic
903282500 1:22257887-22257909 CACTCACAGCTCCCTGGGCATGG + Intergenic
905257256 1:36692964-36692986 GCCCCAGAGCTCCCAGGAAATGG + Intergenic
905461205 1:38124055-38124077 CACCCACAGCTCCCAGAAAGGGG + Intergenic
905659670 1:39711871-39711893 TACTCACAGTTCCCTAGAAATGG + Intronic
906687978 1:47774769-47774791 TACTCACAGCTTCTAGGCACAGG + Intronic
906975548 1:50568180-50568202 TACTCACAATTACCAGGGAAAGG + Intronic
907823130 1:57990136-57990158 TCTCCTCAGCTCCCAGGAAATGG + Intronic
907873432 1:58463967-58463989 AGCTCACAGCTCCAAGCAAATGG + Intronic
908148108 1:61268764-61268786 AGCCCAGAGCTCCCAGGAAAAGG - Intronic
908231104 1:62105970-62105992 TAGTCCCAGCTCCCAGGATGAGG + Intronic
908651469 1:66337547-66337569 TGCTCACAGGTCCCTGGAGATGG + Intronic
908701652 1:66908558-66908580 TATTCACAGTTCCAAGGAAGAGG - Intronic
908793885 1:67812002-67812024 CAGTCACAGTTCTCAGGAAAAGG + Intronic
909348894 1:74625131-74625153 TACTCACAGTTCCCAAGAGGAGG - Intronic
909664919 1:78121919-78121941 TCCTCACAGCCTCCAGCAAAAGG - Intronic
911254763 1:95621080-95621102 TACTCCCAGGTCCCAAGAAGGGG + Intergenic
911544663 1:99202379-99202401 ATCTCACATCTCCCAGGAACAGG - Intergenic
914348541 1:146820296-146820318 TACTCACAGATTCCAGGAATTGG + Intergenic
915268061 1:154732742-154732764 TATTCACAGCTCCCTCAAAATGG - Intronic
915437535 1:155919929-155919951 TGCTCACAGCCCACAGGTAAGGG + Intronic
915600653 1:156921028-156921050 TACTCACTGCTCCAAGGTTATGG + Intronic
916042306 1:160971661-160971683 TACTCACAGTTCCCAAGGGAAGG + Intergenic
916202032 1:162281302-162281324 TATTCACAGAGCCCAAGAAAAGG - Intronic
917030250 1:170682507-170682529 TACTAACAAATCCCAGGAGATGG - Intronic
918147879 1:181773686-181773708 AGCTCACAGCTTCCAGGAATCGG + Intronic
920074050 1:203324226-203324248 CACCCACATCTCCCAGGAAGTGG - Intergenic
920374996 1:205503583-205503605 AACTCACAGTCCCCAGGGAAAGG + Intergenic
920959058 1:210648061-210648083 TCCTGCCAGCACCCAGGAAAGGG - Intronic
922819540 1:228474608-228474630 TACTCACAGTTCCCAAGAGGAGG + Intergenic
922873184 1:228919288-228919310 TACTCACAGTTCCCATGAGGAGG - Intergenic
923329738 1:232911454-232911476 TATTCACAGTTCCCAGGAGGAGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923566472 1:235080134-235080156 TACTCATCTCTCCAAGGAAAAGG + Intergenic
1063527101 10:6796464-6796486 CACTCACAGTTCCCAGGAGGAGG - Intergenic
1063856001 10:10254828-10254850 AAATCACAGCTCTCTGGAAACGG + Intergenic
1064868204 10:19906287-19906309 TACTCACAGATCCCAGGAGAAGG + Intronic
1065282805 10:24156897-24156919 TACTCACAGTTTCCTAGAAATGG - Intronic
1065468749 10:26054536-26054558 TATTCACAGATCCCAGGGATTGG - Intronic
1065837799 10:29675046-29675068 TATTCACAGCTTCCAGGGATTGG + Intronic
1067454470 10:46407936-46407958 GTCTGACAGCTCCCTGGAAAAGG - Intergenic
1067632732 10:47976696-47976718 GTCTGACAGCTCCCTGGAAAAGG + Intergenic
1069142413 10:64842410-64842432 TGGTCAAAGCTCCCTGGAAATGG + Intergenic
1069172922 10:65255245-65255267 GAGTCACAGGGCCCAGGAAAGGG + Intergenic
1069418418 10:68223720-68223742 TACTCACAGATCCTAGAAACAGG + Intergenic
1069719975 10:70543781-70543803 TACACACAGCTCCCAGCACGGGG - Intronic
1070960929 10:80499761-80499783 AGCGCACAGCTCCCAGGAAAGGG + Intronic
1072541515 10:96401820-96401842 TACCCCCACCTCCCAGGAATGGG - Intronic
1072563271 10:96596400-96596422 TACTCACAGATCCCAAAACAGGG - Intronic
1074311877 10:112329344-112329366 TACTCACGACACCCAAGAAATGG - Intergenic
1074960815 10:118444135-118444157 TAATAACAGTTCCCAGGCAAAGG - Intergenic
1075263816 10:120984111-120984133 CACTCACAAATCCCAGGAGAAGG - Intergenic
1076248157 10:128963771-128963793 AAAGCACTGCTCCCAGGAAAAGG - Intergenic
1076620167 10:131781968-131781990 AACTCACAGCTCCCAGGGCCAGG - Intergenic
1076725399 10:132410669-132410691 CCCTCACAGCTCCCAGGACCAGG - Intronic
1077555450 11:3223939-3223961 AACTCATAGCTCCCAGGAGGAGG + Intergenic
1078435402 11:11320852-11320874 TACACACATTTCCCAGGAAGGGG - Intronic
1083619187 11:64040583-64040605 AACACACAGCTCTCGGGAAAAGG - Intronic
1083799449 11:65038061-65038083 TCCTCACATTTCCCAGGTAAAGG - Intronic
1084436658 11:69146066-69146088 TACTTACAGTTCCCAGGAGCAGG - Intergenic
1084551481 11:69845699-69845721 TACTCACAGGTTTCAGGAATTGG - Intergenic
1085169361 11:74435404-74435426 TACTCAAAGCTCCAAAGAGAGGG - Intergenic
1085344973 11:75762849-75762871 TACCCACAGCACCCAGCACAAGG + Intronic
1085734392 11:79026658-79026680 TTCTCACAGCAACCAAGAAAGGG + Intronic
1085756291 11:79204433-79204455 TAGTCACAGCTCCCAGAGATAGG - Intronic
1087736979 11:101845298-101845320 TAATCACAGCTGGCAGCAAAAGG + Intronic
1087821772 11:102720442-102720464 TACACACAGCTCCTAGCATATGG + Intronic
1088991050 11:114953963-114953985 AACTCATAGCTCCCAGGAGCTGG + Intergenic
1089350088 11:117817153-117817175 TCCTCACAGCACCCATGAACAGG - Intronic
1089553685 11:119302242-119302264 TCCTCACAGCACCCAGTCAAAGG - Exonic
1090666272 11:128916878-128916900 CCCTCACAGCTCCCAGCACAGGG + Exonic
1093090169 12:14911588-14911610 TACTCACAGTTCCCAAGAGGAGG - Intergenic
1093181581 12:15972747-15972769 TGCTCACAACTCTCAGGAGAAGG + Intronic
1093653146 12:21666995-21667017 TAAACACAGCTGCCTGGAAATGG - Intronic
1094676869 12:32628850-32628872 TTATCTCAGATCCCAGGAAAAGG - Intronic
1098370445 12:69754066-69754088 TCCTCACAGCAACCAGGACAAGG + Intronic
1098389981 12:69959360-69959382 TACTCACAGTCCCCAAGACAAGG - Intergenic
1098549086 12:71743091-71743113 TATTCACAGGTTCCAGGAATTGG + Intergenic
1098611361 12:72462449-72462471 TACCAACACCACCCAGGAAAGGG - Intronic
1099066636 12:77988763-77988785 TAGACACAGCTCTCAGGCAATGG - Intronic
1099163552 12:79274665-79274687 TACTCAGATATCCCAGGAGATGG - Intronic
1099593597 12:84627732-84627754 TACTCTCTCCTCACAGGAAAAGG + Intergenic
1100648139 12:96552714-96552736 TCCTCACAGCTACAATGAAATGG - Intronic
1101936891 12:109065480-109065502 GACACACAAATCCCAGGAAATGG + Intronic
1102566239 12:113799156-113799178 GACTCACACCTTCCAGCAAAGGG + Intergenic
1102586280 12:113925244-113925266 TACACACAGAGCCCAGGGAAAGG + Intronic
1103167669 12:118784088-118784110 TACTCACAGTTCCCAAGAGGAGG - Intergenic
1103646202 12:122394764-122394786 TAATCCCAGCTCCCAGGAGGCGG + Intronic
1103815400 12:123651141-123651163 TACTCACATGTCCCAGTAATGGG - Intronic
1105836811 13:24219240-24219262 TACTCAGAAATTCCAGGAAAAGG + Intronic
1106954709 13:34923818-34923840 TAATAACAGCTCCCTGGAAATGG + Intergenic
1107275226 13:38670599-38670621 TACTCACAACTGCTAGGAGATGG + Intergenic
1107328251 13:39268852-39268874 TACTCACAGTTGCCAAGAACAGG + Intergenic
1108385205 13:49893481-49893503 TACTCACAGATCCCAACAGAAGG + Intergenic
1108590414 13:51907715-51907737 TACTCACAGATCCCAACAGAAGG - Intergenic
1108738880 13:53314218-53314240 CCCTCACAGCTGCCAAGAAAGGG - Intergenic
1108866249 13:54925845-54925867 TACTCACAGGTCCTAGAAACAGG - Intergenic
1108957272 13:56175564-56175586 TACTCACAGGTCACAGAGAAGGG + Intergenic
1109018748 13:57056541-57056563 TAATAACACCTCCCAAGAAAAGG + Intergenic
1109401363 13:61833669-61833691 TTCTCTCAGCTTCCAGTAAATGG + Intergenic
1109636667 13:65128114-65128136 TATTCACAGTAGCCAGGAAATGG - Intergenic
1109956540 13:69575225-69575247 TACTCACAACTACCAAGATATGG - Intergenic
1111264425 13:85789362-85789384 TACTTACAACACCAAGGAAATGG + Intergenic
1111319901 13:86613659-86613681 TTCACATGGCTCCCAGGAAAGGG - Intergenic
1111384034 13:87500112-87500134 GACTCACGTCTCCCAGGATATGG - Intergenic
1111572814 13:90108769-90108791 TTCTCACAGCTCATAGGAATAGG + Intergenic
1112314771 13:98351168-98351190 TACTCACAGTTCCCAAGAGGAGG - Intronic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1112438769 13:99410018-99410040 TACTCACAGATCCCAAGAGGAGG - Intergenic
1113190747 13:107742798-107742820 TACTCACAACCCCCAGCAGAGGG + Intronic
1113635086 13:111913862-111913884 GACGCAGAGCTTCCAGGAAAGGG - Intergenic
1113909499 13:113835522-113835544 TGCGTACAGCTCCCAGGAGAAGG - Exonic
1114071724 14:19115348-19115370 TAATAACAGCTCCCTGGAAAAGG + Intergenic
1114090536 14:19284616-19284638 TAATAACAGCTCCCTGGAAAAGG - Intergenic
1114377697 14:22166195-22166217 TAGCCACAGATCCCAGCAAAAGG + Intergenic
1116686592 14:48047816-48047838 TACTCACATTTCCCAAGAGAAGG + Intergenic
1117782581 14:59249291-59249313 TACACAGGGCTCCCAGGACAAGG - Intronic
1117963212 14:61182420-61182442 TACTTATAGCTCCAAGAAAAGGG + Intergenic
1118349378 14:64962706-64962728 AACTCACAGTTCCTAGGAAGAGG + Intronic
1118877560 14:69797772-69797794 TCCTCTCAGCTCCCAGGAAAAGG - Intergenic
1120256104 14:82121617-82121639 TACTCACAGTTCCCAAGAGGAGG + Intergenic
1120336161 14:83158330-83158352 TGCTCACAGTTCCCAAGAACAGG + Intergenic
1120960944 14:90124319-90124341 TATTCACAGGTTCCAGGGAATGG - Intronic
1121606788 14:95246449-95246471 TACTCACAGTTCCCAAGAGGAGG - Intronic
1122802112 14:104236637-104236659 TACTCACAGCTCCCAAGAGGAGG + Intergenic
1123003186 14:105307496-105307518 TACTCACAGTTCCCAGGAGGAGG - Exonic
1202845425 14_GL000009v2_random:168620-168642 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1202914825 14_GL000194v1_random:158886-158908 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1202875366 14_GL000225v1_random:202599-202621 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1202877844 14_KI270722v1_random:23823-23845 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1124872765 15:33559391-33559413 TACTCACAGGTCCTAGCAACAGG + Intronic
1125895261 15:43296640-43296662 TACAAACAGCAGCCAGGAAAAGG - Intronic
1126128690 15:45319725-45319747 TCCTCTCAGCTCCTAGGAGAAGG - Intergenic
1126513582 15:49508918-49508940 TACTCACAGTTCCCAAGAGTAGG + Intronic
1126531765 15:49718736-49718758 TATTCACAGATCCCAAGAGAAGG + Intergenic
1126795118 15:52254200-52254222 TCCTCACTGCTCCTAGAAAAAGG - Intronic
1127176236 15:56361016-56361038 TACTCACAGGTCCTAGAAATAGG - Intronic
1127555506 15:60083405-60083427 TTCTCCCTGCTCCCAGGAAGGGG - Intergenic
1130569678 15:85030386-85030408 TTCTCACTTCTCACAGGAAAAGG - Intronic
1130647634 15:85742820-85742842 TACTGACAGCTTCCAGGGTAGGG + Intronic
1130746050 15:86655025-86655047 TACTCACAGCTTGCCAGAAAAGG + Intronic
1130886254 15:88095011-88095033 TAGCCACAGCTCCCAGGTAATGG - Intronic
1131957163 15:97748735-97748757 GGCTCCCAGCTCCCAGGGAAAGG - Intergenic
1132075157 15:98813582-98813604 TACTCACAGTCCCCAAGAAGAGG - Intronic
1132201200 15:99955987-99956009 TACTCACAGTTCCCAAGACAAGG + Intergenic
1133680163 16:8113758-8113780 TGCTGACAGCTCCCAGAAACTGG - Intergenic
1134088252 16:11373278-11373300 CACTCAGAGCTACCAGGCAAAGG + Intronic
1134392360 16:13831372-13831394 TACTCACAGATCCCAGGAGAAGG - Intergenic
1135191081 16:20355182-20355204 TACTCACAGATCCCAAGAGAAGG - Intronic
1135624185 16:23981454-23981476 TATTCACAGGTCCCAGGATTAGG + Intronic
1136617985 16:31410400-31410422 TCCCCACAGCCCCCAGGAAGAGG - Exonic
1137496115 16:48970582-48970604 GACTTGCAGCTCCCAAGAAATGG - Intergenic
1138139755 16:54558007-54558029 CAATCACAGCTCACAGGAAGCGG - Intergenic
1138664953 16:58558466-58558488 TCATCACAGCTTCCAGGTAAGGG - Exonic
1139985495 16:70895252-70895274 TACTCACAGATTCCAGGAATTGG - Intronic
1140238712 16:73182089-73182111 TCCTCCCAGCTCTGAGGAAAAGG - Intergenic
1140314992 16:73888015-73888037 TAAAAACAGCTCCCAGGAAGTGG + Intergenic
1140826160 16:78708830-78708852 TTTTCACAGCGCCCAGCAAAGGG + Intronic
1140942985 16:79739622-79739644 TACACACAGCTTCCAGAAATAGG - Intergenic
1145971031 17:28956649-28956671 TTCTCACGGCTCCCAGGTCATGG - Intronic
1146921058 17:36712130-36712152 TAGGCACAGCCCACAGGAAATGG - Intergenic
1147331384 17:39701121-39701143 CACGCACAGCACCAAGGAAAAGG - Intronic
1149017381 17:51924234-51924256 AAAGCACAGATCCCAGGAAAAGG + Intronic
1149033670 17:52110894-52110916 TACTCACAGCAACCATGTAAGGG + Intronic
1151116610 17:71742802-71742824 TACTCACAGCTACCAGAGAGTGG + Intergenic
1151796008 17:76346330-76346352 TCCTCTCGGCTCCCAGGAAGAGG + Intronic
1152013967 17:77737436-77737458 TACTCACAGTTCCCAAGAGGAGG + Intergenic
1152102365 17:78309571-78309593 TAGTCACAGGTTCCAGGAATCGG - Intergenic
1152140253 17:78532298-78532320 TACTTACAGTTCCCAAGAAGGGG - Intronic
1152248195 17:79197139-79197161 GAATCACAGCTCACAGGAACTGG - Intronic
1152419766 17:80186129-80186151 CATTCACAGCTCCCAGGGTAGGG - Intronic
1153170040 18:2305686-2305708 TACTCAATGATCCTAGGAAATGG - Intergenic
1153908155 18:9682224-9682246 TCCTCAAAGCTCCCAGTCAAGGG - Intergenic
1154430929 18:14307931-14307953 TATCCACAGTTCCCAGGAATTGG - Intergenic
1155253175 18:23970493-23970515 TACTCACATATTCCAAGAAAGGG - Intergenic
1156231637 18:35158855-35158877 AAATCAAAGCACCCAGGAAAGGG - Intergenic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1158233106 18:55280700-55280722 TATTCACAGGTCACAGTAAAAGG + Intronic
1159891389 18:73956303-73956325 TACTCACAGATTCCAGGATTAGG + Intergenic
1161723305 19:5915303-5915325 TGCTCACAGCTGCCAGGCACTGG - Exonic
1162369489 19:10270358-10270380 TCTTTACAGCTCCCAGAAAAAGG - Intergenic
1162822250 19:13230027-13230049 TACTCACCTCTCCCTGGAACTGG - Intronic
1162822586 19:13231994-13232016 TTCTCTCAGCTCCCAGTAAAAGG - Intronic
1162863350 19:13525019-13525041 TACTCACAGGTCCAAGAAGAAGG + Intronic
1165162130 19:33822827-33822849 TACTCACAGATCCCAGGTTTAGG + Intergenic
1165278290 19:34773373-34773395 TTCTCAAGGCTCCCAAGAAAGGG + Intergenic
1165364860 19:35359199-35359221 TGCTCACAGCTGCCAGGAAGAGG - Exonic
1165366679 19:35371668-35371690 TGCTCACAGCTGCCAGGAAGAGG - Exonic
1167534655 19:50041965-50041987 TCCCCCCAGCTCCCAGGACAAGG - Intronic
1167697791 19:51025316-51025338 CACTCAAAGCGCCCAGGACAGGG - Intronic
1168160161 19:54505118-54505140 TACTCACAGCTGCCAAGACCTGG - Intronic
1168547316 19:57264073-57264095 TACACACACTTCCCAAGAAAGGG - Intergenic
1202672834 1_KI270710v1_random:9120-9142 AACTCAGAGCTCCAAGGGAATGG - Intergenic
925255985 2:2488523-2488545 TACTCACAACACCCAAGATATGG - Intergenic
925340141 2:3130511-3130533 TACTCACAGGTGCCAGCAACTGG + Intergenic
926173490 2:10568978-10569000 TACTCACTAGTCCTAGGAAATGG - Intergenic
926247691 2:11133052-11133074 AACGGACAGCTCCTAGGAAAGGG - Exonic
926686578 2:15702948-15702970 TACTCACAGTTCCCAAAAAAGGG - Intronic
927300566 2:21507696-21507718 AACACACAGATCCCTGGAAAAGG + Intergenic
928214282 2:29348312-29348334 TGCTCACAGCTCTCTGGAGAGGG + Intronic
929976029 2:46635823-46635845 TACCCCCAGCTCTCAGGAATGGG + Intergenic
930092662 2:47542513-47542535 CCCTCAGAGCTCCCATGAAAGGG - Intronic
931364086 2:61603719-61603741 TGCTCACAGCCCCCTGGGAAAGG - Intergenic
931425161 2:62164231-62164253 TATTCACAACTTTCAGGAAAAGG + Intergenic
932346558 2:70999573-70999595 TTCTCACCACTCTCAGGAAATGG - Intergenic
932893852 2:75619558-75619580 TACTCGCAGCTCCCAAGAGAAGG - Intergenic
933264537 2:80168210-80168232 GCCTCACAGCTCTCAGAAAAGGG + Intronic
933629778 2:84642701-84642723 TACTCACACTTCCCATGAAATGG - Intronic
935019504 2:99216099-99216121 TACTCACGGATCCCCGGAGAGGG - Exonic
935469375 2:103438538-103438560 TACTCCCAGCTGCTAGGAATGGG - Intergenic
935496760 2:103791978-103792000 TACTCACAGCTTGCAGGAGGAGG + Intergenic
935620809 2:105128047-105128069 TCCTCACAGTTCCCAGGACGAGG + Intergenic
936255122 2:110904627-110904649 TACTCACAGTTCCCAAGAGAAGG + Intronic
936614325 2:114033076-114033098 TACTCACAGTTCCTAAGAGAAGG - Intergenic
937832365 2:126437802-126437824 TACCCACAGATCCCAAGAGAAGG + Intergenic
937887528 2:126910026-126910048 TACTCACAGATCCCAAGAGAAGG - Intergenic
937946535 2:127343680-127343702 TATTAACAGCACACAGGAAAGGG + Intronic
938107643 2:128544360-128544382 CACTCCCAGCTCCCAGCCAATGG - Intergenic
938129102 2:128695317-128695339 TACTTAGAGTTCCTAGGAAAGGG - Intergenic
938232568 2:129674313-129674335 TACCCCCTGCTCTCAGGAAATGG - Intergenic
938485976 2:131708931-131708953 TAATAACAGCTCCCTGGAAAAGG + Intergenic
939067847 2:137505739-137505761 TACTCACAGTTCCCAAGAGGAGG + Intronic
939453996 2:142409821-142409843 TACTCACAGTTCCCAAGAAGAGG + Intergenic
940174353 2:150862497-150862519 TACTCTCAGGTCCCAGAGAAGGG + Intergenic
940303349 2:152198929-152198951 TATTCACAGCTCTCAAGAGAAGG - Intergenic
940789664 2:158018813-158018835 TTCACAGAGCTCCTAGGAAAAGG - Intronic
941653471 2:168118541-168118563 TCCTCTCAGCTCCCAGTCAAAGG + Intronic
941773406 2:169366079-169366101 TATTCACAGATCCCAAGAGAAGG + Intergenic
943291577 2:186078845-186078867 TCCTCTCAGCTCCCAGTAAGAGG - Intergenic
945099864 2:206253907-206253929 TACTCACAGTCCCCAAGACACGG + Intergenic
945746358 2:213723759-213723781 GAAGCACAGCTCCCTGGAAATGG - Intronic
946096520 2:217279195-217279217 TACTCACAGCTCACAGGAGGAGG + Intergenic
946285932 2:218702625-218702647 TACTTGAAGCTCCCAGGACAAGG + Exonic
1169040763 20:2493539-2493561 TACTGACTGCCCCCAGAAAAAGG - Exonic
1169257872 20:4112392-4112414 CACCAACGGCTCCCAGGAAATGG - Intergenic
1169325664 20:4673557-4673579 TACTCACAGGTCCCAGAGACCGG + Intergenic
1169416807 20:5424160-5424182 TACTCACAGGTTCCAGGGACTGG + Intergenic
1169641346 20:7755999-7756021 GACACACAGCTGCCAGGAAATGG + Intergenic
1169817803 20:9676483-9676505 TTCACACAGTTCCCAGGAATAGG - Intronic
1170329246 20:15190635-15190657 TACTCACAGTTCCTAAGAAGAGG + Intronic
1170830208 20:19833159-19833181 TACTCACAGATCCCAAGAGGAGG - Intergenic
1171350849 20:24502039-24502061 CACTCACAGCTATCAGGACAGGG - Intronic
1171394066 20:24819705-24819727 TACTCAGGGCTCCCAGCACAAGG - Intergenic
1171480594 20:25453156-25453178 TGCTGACAGCTCCCAGGATCTGG + Exonic
1174502913 20:50998917-50998939 TACTCACAGTTCCCAAGAGGAGG + Intergenic
1174823896 20:53751401-53751423 AAGTCACAGCTAACAGGAAAAGG + Intergenic
1176634176 21:9173531-9173553 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1176639132 21:9281258-9281280 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1178782927 21:35623098-35623120 TACTCACAGATCTCAAGAGAAGG - Intronic
1179078003 21:38142418-38142440 TACTCACAGTTCCCAAGAGCAGG + Intronic
1179522148 21:41952805-41952827 TCCTCACAACTCCCGGGACAGGG - Intronic
1179725557 21:43339664-43339686 TTTTCACAGCTCCCAGGATTAGG - Intergenic
1180202622 21:46234599-46234621 TTCTCACAGCTCTCAGAAGAAGG + Intergenic
1180372439 22:12054101-12054123 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1180415907 22:12712918-12712940 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1180423178 22:12888765-12888787 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1180490163 22:15837699-15837721 TAATAACAGCTCCCTGGAAAAGG + Intergenic
1181443799 22:22953028-22953050 TACTCACAGATCTCAAGAAAAGG + Intergenic
1181997551 22:26894538-26894560 TACTCACAGTTCCCAAGAGGAGG - Intergenic
1182467120 22:30524279-30524301 TACTCACAGTTCCCAAGAGGAGG - Exonic
1182759083 22:32707588-32707610 TATTCCCAGTTCACAGGAAAGGG - Intronic
1183490155 22:38111708-38111730 TAGTCCCAGCCCCCAGGGAACGG + Exonic
1184964337 22:47958939-47958961 TACTCACAGTTCCCAAGAGGAGG + Intergenic
1185068560 22:48644141-48644163 TACACACTGCTCCCAGAAAAGGG - Intronic
1185109236 22:48891634-48891656 TCCTCAGAGATCCCAAGAAATGG - Intergenic
949312012 3:2710456-2710478 TACACAGAGCTTTCAGGAAAAGG - Intronic
950004771 3:9684655-9684677 TACTCACAGCCCACAAGGAAAGG - Exonic
950801344 3:15554165-15554187 TACTCAGAGTTCCCAAGAAGAGG - Intergenic
952136362 3:30426487-30426509 TCCTCCCAGCTCCCAGTCAAGGG - Intergenic
952865314 3:37851417-37851439 TACTCACAGATCCAAGAGAAGGG + Intergenic
953377040 3:42437246-42437268 TACTCACAGTTCCCAAGAGGAGG - Intergenic
954609937 3:51939037-51939059 TACCCCCAGCTCCCAGGAGCAGG - Intronic
954934137 3:54311452-54311474 TAGTCAAAGTTCCCAGAAAAGGG - Intronic
955925827 3:64004257-64004279 TCCTCAAACCTCCCAAGAAAAGG + Intergenic
957844175 3:85710015-85710037 ATCTCACAGCTCTCCGGAAATGG + Intronic
958490874 3:94770865-94770887 TACTCACACTACCCAGGATATGG + Intergenic
959650254 3:108744294-108744316 TACTCACAGATTCCAAGAGAAGG - Intronic
961387469 3:126530520-126530542 CAGCCACAGTTCCCAGGAAAGGG + Intronic
961872119 3:129996249-129996271 TACTCACAGGTCCCAAGAGGAGG + Intergenic
964077100 3:152705499-152705521 TACTCACAGTTCCAAGAGAAGGG + Intergenic
965381941 3:168000692-168000714 TTCTTACAGCTCTGAGGAAATGG + Intergenic
965792462 3:172404452-172404474 ACCTCACAGCTGCCTGGAAAAGG + Intergenic
966129705 3:176623644-176623666 TCTCCACAGTTCCCAGGAAAAGG + Intergenic
966785706 3:183620918-183620940 TACTCACAGTTCCTAAGAGAAGG + Intergenic
967438441 3:189478097-189478119 TATCCACAGCTCAGAGGAAAAGG - Intergenic
1202747763 3_GL000221v1_random:123761-123783 AACTCAGAGCTCCAAGGGAATGG - Intergenic
968605173 4:1532017-1532039 CACACACAGCTGCCAGGACAGGG - Intergenic
968920748 4:3521178-3521200 TTCCCCCAGCCCCCAGGAAAGGG - Intronic
970261236 4:14227090-14227112 TACTCATAGATCCCAAGAAGCGG - Intergenic
971297234 4:25407097-25407119 CACTCACAGCTCTCTTGAAAAGG + Intronic
972299746 4:37773466-37773488 TTCTCAAGGTTCCCAGGAAAGGG - Intergenic
972419846 4:38877063-38877085 CACTCACAGGTTCCAGGAATTGG + Intronic
974031324 4:56779311-56779333 TTCACACATCTCCCAGGGAATGG - Intergenic
976270223 4:83222717-83222739 TATTCACAGATCCCAAGAGAAGG - Intergenic
976449754 4:85174562-85174584 TACTCACAGTTCCCAGAGGAAGG - Intergenic
977297575 4:95227871-95227893 TACTACCAGCAGCCAGGAAATGG - Intronic
977827127 4:101546162-101546184 TAATCACAGATTCCAGGAACTGG + Intronic
978039007 4:104035359-104035381 TTCTCAGAGCTCTCAAGAAAAGG - Intergenic
978169363 4:105650645-105650667 TACTCACAGGTCCCAGAGAGAGG - Intronic
979349717 4:119629191-119629213 CACTCCCAGGCCCCAGGAAAAGG - Intergenic
979378858 4:119984503-119984525 TACTCATAGATCCCTAGAAACGG + Intergenic
980371232 4:131876323-131876345 TACTCACAGTTTCCAAGAGAAGG + Intergenic
982325474 4:154125012-154125034 TACTCCCAGATCCCGGGAAAGGG + Intergenic
983481914 4:168285481-168285503 TACAGACAGCTCCAATGAAATGG - Exonic
984530466 4:180909624-180909646 TACCCACAGGTCCCTGGAAGAGG - Intergenic
1202754029 4_GL000008v2_random:39671-39693 AACTCAGAGCTCCAAGGGAATGG + Intergenic
985590278 5:760999-761021 TACCAGCAGCTGCCAGGAAAAGG + Intronic
986168209 5:5293902-5293924 AGTTCAAAGCTCCCAGGAAAGGG - Intronic
986709923 5:10481278-10481300 TACTCCCAGTTCCCAGGAGGAGG + Intergenic
987434896 5:17883094-17883116 TATTCACATTTCTCAGGAAATGG + Intergenic
990001375 5:50897448-50897470 TTCTCTCAGCTCCCAGGACATGG - Intergenic
990288362 5:54323889-54323911 TGCTCAAACCTCTCAGGAAAAGG + Intergenic
992316211 5:75557906-75557928 TAATCCCAGCTACCAGGAAGTGG - Intronic
992466569 5:77011943-77011965 AATTCACAGCTCCCAAGAATAGG - Intergenic
993492769 5:88571959-88571981 TATTCACAGGTTCCAGGAATTGG + Intergenic
996390572 5:122956234-122956256 TGTTCACTGCTCCCAGGAAGCGG - Intronic
997424498 5:133794051-133794073 CACACCCATCTCCCAGGAAAGGG - Intergenic
999832425 5:155333249-155333271 TACTCACAGCTCCTGGGGATAGG - Intergenic
1001241650 5:170075949-170075971 TAATCCCAGCTCCCAAGAAGGGG - Exonic
1001489460 5:172145298-172145320 GACTCACAAATCCCAGGACAAGG + Intronic
1001978512 5:176021110-176021132 TACTCACAGATCCCAGAGAGAGG + Intronic
1002052325 5:176578073-176578095 TACAGCCTGCTCCCAGGAAATGG + Exonic
1002238905 5:177822652-177822674 TACTCACAGATCCCAGAGAGAGG - Intergenic
1003251094 6:4429754-4429776 TACTCACAGTTCCCAGGAGGAGG - Intergenic
1004104420 6:12652709-12652731 TACTTTTAGCTCCCAGGTAAAGG - Intergenic
1004302240 6:14469118-14469140 TACTTACAGATCCCAGAGAAAGG - Intergenic
1004320738 6:14629735-14629757 AACTCACTGCTCCCATGACACGG + Intergenic
1004560455 6:16744492-16744514 TACCCACTGCTCCCAGGACAGGG + Intronic
1004607894 6:17211048-17211070 TCCTTGCAGCTCCCAGAAAATGG - Intergenic
1005217481 6:23548067-23548089 TGCTCACAGGCCCCAGGAGATGG + Intergenic
1009558793 6:65211219-65211241 TATTCATATCTCCTAGGAAAGGG + Intronic
1009995506 6:70891025-70891047 TACTGACACCTCCCTGGAAGTGG + Intronic
1011255153 6:85413409-85413431 TAATCACAGCACCCAGAAAGTGG - Intergenic
1012291871 6:97466190-97466212 TGCCGAGAGCTCCCAGGAAAGGG + Intergenic
1013635837 6:112028492-112028514 TACTCAAAGCTCCCACGAGGAGG - Intergenic
1013742577 6:113305289-113305311 TGCTCACAGTTCCCAAGAGAAGG + Intergenic
1014143244 6:117967752-117967774 TAGACACAGCTACCAAGAAAGGG + Intronic
1014474305 6:121853948-121853970 TACTCTCAGATCCCAAGAGAAGG + Intergenic
1014961921 6:127696620-127696642 TATTCAAACCCCCCAGGAAATGG - Intergenic
1015220038 6:130794181-130794203 TACTCACAGTTCCCAAGAGGAGG + Intergenic
1017837725 6:158194331-158194353 TTCTCTCAGCTCCGAGGAAGGGG + Exonic
1018284836 6:162226339-162226361 TATCCACAGCACCCAGGAAGGGG - Intronic
1018744842 6:166754304-166754326 TACTCACAGATCCCAAGAGAGGG + Intronic
1018830496 6:167438847-167438869 TATTCACAGCCTCCAGGAATTGG + Intergenic
1019443892 7:1061033-1061055 CACGCTGAGCTCCCAGGAAAGGG + Intronic
1019815173 7:3194715-3194737 TACTCACAGTTCCCAGGAGGAGG + Intergenic
1020838457 7:13184619-13184641 TACTCATAGTCTCCAGGAAAAGG + Intergenic
1020930884 7:14392303-14392325 TACTGACAACTCCCAGATAAAGG - Intronic
1020975450 7:15000473-15000495 TTCTAACAGCTCCCAGGTTATGG + Intergenic
1021399948 7:20198255-20198277 TTTTCCCAGCTCCCATGAAAGGG - Intronic
1021594087 7:22296306-22296328 TACTCACAGTTCCCAAGAGAAGG + Intronic
1021977062 7:26021086-26021108 AACTCCCAACTTCCAGGAAAGGG + Intergenic
1022062538 7:26812277-26812299 TACTCTCATTTCCCAGTAAAAGG - Intronic
1022089235 7:27096833-27096855 AACTCAGAGCTCGCCGGAAAAGG + Intergenic
1022639829 7:32171127-32171149 TACCCACAGTTCCCAGGAGAGGG - Intronic
1022810303 7:33861779-33861801 TACTCACAGATCCCAAGAGAAGG + Intergenic
1023535743 7:41207386-41207408 TACTCACAGGTCCCAGAACAGGG - Intergenic
1024118310 7:46213285-46213307 TACTCACAGTTCCTAAGAGAAGG + Intergenic
1024352500 7:48381155-48381177 TACTCACAGACCCCAAGAGAAGG - Intronic
1024670571 7:51590050-51590072 TTCTCACAGATCCCAAGAAGAGG - Intergenic
1024908577 7:54419197-54419219 TTCTCACAGGTCCTAAGAAAAGG - Intergenic
1026538731 7:71261949-71261971 TGCTCACGGCTCCCGGGAAGAGG - Intronic
1026795672 7:73364495-73364517 TAGACACAGTCCCCAGGAAAGGG + Intergenic
1027851353 7:83456277-83456299 TACTCACATCTCAAAGAAAATGG - Intronic
1028021647 7:85783414-85783436 TACTCACAACTGCCATGATATGG - Intergenic
1029278087 7:99419499-99419521 TGCTCGCTGCTCCCAGGAAGGGG - Exonic
1029549118 7:101227586-101227608 TCCTCTGTGCTCCCAGGAAAGGG - Intergenic
1030745998 7:113167192-113167214 TACTCACAGATCCCAAGAGAAGG + Intergenic
1032256446 7:130300899-130300921 CACTTACAGCTTCCAGGGAATGG - Exonic
1032297202 7:130650285-130650307 TATTCACAGGTCCTAGGAATTGG + Intronic
1033000803 7:137502313-137502335 TACTCCCAGATCGCAGGCAATGG - Intronic
1033284298 7:140027142-140027164 GACACACAGCTCCCAGCACATGG + Intronic
1033616214 7:143016965-143016987 TACTATCAGCTCCCAGTCAAGGG + Intergenic
1034845080 7:154437082-154437104 TAGTCACAGGTACCAGGGAATGG - Intronic
1035462990 7:159056804-159056826 CTCTCACAGCTCTCAGGAAGTGG + Intronic
1036728703 8:11243122-11243144 TACTCACAGTTCCCAAGAGAAGG + Intergenic
1037574102 8:20184707-20184729 TACTCACAGGTTCCAGGATTAGG + Intergenic
1038496188 8:28004885-28004907 TACTCACAGTTCCCTAGAGAAGG + Intergenic
1038698997 8:29832271-29832293 TACTCACAGTTCCCAAGACTGGG + Intergenic
1039038991 8:33389062-33389084 TTCTGACAGCTCTCAGGGAACGG - Exonic
1039302059 8:36220235-36220257 TACTCATAGTTCCCAAGAGAAGG - Intergenic
1039996271 8:42536525-42536547 TACTGTCAGCTCCCAACAAAAGG + Intronic
1040697045 8:50012638-50012660 TACTCACAGTTCCCTAGAAGAGG + Intronic
1040994298 8:53386715-53386737 TACTCACAGCTCCCTGGCCAGGG + Intergenic
1041005315 8:53492448-53492470 AACTCACAGATCCCAAGAGAGGG + Intergenic
1041219077 8:55631380-55631402 TACTCAAAGTTCCCAGGAAGAGG + Intergenic
1041405987 8:57500208-57500230 TACACACAGCTCTCAAGGAAGGG + Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1042157272 8:65858011-65858033 TACTCAGTGAACCCAGGAAATGG - Intergenic
1042803570 8:72747082-72747104 TACTCACAGATCCCTAGAAATGG + Intronic
1042841375 8:73127182-73127204 TACTCACAGGTTCCAGGTATTGG + Intergenic
1044664723 8:94623380-94623402 AACTCCCAGCCTCCAGGAAAGGG - Intergenic
1046035518 8:108836312-108836334 AACTCACAGCTACCATGGAATGG + Intergenic
1047319252 8:123764205-123764227 AACTGACAGCTTCCATGAAAGGG + Intergenic
1047746177 8:127846653-127846675 TAAAGACAGCTCACAGGAAAGGG + Intergenic
1047957014 8:129984017-129984039 TACAGACAGCTCCCAGGTGATGG + Intronic
1048627125 8:136197502-136197524 TAGACACAGCTCCCACGAGAGGG + Intergenic
1049071456 8:140358871-140358893 TGCTCACTGCTCCCAGGAAAGGG - Intronic
1049743220 8:144250869-144250891 ACCTCCCAGCTCCCAGCAAAGGG + Intronic
1050017856 9:1254312-1254334 TTCTCACTGCTACGAGGAAAAGG + Intergenic
1050019588 9:1269392-1269414 TGGTCTCAGCTCCCAGAAAAGGG - Intergenic
1050426710 9:5519007-5519029 TACTCACAGATCCCAAGAGAAGG + Intronic
1050668458 9:7968245-7968267 TACTCACAGATCCCAAGAGGAGG - Intergenic
1051980568 9:23010371-23010393 TATTCACAGTTCCCAAGATATGG - Intergenic
1053228087 9:36379341-36379363 TTCTCACAGTTTCCAGAAAAGGG + Intronic
1054710855 9:68509559-68509581 TACTCACAGTTCCCAAGAGGAGG + Intronic
1055283008 9:74696648-74696670 TACTCACAGTTTCCAAGAGAAGG + Intergenic
1056117031 9:83450634-83450656 GACCCTCAGCTCCCTGGAAAGGG + Intronic
1057199002 9:93130501-93130523 TCCTCACAGGCCCCTGGAAAGGG - Intronic
1060278074 9:122197388-122197410 TAATCACAACTCCCAGGATCTGG + Intronic
1060797539 9:126522768-126522790 CAGTCTGAGCTCCCAGGAAATGG + Intergenic
1061116694 9:128617912-128617934 GTCTCGAAGCTCCCAGGAAAAGG - Intronic
1061219009 9:129238067-129238089 CACTCACAGCTCCAGGGAACAGG - Intergenic
1061744234 9:132727974-132727996 TACTCACAGCTCCCAGGAAAAGG - Intronic
1203757015 Un_GL000218v1:141167-141189 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1203716398 Un_KI270742v1:153842-153864 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1203534817 Un_KI270743v1:24397-24419 AACTCAGAGCTCCAAGGGAATGG + Intergenic
1203650626 Un_KI270751v1:117397-117419 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1185726428 X:2425768-2425790 TACTCACAGGTCCCAAGAGGAGG + Intronic
1186586229 X:10876153-10876175 TACTCACAGTTTCCAAGAGAGGG + Intergenic
1187435785 X:19267853-19267875 TACTCACAGATCCCAAGAGGAGG + Intergenic
1187556625 X:20358099-20358121 TATTCACAGCAGCCAGGGAATGG - Intergenic
1188346528 X:29073146-29073168 TCCTCAAGGCTCACAGGAAAAGG - Intronic
1188685052 X:33059440-33059462 TGGGCACAGCTACCAGGAAAAGG + Intronic
1189161521 X:38813976-38813998 TACTCACAGGTTCCAGTGAATGG - Intergenic
1191680830 X:63838387-63838409 TAATCACAGATTCCAGGCAATGG + Intergenic
1192757528 X:74062133-74062155 TACTCACAGATCACAAGAAGAGG - Intergenic
1194722467 X:97356293-97356315 TATTCCCAGCTCCTAGGAAAAGG - Intronic
1195671988 X:107477589-107477611 TCCTGACAGATCCCAGTAAAAGG + Intergenic
1196272387 X:113727648-113727670 TACTTTCAGCTCCCAGCAAAAGG - Intergenic
1197029437 X:121796351-121796373 GTCTCACATCTCCCAGGAAAGGG + Intergenic
1200031310 X:153298142-153298164 CCCTCCCAGCACCCAGGAAAGGG + Intergenic
1200104162 X:153703204-153703226 TGCTCCCAGCTCCTAGGCAAAGG + Intronic
1201170594 Y:11258791-11258813 AACTCAGAGCTCCAAGGGAATGG - Intergenic
1201513132 Y:14787473-14787495 TGCTCACTGCTCCCAGTAGAGGG + Intronic
1201632594 Y:16085597-16085619 TACTCACAATTGCCAGGAGATGG + Intergenic