ID: 1061746071

View in Genome Browser
Species Human (GRCh38)
Location 9:132741117-132741139
Sequence TGCCGTGACCTGGCACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061746071_1061746079 14 Left 1061746071 9:132741117-132741139 CCAGTCTGTGCCAGGTCACGGCA 0: 1
1: 0
2: 0
3: 25
4: 232
Right 1061746079 9:132741154-132741176 AGCTCTCAGGTGCAGGTATGGGG No data
1061746071_1061746075 7 Left 1061746071 9:132741117-132741139 CCAGTCTGTGCCAGGTCACGGCA 0: 1
1: 0
2: 0
3: 25
4: 232
Right 1061746075 9:132741147-132741169 CACCAGCAGCTCTCAGGTGCAGG No data
1061746071_1061746080 20 Left 1061746071 9:132741117-132741139 CCAGTCTGTGCCAGGTCACGGCA 0: 1
1: 0
2: 0
3: 25
4: 232
Right 1061746080 9:132741160-132741182 CAGGTGCAGGTATGGGGCACAGG No data
1061746071_1061746078 13 Left 1061746071 9:132741117-132741139 CCAGTCTGTGCCAGGTCACGGCA 0: 1
1: 0
2: 0
3: 25
4: 232
Right 1061746078 9:132741153-132741175 CAGCTCTCAGGTGCAGGTATGGG No data
1061746071_1061746074 1 Left 1061746071 9:132741117-132741139 CCAGTCTGTGCCAGGTCACGGCA 0: 1
1: 0
2: 0
3: 25
4: 232
Right 1061746074 9:132741141-132741163 CATCTGCACCAGCAGCTCTCAGG No data
1061746071_1061746077 12 Left 1061746071 9:132741117-132741139 CCAGTCTGTGCCAGGTCACGGCA 0: 1
1: 0
2: 0
3: 25
4: 232
Right 1061746077 9:132741152-132741174 GCAGCTCTCAGGTGCAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061746071 Original CRISPR TGCCGTGACCTGGCACAGAC TGG (reversed) Intronic
900787357 1:4656957-4656979 TGCTGAGACCTGGGACAGTCCGG - Intronic
901005205 1:6168377-6168399 AGCTGTGACCTGGCACAGTTGGG - Intronic
901230183 1:7637412-7637434 GGCCGTGCCCAGGCACAGGCAGG + Intronic
901644804 1:10710604-10710626 AGCCCTGAGCTGGCAGAGACTGG - Intronic
902994357 1:20212253-20212275 TGCCGTGACCTGGATGAAACAGG - Intergenic
903237152 1:21957368-21957390 TGCTGTGACCTGGGGCAAACAGG + Intergenic
904285320 1:29450057-29450079 AGCCCTGGCCTGGCACAGACAGG + Intergenic
906131379 1:43460419-43460441 TGCAGTGACCTGGATGAGACTGG + Intergenic
907349676 1:53817332-53817354 TGCAGTGACCTGGATGAGACTGG + Intronic
909639318 1:77854184-77854206 TGCAGTGACCTGGATGAGACTGG - Intronic
909960815 1:81839675-81839697 TGCAGTGACCTGGATGAGACTGG - Intronic
910048850 1:82953150-82953172 TGCAGTGACCTGGATGAGACTGG - Intergenic
910667229 1:89738891-89738913 TGCCCTGACCAGGCAGAGCCTGG - Intronic
914968438 1:152283301-152283323 TGCAGTGACCTGGTTGAGACTGG + Intergenic
916581101 1:166109965-166109987 TGCAGTGACCTGGATGAGACTGG + Intronic
917053723 1:170955107-170955129 TGCAGTGACCTGGTTGAGACTGG - Intronic
917751665 1:178058774-178058796 CCCACTGACCTGGCACAGACTGG + Intergenic
920190661 1:204191675-204191697 CTCCGTGCCCTGGCACAGTCTGG + Intronic
922794173 1:228331340-228331362 TGCAGTGACCTGGATGAGACTGG - Intronic
923648712 1:235851249-235851271 TGCAGTGACCTGGATGAGACTGG + Intronic
923808271 1:237284402-237284424 TGCAGTGACCTGGATGAGACTGG - Intronic
924320937 1:242849460-242849482 TGCAGTGACCTGGATGAGACTGG - Intergenic
1063542472 10:6948188-6948210 TGCAGTGACCTGGATAAGACTGG + Intergenic
1065020988 10:21501294-21501316 TTCAGTGACCTGGGACAGAGAGG + Intergenic
1065892454 10:30132771-30132793 TGCCTGGACCTGGAGCAGACAGG - Intergenic
1066323265 10:34327205-34327227 TGCCCTGACCTGTCAAACACAGG + Intronic
1067450557 10:46379640-46379662 TGCAGTCAGATGGCACAGACAGG + Intronic
1067586686 10:47480111-47480133 TGCAGTCAGATGGCACAGACAGG - Intronic
1069782005 10:70962803-70962825 TGGCGTTACCTGGCTCAGCCAGG - Intergenic
1070184456 10:74047389-74047411 TGCCTTGACTTGGAAAAGACAGG + Intronic
1070484716 10:76919003-76919025 TGCAGTGACCTGGATGAGACTGG + Intronic
1071485139 10:86096043-86096065 TGCAGTGACCTGGATGAGACTGG + Intronic
1072815423 10:98503709-98503731 TGCAGTGACCTGGTTGAGACTGG + Intronic
1074985332 10:118653347-118653369 TGCAGTGACCTGGATGAGACTGG - Intergenic
1075121498 10:119667987-119668009 TGCCGTGAGATGGCCCTGACAGG - Intronic
1075660136 10:124187779-124187801 TGCAGTGACCTGGATGAGACTGG - Intergenic
1076537957 10:131195070-131195092 TGCTGGGACCTGGAACAGCCTGG - Intronic
1077187987 11:1243958-1243980 TGCCGTGCCCAGGCCCAGCCTGG + Exonic
1077188413 11:1245629-1245651 TGCCGTGCCCAGGCCCAGCCTGG + Exonic
1077188943 11:1247729-1247751 TGCCGTGCCCAGGCCCAGCCTGG + Exonic
1077189369 11:1249400-1249422 TGCCGTGCCCAGGCCCAGCCTGG + Exonic
1077265516 11:1647133-1647155 TGCTGAGACCTGGCACGGATGGG + Intergenic
1077890439 11:6414453-6414475 TGCCGTGTGCCGACACAGACTGG + Intronic
1078997001 11:16712012-16712034 TGCAGTGACCTGGCTGAGATTGG - Intronic
1079027692 11:16961688-16961710 TGCTGTGACCTTCCACACACCGG - Intronic
1082638916 11:55630599-55630621 TGCTGTGACCTGGATGAGACTGG + Intergenic
1083996337 11:66274857-66274879 TTCAGTGACCTGGCACATGCTGG + Intronic
1085834734 11:79940533-79940555 TGCTGTGACCTGGGATAGAATGG - Intergenic
1088223964 11:107598731-107598753 TGCCACCACCAGGCACAGACTGG - Intronic
1088916441 11:114231416-114231438 AGCCCTCACCTGGCACAGAGAGG + Intronic
1089825763 11:121275300-121275322 TGCAGTGACCTGGATGAGACTGG - Intergenic
1089879301 11:121758169-121758191 GGCCGTGACCAGGGACAGACAGG - Intergenic
1090537604 11:127661446-127661468 TGCAGTGACCTGGATGAGACTGG - Intergenic
1090757819 11:129809555-129809577 TGCAGTGACCTGGATGAGACTGG + Intergenic
1091950036 12:4585068-4585090 TGCGGTGACATGCCACAGGCAGG - Intronic
1093488297 12:19676799-19676821 TGCAGTGACCTGGTTGAGACTGG - Intronic
1097295990 12:57963615-57963637 TGCAGTGACCTGGATGAGACTGG + Intergenic
1097385384 12:58944560-58944582 TGCAGTGACCTGGATGAGACTGG - Intergenic
1102215761 12:111160523-111160545 TCGCGTGACCCGGCACAGAGGGG + Intronic
1103111833 12:118286913-118286935 TGCAGTGACCTGGATGAGACTGG + Intronic
1104333032 12:127865719-127865741 TGCAGTGACCTGGATGAGACTGG + Intergenic
1111988895 13:95095385-95095407 TGCAGTGACCTGGATGAGACTGG + Intronic
1111993770 13:95142275-95142297 TGCAGTGACCTGGATGAGACTGG + Intronic
1112034974 13:95488660-95488682 TGCAGTGACCTGGATAAGACTGG - Intronic
1112489625 13:99849821-99849843 TGCCTTGCCCTGGCCCTGACTGG - Intronic
1112738603 13:102449268-102449290 TGCAGTGACCTGGATGAGACTGG + Intergenic
1112973410 13:105287814-105287836 TGACATGACCTGGCTCAGTCAGG + Intergenic
1113182772 13:107650428-107650450 TGCAGTGACCTGGATGAGACTGG + Intronic
1118197110 14:63637649-63637671 TGCCATGACCTGGATGAGACTGG + Intronic
1119947242 14:78707849-78707871 TGCAGTGACCTGGATAAGACTGG - Intronic
1120059165 14:79961424-79961446 TGCCATGAATTGGCACAGCCTGG - Intergenic
1120489928 14:85164656-85164678 TGCAGTGACCTGGATGAGACTGG + Intergenic
1121460457 14:94072297-94072319 TGCAGTGACCTGGATGAGACTGG + Intronic
1202840189 14_GL000009v2_random:114346-114368 TGCCCTGAGCTTGCACAAACCGG - Intergenic
1202909572 14_GL000194v1_random:104543-104565 TGCCCTGAGCTTGCACAAACTGG - Intergenic
1202857176 14_GL000225v1_random:58753-58775 TCCCCTCTCCTGGCACAGACTGG - Intergenic
1124557603 15:30741699-30741721 TGCAGTGACCTGGATGAGACTGG + Intronic
1124673642 15:31663968-31663990 TGCAGTGACCTGGATGAGACTGG - Intronic
1125412387 15:39418780-39418802 TGCAGTGACCTGGATGAGACTGG - Intergenic
1126460298 15:48907704-48907726 TGCAGTGACCTGGATGAGACTGG - Intronic
1126488071 15:49204995-49205017 TGCAGTGACCTGGATGAGACTGG - Intronic
1126578036 15:50216942-50216964 TGCAGTGACCTGGATGAGACTGG + Intronic
1126731578 15:51688851-51688873 TGCCCTGACCTGGCCCTGACAGG + Intronic
1127858327 15:62971431-62971453 TCCCGGGACCTGGCAGAGAGGGG + Intergenic
1128544399 15:68557469-68557491 TGCCATGACCTTGGATAGACTGG - Intergenic
1129096427 15:73213564-73213586 TGCAGTGACCTGGATGAGACTGG - Intronic
1129739496 15:77983397-77983419 TGGCGGGACCTGGAACTGACTGG + Intergenic
1132333923 15:101031050-101031072 TGCAGTGACCTGGAGGAGACGGG - Intronic
1132346627 15:101112637-101112659 TGTCACGACCTGGCACAGCCTGG - Intergenic
1132435430 15:101797508-101797530 TGCAGTGACCTGGATGAGACTGG + Intergenic
1134065962 16:11228421-11228443 AGCTCTGACCTGGCACAGTCAGG - Intergenic
1134202889 16:12213606-12213628 TGCTGTGACCTTCCACAGCCTGG - Intronic
1134689061 16:16179025-16179047 TGCCCTGACCTGCCACAGCCTGG - Intronic
1137512326 16:49112454-49112476 TGCCCTGACCTGCCTCAGAGTGG - Intergenic
1138444508 16:57055018-57055040 TGCAGGGACCTGGATCAGACAGG - Exonic
1139145530 16:64320163-64320185 TGCAGTGACCTGGATGAGACTGG - Intergenic
1140606351 16:76543729-76543751 TGCTGTGACCTGCCACTGGCTGG + Intronic
1140824852 16:78696251-78696273 TCCCGTGATGTGGCAAAGACAGG - Intronic
1141711380 16:85701186-85701208 TGGCAGGACCTGGCACAGAGGGG + Intronic
1141889180 16:86915209-86915231 TTCCTTGACTTGGCACAGCCGGG - Intergenic
1142485506 17:245490-245512 TGCCCTGACTTGGAGCAGACGGG + Intronic
1142641075 17:1286267-1286289 GGAGGTGACCAGGCACAGACAGG + Intronic
1146124357 17:30220171-30220193 TCCCGTGACCTAACACAGAGTGG - Intronic
1146266742 17:31457942-31457964 TGCTGAGACCTGGGTCAGACTGG - Intronic
1147122065 17:38341455-38341477 AGCCCTGACCTGGCACTGCCTGG + Intronic
1147311010 17:39596232-39596254 AGCCCAGGCCTGGCACAGACAGG + Intergenic
1151048867 17:70953383-70953405 TGCAGTGACCTGGATGAGACTGG + Intergenic
1151321039 17:73352464-73352486 GGCCGGTACCTGGCACAGACTGG + Exonic
1156598071 18:38570808-38570830 TTCCCTGACCTGTCACAGAATGG - Intergenic
1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG + Intronic
1160215704 18:76928017-76928039 TGCCAGGACCTGGCTCAGGCTGG - Exonic
1160653518 19:246966-246988 TGCCGTGCCCCGGCACCGGCAGG - Intergenic
1160691755 19:463601-463623 TGGCGTGACCTGGAAGAAACTGG + Exonic
1161377905 19:3949617-3949639 TCCCGGGGCCTGGGACAGACAGG + Intergenic
1161806742 19:6448279-6448301 TGCCTAGCCCAGGCACAGACTGG + Intronic
1162105294 19:8366487-8366509 AGCCCTGACCTGGCCCAGCCAGG + Intronic
1164777526 19:30864565-30864587 TGACCTGACCCAGCACAGACAGG + Intergenic
1166863128 19:45821106-45821128 TGCTGTGCCCTGGCACAGAGTGG - Intronic
1167181262 19:47905549-47905571 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167181926 19:47910916-47910938 TGCAGTGACCTGGATGAGACCGG - Intergenic
1167182577 19:47916299-47916321 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167183247 19:47921649-47921671 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167183892 19:47926685-47926707 TGCAGTGACCTGGATGAGACCGG - Intergenic
1167184542 19:47932051-47932073 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167185214 19:47937400-47937422 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167185868 19:47942792-47942814 TGCCGTGACCTGGATGAGACCGG - Intergenic
1167186532 19:47948153-47948175 TGCAGTGACCTGGATGAGACCGG - Intergenic
1167187184 19:47953542-47953564 TGCAGTGACCTGGATGAGACCGG - Intergenic
1167187832 19:47958922-47958944 TGCAGTGACCTGGATGAGACCGG - Intergenic
1167542005 19:50094713-50094735 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167543985 19:50109248-50109270 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167544660 19:50114602-50114624 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167545335 19:50119952-50119974 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167546012 19:50125304-50125326 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167546689 19:50130639-50130661 TGCCGTGACCTGGATGAGACCGG + Intergenic
1167547346 19:50135981-50136003 TGCCGTGACCTGGATGAGACCGG + Intergenic
1168545652 19:57247688-57247710 TGCCTTGACCTGGCACTTTCTGG + Intronic
1202632855 1_KI270706v1_random:16211-16233 TGCCCTGAGCTTGCACAAACTGG + Intergenic
1202653023 1_KI270707v1_random:23838-23860 TGCCCTGAGCTTGCACAAACCGG - Intergenic
1202659132 1_KI270708v1_random:51907-51929 TGCCCTGAGCTTGCACAAACCGG + Intergenic
926797709 2:16632426-16632448 TCCCCTGAGGTGGCACAGACAGG - Intronic
932095943 2:68848529-68848551 TGCAGTGACCTGGACGAGACTGG + Intergenic
932449177 2:71798768-71798790 TGCCAAGTCCTGGCACATACAGG + Intergenic
933811467 2:86035393-86035415 AGTCCTGACCTGCCACAGACTGG + Intronic
935104418 2:100026776-100026798 TGCAGTGACCTGGATAAGACTGG + Intronic
939907899 2:147940704-147940726 TGCAGTGACCTGGATGAGACTGG + Intronic
941681185 2:168401346-168401368 TGCTGTGAGCTAGCACAGCCTGG + Intergenic
943890824 2:193284756-193284778 TGCTGTGACCTGGATGAGACTGG - Intergenic
944205035 2:197149557-197149579 TTTAGTGACATGGCACAGACAGG + Intronic
947635344 2:231677903-231677925 TCCCAGGACCTGGCACAAACGGG - Intergenic
947885264 2:233564368-233564390 TGCCTTCACCTGGCCCTGACTGG - Intronic
1169643754 20:7785660-7785682 TGCAGTGACCTGGATGAGACTGG + Intergenic
1171238793 20:23548573-23548595 TGGCGTGACATGGCAGAGTCAGG + Intergenic
1172993209 20:39050809-39050831 TGGGGTGACCTGGGACAGTCTGG - Intergenic
1174600778 20:51723096-51723118 TGCAGTGACCTGGATGAGACTGG + Intronic
1176599128 21:8775813-8775835 TGCCCTGAGCTTGCACAAACCGG + Intergenic
1176645074 21:9342091-9342113 TGCCCTGAGCTTGCACAAACTGG + Intergenic
1176952520 21:15064481-15064503 TGCCCAGAACTGGCACGGACGGG + Intronic
1178054960 21:28788370-28788392 TGCAGTGACCTGGATGAGACTGG + Intergenic
1178059927 21:28841513-28841535 TGCAGTGACCTGGATGAGACTGG + Intergenic
1180326591 22:11435431-11435453 TGCCCTGAGCTTGCACAAACCGG + Intergenic
1180367879 22:11957143-11957165 TGCCCTGAGCTTGCACAAACTGG - Intergenic
1180378210 22:12114193-12114215 TGCCCTGAGCTTGCACAAACTGG + Intergenic
1180419299 22:12799088-12799110 TGCCCTGAGCTTGCACAAACCGG - Intergenic
1180600134 22:17010075-17010097 TGCAGTGACCTCGTACCGACTGG + Intergenic
1181014508 22:20061475-20061497 TGCCCTGACATGGCACAGCAGGG + Intronic
1183329983 22:37214163-37214185 TTCAGTGGCCTGGCTCAGACGGG - Intergenic
1183521913 22:38300549-38300571 TTCCGTGTCCTTGCACAGTCGGG - Intronic
949878428 3:8642245-8642267 TGCAGTGTCCTAGCACAGAGCGG - Intronic
950076326 3:10189775-10189797 TGTCTGGACCTGGCACAGCCCGG - Intronic
951852472 3:27157026-27157048 TGCAGTGACCTGGATGAGACTGG + Intronic
954710291 3:52502078-52502100 AGCCCTTACCTGGCACACACAGG - Exonic
957095250 3:75771953-75771975 TGCCCTGAGCTTGCACACACCGG - Intronic
958778465 3:98513286-98513308 AGCTGTGTCCTGGCACAGATGGG - Intronic
964190432 3:153994245-153994267 TGCAGTGACCTGGATGAGACTGG + Intergenic
964418577 3:156476441-156476463 TGCAGTGACCTGGATGAGACTGG - Intronic
964430181 3:156597501-156597523 TGCAGTGACCTGGATGAGACTGG + Intergenic
967143791 3:186588373-186588395 TTGAGTGACCTGGCACAGCCTGG - Intronic
1202741817 3_GL000221v1_random:62977-62999 TGCCCTGAGCTTGCACAAACTGG - Intergenic
970658166 4:18254822-18254844 TGCAGTGACCTGGATGAGACTGG - Intergenic
973362489 4:49178185-49178207 TGCCCTGAGCTTGCACAAACCGG + Intergenic
973398612 4:49618676-49618698 TGCCCTGAGCTTGCACAAACTGG - Intergenic
973782963 4:54306876-54306898 TGCAGTGACCTGGATGAGACTGG + Intergenic
976751207 4:88452759-88452781 TGCCTTTACCTGGCACTGGCTGG - Intergenic
976856804 4:89613799-89613821 TGCAGTGACCTGGATGAGACTGG + Intergenic
978128824 4:105168882-105168904 TGCAGTGACCTGGATAAGACTGG - Intronic
979269590 4:118744345-118744367 AGCACGGACCTGGCACAGACTGG - Intronic
981825315 4:148934114-148934136 TGCAGTGACCTGGATAAGACTGG + Intergenic
981991150 4:150922463-150922485 TGCAGTGACCTGGATAAGACTGG + Intronic
982119133 4:152123638-152123660 TGCAGTGACCTGGATGAGACTGG - Intergenic
982218292 4:153101754-153101776 TGCAGTGACCTGGATGAGACTGG - Intergenic
982999655 4:162398218-162398240 TGCAGTGACCTGGATGAGACTGG + Intergenic
983043990 4:162964208-162964230 TGCCGTGATCTCGCCCAGGCTGG + Intergenic
984527059 4:180870140-180870162 TGCAGTGACCTGGGTGAGACTGG - Intergenic
985008205 4:185555621-185555643 TGCAGTGACCTGGATGAGACTGG - Intergenic
1202759829 4_GL000008v2_random:99658-99680 TGCCCTGAGCTTGCACAAACTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
988902709 5:35751164-35751186 TGCAGTGACCTGGATGAGACTGG + Intronic
990413941 5:55568043-55568065 TGCAGTGACCTGGATGAGACTGG - Intergenic
991958589 5:72019931-72019953 TCCCATGACCTAGAACAGACTGG + Intergenic
995955872 5:117775857-117775879 TGCAGTGACCTGGCTGAGATCGG + Intergenic
996325888 5:122272914-122272936 TGCAGTGACCTGGCTGAGAATGG + Intergenic
999190560 5:149743871-149743893 AGCCATGCCCTGGAACAGACTGG - Intronic
999285958 5:150394419-150394441 TGCCATGCCTTGACACAGACTGG - Intronic
1000643236 5:163730538-163730560 TCCTGTGACCTGGCACAGGCTGG + Intergenic
1001299463 5:170523524-170523546 TGCCATGTCCTGGCCCAGCCAGG - Intronic
1002097871 5:176842556-176842578 TGCAGTGACCTGGATGAGACTGG + Intronic
1003582492 6:7353788-7353810 TGCAGTGACCTGGATGAGACTGG + Intronic
1006395069 6:33781937-33781959 TGCCCTGACCCAGCACAGCCTGG + Intronic
1006722548 6:36166966-36166988 TGCAGTGACCTGGATGAGACTGG + Intergenic
1007364961 6:41384780-41384802 TGCCCTGACCTGGCATAGATGGG - Intergenic
1007480379 6:42145777-42145799 TGCCGTGACCTCCCACACACTGG - Intergenic
1008220604 6:48850047-48850069 TGCAGTGACCTGGATGAGACTGG + Intergenic
1008710808 6:54224879-54224901 TGCAGTGACCTGGATGAGACTGG - Intronic
1015566035 6:134572703-134572725 TGCAGTGACCTGGATGAGACTGG + Intergenic
1015626928 6:135188929-135188951 TGCCTTGACTTGGCACACAGAGG + Intronic
1018380067 6:163250956-163250978 TGCAGTGACCTGGATGAGACTGG + Intronic
1019592947 7:1844701-1844723 TGCTGTGGCTTGGCACAGGCCGG + Intronic
1023931387 7:44708547-44708569 TGGCCTGACCTGGCACAGAAAGG + Exonic
1024362263 7:48480471-48480493 TGCTCTGCCCTGCCACAGACCGG - Intronic
1024916759 7:54509948-54509970 TGCTGTGACCTGGATGAGACTGG - Intergenic
1027181941 7:75946941-75946963 TGCAGTGCCCTGGCACAGTTTGG - Intronic
1029000069 7:97143599-97143621 TGCAGTGACCTGGATGAGACTGG - Intronic
1038463506 8:27737959-27737981 TGCAGTGACCTGGATGAGACTGG + Intronic
1046369561 8:113283933-113283955 TGCAGTGACCTGGATGAGACTGG + Intronic
1047407481 8:124597511-124597533 TGCAGAGACCTGGCAGCGACAGG + Intronic
1049099157 8:140567031-140567053 TGCTGTGCCCTGGCACGGATCGG + Intronic
1049553833 8:143272630-143272652 TGTGGAGACCTGGCACAGCCTGG + Intronic
1049553919 8:143273026-143273048 GGCCATGCCCTGGCACTGACAGG - Intronic
1050503277 9:6321339-6321361 TGCAGTGACCTGGCTGAGATTGG + Intergenic
1052895505 9:33744073-33744095 TGCAGTGACCTGGATGAGACTGG + Intergenic
1053222782 9:36325858-36325880 TGCGGAGGCCTGGCAGAGACAGG - Intergenic
1058622713 9:106900136-106900158 TGCAGTGACCTGGATAAGACTGG - Intronic
1058771230 9:108234377-108234399 TGCAGTGACCTGGATGAGACTGG + Intergenic
1059499752 9:114741494-114741516 TGCAGTGACCTGGATGAGACTGG + Intergenic
1061227878 9:129291224-129291246 GGCCGGGAGCTGGCACACACAGG + Intergenic
1061746071 9:132741117-132741139 TGCCGTGACCTGGCACAGACTGG - Intronic
1062526632 9:136980497-136980519 TGCTGGGGCCTGGCACAGAGTGG - Intronic
1203710447 Un_KI270742v1:92901-92923 TGCCCTGAGCTTGCACAAACTGG - Intergenic
1203540605 Un_KI270743v1:84553-84575 TGCCCTGAGCTTGCACAAACTGG + Intergenic
1185715697 X:2340360-2340382 TGCAGTGACCTGGATGAGACTGG - Intronic
1185933272 X:4227328-4227350 TGCAGTGACCTGGATGAGACTGG + Intergenic
1187681874 X:21776180-21776202 TGCAGTGACCTGGATGAGACTGG + Intergenic
1187749239 X:22443827-22443849 TGCAGTGACCTGGATGAGACTGG + Intergenic
1188737747 X:33739394-33739416 TGCAGTGACCTGGATGAGACTGG - Intergenic
1189286380 X:39854900-39854922 TGCCCTCACATGGCAGAGACAGG - Intergenic
1189544764 X:42029941-42029963 TGCAGTGACCTGGATGAGACTGG - Intergenic
1190894987 X:54608649-54608671 TGCAGTGACCTGGATGAGACTGG - Intergenic
1193158083 X:78195804-78195826 TGCTGTGACCTGGATGAGACTGG + Intergenic
1193589863 X:83375790-83375812 TGCAGTGACCTGGAAGAGACTGG - Intergenic
1194543004 X:95198065-95198087 TGCAGTGACCTGGATGAGACTGG - Intergenic
1196200145 X:112877459-112877481 TGCAGTGACCTTGGAAAGACAGG + Intergenic
1198596586 X:138242889-138242911 TGCAGTGACCTGGATGAGACTGG + Intergenic
1199057590 X:143316525-143316547 TGCAGTGACCTGGGTGAGACTGG - Intergenic
1199150105 X:144421768-144421790 TGCAGTGACCTGGATGAGACTGG - Intergenic
1200906824 Y:8492258-8492280 TGCCTTGATCTTGCACAGAAGGG + Intergenic
1201143357 Y:11046821-11046843 TGCCGTAACCAACCACAGACTGG - Intergenic
1201165423 Y:11204552-11204574 TGCCCTGAGCTTGCACAAACTGG - Intergenic