ID: 1061746451

View in Genome Browser
Species Human (GRCh38)
Location 9:132743790-132743812
Sequence TGGGCACGATCACAGTACCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061746451_1061746460 10 Left 1061746451 9:132743790-132743812 CCCCGGTACTGTGATCGTGCCCA 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1061746460 9:132743823-132743845 GCAAAGACTCGGGCTCTGAGAGG No data
1061746451_1061746459 0 Left 1061746451 9:132743790-132743812 CCCCGGTACTGTGATCGTGCCCA 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1061746459 9:132743813-132743835 TTTCGAGGGTGCAAAGACTCGGG No data
1061746451_1061746461 28 Left 1061746451 9:132743790-132743812 CCCCGGTACTGTGATCGTGCCCA 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1061746461 9:132743841-132743863 AGAGGTGAAGTGTTGCCTCCAGG No data
1061746451_1061746458 -1 Left 1061746451 9:132743790-132743812 CCCCGGTACTGTGATCGTGCCCA 0: 1
1: 0
2: 0
3: 8
4: 72
Right 1061746458 9:132743812-132743834 ATTTCGAGGGTGCAAAGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061746451 Original CRISPR TGGGCACGATCACAGTACCG GGG (reversed) Intronic
901709852 1:11105366-11105388 AGGGCAAGATCACAGGACCGGGG - Intergenic
904567722 1:31437685-31437707 TGGACACAACCACAGTACCTGGG + Intergenic
918744460 1:188182440-188182462 AGGGCGAGATCACAGGACCGGGG - Intergenic
920062233 1:203235288-203235310 AGGGCGAGATCACAGGACCGGGG - Intronic
922264727 1:223973005-223973027 AGGGCAAGACCACAGGACCGGGG - Intergenic
923419578 1:233799132-233799154 AGGGCAAGATCGCAGGACCGGGG + Intergenic
924426095 1:243951680-243951702 TGAGTACCATCAGAGTACCGAGG - Intergenic
1071183925 10:83019176-83019198 AGGGCAAGATCACAGGACCAGGG - Intergenic
1074497858 10:113995852-113995874 TGGGCACCATCAGTGTACCATGG - Intergenic
1075459029 10:122603529-122603551 AGGGCAAGATCACAGGACTGGGG + Intronic
1075459661 10:122607588-122607610 AGGGCAAGATCACAGGACTGGGG + Intronic
1075460293 10:122611647-122611669 AGGGCAAGATCACAGGACTGGGG + Intronic
1075460925 10:122615706-122615728 AGGGCAAGATCACAGGACTGGGG + Intronic
1078840032 11:15069753-15069775 AGGGCAAGATCACAGGACCAGGG + Intronic
1084344935 11:68540471-68540493 AGGGCGAGATCACAGGACCGGGG + Intronic
1088494755 11:110421654-110421676 AGGGCGAGATCACAGGACCGGGG + Intergenic
1089535302 11:119157269-119157291 TGGGCACTATGCCAGGACCGAGG - Intronic
1106390941 13:29335421-29335443 AGGGCAAGATCACAGGACCAGGG - Intronic
1114638472 14:24202728-24202750 AGGGCGAGATCACAGGACCGGGG - Intronic
1116783569 14:49264136-49264158 TGGGCACTATCACTGCACCAAGG + Intergenic
1121099425 14:91240028-91240050 AGGGCAAAATCACAGGACCGAGG + Intronic
1127429543 15:58889287-58889309 TGGGAAGGATTACAGTACTGGGG - Intronic
1127831364 15:62754308-62754330 AGGGCACGATGACAGTGCCAGGG + Intronic
1128598781 15:68977405-68977427 AGGGTAAGATCACAGGACCGGGG + Intronic
1135407853 16:22210927-22210949 TGGGCAGGATCACAGTGGAGAGG + Intronic
1143730400 17:8879447-8879469 TGGGCAAGATCCCAGAACAGAGG - Exonic
1147058967 17:37858762-37858784 AGGGCGAGATCACAGGACCGGGG - Intergenic
1150807676 17:68331935-68331957 AGGGCGAGATCACAGGACCGAGG + Intronic
1153795981 18:8622590-8622612 AGGGCAAGATCACAGGACCAGGG + Intronic
1157700632 18:49759810-49759832 TGGCCAGGGACACAGTACCGGGG + Intergenic
1159280160 18:66274656-66274678 AGGGCAAGATCACAGGACCAGGG - Intergenic
1160800713 19:966864-966886 TGGGCACGAGGGCAGTACCTTGG - Exonic
1161861576 19:6801936-6801958 TGGGCACGATGCCAGCACAGTGG + Intronic
1162281034 19:9698211-9698233 AGGGCGAGATCACAGGACCGAGG - Intronic
1164330647 19:24251511-24251533 AGGGCAAGATCACAGGACTGGGG - Intergenic
1164332260 19:24270990-24271012 AGGGCAAGATCACAGGACTGGGG - Intergenic
1168147775 19:54429482-54429504 GGGGCACGATCACAGCTCTGAGG + Intronic
926135346 2:10332143-10332165 TGGGGACGATCACAGGACAGTGG + Intronic
934054429 2:88240134-88240156 TGGGCACGATGAGAGTCCCAGGG + Intergenic
936349859 2:111704325-111704347 TGGGCATGTCCACAGTACTGGGG + Intergenic
936695180 2:114937722-114937744 TGGGCACGTTCAGAGTAGTGTGG - Intronic
941571131 2:167172320-167172342 AGGGCAAGATCACAGGACCGGGG + Intronic
1170506150 20:17027713-17027735 AGGGCAAGATCACAGGACTGGGG - Intergenic
1170536346 20:17344819-17344841 TGGGCACCATCACAGAAAGGAGG - Intronic
1179425281 21:41273180-41273202 AGGGCAAGATCACAGGACCAGGG + Intronic
1182097973 22:27638719-27638741 TGGGGACAATCACAGTAAGGCGG + Intergenic
1183318558 22:37149869-37149891 TGGCCACGGTCCCAGCACCGGGG - Exonic
955002187 3:54937818-54937840 CGGGCATGATCACAGCACAGAGG + Intronic
956798885 3:72739267-72739289 TGGGCAGGATCTCTGTACTGGGG - Intergenic
958270099 3:91488918-91488940 TGGCCAAGATTACAGTACCCAGG - Intergenic
958684223 3:97372031-97372053 AGGGCGAGATCACAGGACCGGGG - Intronic
960555128 3:119019799-119019821 TGGCCAGGGTCACAGTACAGGGG - Intronic
974726994 4:65810733-65810755 AGGGCAGGATCACAGGACCGGGG + Intergenic
976803110 4:89015238-89015260 AGGGTAAGATCACAGGACCGGGG - Intronic
993502679 5:88680448-88680470 TGAGCACGGGCACAGTCCCGGGG + Intergenic
998690816 5:144585492-144585514 TGGGCACTATCACAATAACCTGG - Intergenic
1001512645 5:172334623-172334645 TGGGCACGATGAAAGGACGGGGG + Exonic
1001521532 5:172397363-172397385 AGGGCAAGATCACAGGACCGGGG - Intronic
1001543873 5:172558180-172558202 TGGGCACGATAATAGGACCTGGG - Intergenic
1008985060 6:57532423-57532445 TGGCCAAGATTACAGTACCCAGG + Exonic
1011959819 6:93073681-93073703 AGGGCAAGATCACAGGACTGGGG - Intergenic
1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG + Intronic
1022652173 7:32287445-32287467 TGGGCATGACCACAGCACCCTGG + Intronic
1024122817 7:46262017-46262039 AGGGCGAGATCACAGGACCGGGG - Intergenic
1028435113 7:90794237-90794259 AGGGCGAGATCACAGGACCGGGG + Intronic
1029089888 7:98039941-98039963 AGGTCACACTCACAGTACCGGGG + Intergenic
1032723521 7:134570331-134570353 AGGGCAAGATCACAGGACCGGGG - Intronic
1032937086 7:136745434-136745456 AGAGCAAGATCACAGGACCGGGG + Intergenic
1040679053 8:49787058-49787080 AGGGCAAGATCAGAGGACCGGGG + Intergenic
1041167407 8:55102989-55103011 TGTGCACGATTTCAGCACCGAGG + Exonic
1044064012 8:87676582-87676604 AGAGCAAGATCACAGGACCGGGG + Intergenic
1045798738 8:106077558-106077580 AGGGCAAGATCACAGGACCAGGG - Intergenic
1048305719 8:133283194-133283216 TGAGTACGATCACAGAACCTGGG + Intronic
1050606726 9:7309455-7309477 AGGGCAAGATCACAGGACCGGGG - Intergenic
1051833811 9:21311606-21311628 AGGGCAAGATCACAGGACCGGGG - Intergenic
1051845926 9:21451157-21451179 TGGGCACCAGCACAGGACCAAGG - Intergenic
1059786787 9:117594812-117594834 TGGGCAAGAGCACAGTAGTGTGG - Intergenic
1061746451 9:132743790-132743812 TGGGCACGATCACAGTACCGGGG - Intronic
1187644752 X:21335030-21335052 AGGGCGAGATCACAGGACCGGGG - Intergenic
1189557584 X:42161628-42161650 AGGGCGAGATCACAGGACCGGGG + Intergenic
1200242694 X:154506228-154506250 GGAGCCCGATCACAGTCCCGCGG - Exonic