ID: 1061747808

View in Genome Browser
Species Human (GRCh38)
Location 9:132753134-132753156
Sequence GCTCCTTCCTCCTGGGAATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 472}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061747808_1061747814 7 Left 1061747808 9:132753134-132753156 CCGCATTCCCAGGAGGAAGGAGC 0: 1
1: 0
2: 6
3: 75
4: 472
Right 1061747814 9:132753164-132753186 CTGTTGACCTCCTTTTGTCCTGG No data
1061747808_1061747819 18 Left 1061747808 9:132753134-132753156 CCGCATTCCCAGGAGGAAGGAGC 0: 1
1: 0
2: 6
3: 75
4: 472
Right 1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG No data
1061747808_1061747816 9 Left 1061747808 9:132753134-132753156 CCGCATTCCCAGGAGGAAGGAGC 0: 1
1: 0
2: 6
3: 75
4: 472
Right 1061747816 9:132753166-132753188 GTTGACCTCCTTTTGTCCTGGGG No data
1061747808_1061747815 8 Left 1061747808 9:132753134-132753156 CCGCATTCCCAGGAGGAAGGAGC 0: 1
1: 0
2: 6
3: 75
4: 472
Right 1061747815 9:132753165-132753187 TGTTGACCTCCTTTTGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061747808 Original CRISPR GCTCCTTCCTCCTGGGAATG CGG (reversed) Intronic
900156656 1:1205904-1205926 GCTTCTTCCTCCAGGGCCTGTGG - Intronic
900302856 1:1986598-1986620 GCCCCTCCCACCTGGGAGTGTGG + Intronic
901220346 1:7580228-7580250 GCTCCCTCCCCCTGGGGCTGTGG + Intronic
901805040 1:11733243-11733265 ATTCCTTCCTCCTGGGTATGAGG - Intergenic
902213777 1:14922443-14922465 TTTCCTTCCTCCTGGAAAAGTGG + Intronic
902788243 1:18746720-18746742 GTTCCTCCCTCCTGGGAAGCTGG + Intronic
903384509 1:22917618-22917640 ACTCCTTCCTCATGGGACTAAGG - Intergenic
903788836 1:25878824-25878846 GTTCCTCCCTCCTGGGTATGGGG - Intergenic
904038821 1:27572698-27572720 GCTCCAGCCTCCTGGGGAAGCGG - Intronic
904355852 1:29939356-29939378 GCTCCCTCCTCCTGGTGATGTGG - Intergenic
904376373 1:30084984-30085006 TCTTCTTCCTCGTGGGAATCAGG - Intergenic
904872481 1:33627485-33627507 CCTGCTTCGTCCTGAGAATGGGG - Intronic
905044291 1:34984212-34984234 GCCCCCTCCTCCTGGGATTTGGG - Intronic
907137494 1:52153598-52153620 CCTACTTCCTCCTGAGGATGAGG + Intronic
908841008 1:68280050-68280072 ATTCCTTCCTCCTGGGTATGAGG - Intergenic
908903537 1:68982945-68982967 ATTCCTTCCTCCTGGGTATAGGG + Intergenic
909862772 1:80629967-80629989 ATTCCTTCCTCCTGGGTATGGGG + Intergenic
910148133 1:84106948-84106970 TCTCCCTCCTCCTGGGTGTGTGG - Intronic
911125448 1:94337205-94337227 ATTCCTTCCTTCTGGGTATGGGG + Intergenic
911771159 1:101744196-101744218 ATTCCTTCCTTCTGGGTATGAGG - Intergenic
912919886 1:113855745-113855767 GCTATTTCCTCTTGTGAATGGGG - Intronic
913171812 1:116240062-116240084 ATTCCTTCCTTCTGGGCATGGGG - Intergenic
916097299 1:161362748-161362770 GCTCCTTCTTCCTGAGACAGTGG + Exonic
916126491 1:161576083-161576105 ATTCCTTCCTCCTGGGTGTGGGG + Intergenic
916136410 1:161657923-161657945 ATTCCTTCCTCCTGGGTGTGGGG + Intronic
916316591 1:163455246-163455268 GCTCCTTCCCTCTAGGCATGAGG - Intergenic
916353255 1:163876063-163876085 GCTCCTTCCTCCAAGGAACAGGG + Intergenic
916754627 1:167757126-167757148 GCTCTTTCCTCCCGCGAATCAGG - Intronic
916986705 1:170199694-170199716 GTTCCTTCCTCCTGGATATGGGG + Intergenic
917197055 1:172477895-172477917 ACTCCTTCCTTCTGGGTGTGGGG + Intergenic
918206884 1:182317351-182317373 TCTCCTTCTGCCTGGGACTGTGG + Intergenic
918325467 1:183405589-183405611 GCTCCTCCCTCATGGCCATGTGG - Intronic
919200368 1:194348711-194348733 GCTTCTTCCTCCTGGGCCTCTGG - Intergenic
920134258 1:203756820-203756842 GCTCCTTGCTGCTGTGAATTTGG - Intergenic
920434342 1:205938454-205938476 GCCTCATCCTCCTGGAAATGAGG - Intronic
920719658 1:208375270-208375292 TCACCTGCCACCTGGGAATGTGG + Intergenic
922228962 1:223669015-223669037 GCTGCTTCCTCCTGGGTACCTGG - Intergenic
922338408 1:224636185-224636207 GCACCATCCTTCTGGTAATGGGG + Intronic
922814654 1:228439908-228439930 CATCCTTCCTCCTGGGTATGGGG - Intergenic
923797831 1:237175784-237175806 GTTCCTTCTGCCTGGAAATGAGG - Intronic
923867477 1:237955340-237955362 AATCCTTCCTTCTGGGTATGGGG - Intergenic
923949049 1:238926499-238926521 TTTCCTTCCTTCTGGGCATGGGG - Intergenic
924139229 1:241004737-241004759 ATTCCTTCCTTCTGGGTATGGGG + Intronic
924158126 1:241202648-241202670 TTTCCTTCCTTCTGGGTATGAGG + Intronic
924482779 1:244451898-244451920 GCTCCTTCTTCCTCTGCATGTGG - Exonic
924501897 1:244645780-244645802 GATCCTTCTTCCTGGGAACCTGG - Intergenic
1063047264 10:2405071-2405093 GCACTTTCCTCCTGGGATTATGG - Intergenic
1063281417 10:4633405-4633427 GCTCCTTCCTTCCGGGTGTGGGG + Intergenic
1063462865 10:6225508-6225530 GCTCTTCCCTGCAGGGAATGGGG + Intronic
1063795679 10:9511871-9511893 ATTCCTTCCTCCTGGGTATGGGG + Intergenic
1063997422 10:11633164-11633186 TGTCCTTCCTCATGGGTATGAGG + Intergenic
1064284767 10:13982572-13982594 GTTCCTTCCTTCTGGGTATAGGG - Intronic
1064979162 10:21148980-21149002 ATTCCTTCCTCCTGGGTATGGGG - Intronic
1065212920 10:23422192-23422214 GTTCCTGTCTGCTGGGAATGGGG + Intergenic
1065239088 10:23687237-23687259 ACTCCTCCTTTCTGGGAATGGGG + Intergenic
1065530482 10:26665032-26665054 GCTGCTTCTTACTGGGAATTTGG + Intergenic
1065746784 10:28849348-28849370 GGTCCTTCATCCTGGGAACATGG - Intronic
1066133113 10:32413854-32413876 TCCCCTTCCTCCTGAGCATGTGG - Intergenic
1067373449 10:45705839-45705861 GCTCCTTTCCTCTGGGAATAGGG - Intergenic
1067380243 10:45766375-45766397 GCTCCTTTCCTCTGGGAATAGGG + Intronic
1067479811 10:46587409-46587431 GCTACTTCCTCCTGGGGAGGAGG + Intronic
1067614926 10:47754388-47754410 GCTACTTCCTCCTGGGGAGGAGG - Intergenic
1067881266 10:50047610-50047632 GCTCCTTTCCTCTGGGAATAGGG - Intergenic
1067887944 10:50107029-50107051 GCTCCTTTCCTCTGGGAATAGGG + Intronic
1067944766 10:50682774-50682796 GCAGCTTTCTCCTGGGACTGGGG + Intergenic
1070533864 10:77360892-77360914 GCTCCCTCATCCTGGCAGTGAGG - Intronic
1070544544 10:77442218-77442240 GCTGCTCTCGCCTGGGAATGGGG - Intronic
1070790696 10:79187616-79187638 GCCCCTTCCTTCTGGGGCTGAGG + Intronic
1070850968 10:79561213-79561235 GCTTCCTGCTCCTGGGAGTGGGG - Intergenic
1070880062 10:79847776-79847798 GCAGCTTTCTCCTGGGACTGGGG + Intronic
1071335465 10:84596934-84596956 GCTCCCTCCTCCCCGAAATGGGG + Intergenic
1071630331 10:87214352-87214374 GCTACTTCCTCCTGGGGAGGAGG - Intergenic
1071633174 10:87231866-87231888 GCAGCTTTCTCCTGGGACTGGGG + Intronic
1071646623 10:87364084-87364106 GCAGCTTTCTCCTGGGACTGGGG + Intronic
1072821655 10:98564201-98564223 GCTTCATACTCCTGGGAAAGAGG - Intronic
1073099193 10:100998180-100998202 GCCCCTCCCCCCAGGGAATGAGG + Intronic
1073250741 10:102119263-102119285 TCTCTTTCCTCCTGGCAGTGAGG + Intronic
1073339769 10:102735782-102735804 GCTCCTTTCCCTTGGGGATGGGG + Intronic
1073799115 10:107022084-107022106 CCTCCTCCATCCTGGAAATGAGG - Intronic
1074033851 10:109717961-109717983 GCTCCTTCCTGCTGCTTATGGGG - Intergenic
1074890980 10:117736529-117736551 GCTCCCTCTTCCTGAGGATGGGG + Intergenic
1075024446 10:118974196-118974218 TCTCTTTCCTCCTGGGATTCTGG + Intergenic
1075245005 10:120813242-120813264 ACTCCTTCCTTCTGGGCGTGGGG - Intergenic
1075488668 10:122847858-122847880 GCTCTGTCCTCCTGCTAATGGGG + Intronic
1075641340 10:124066765-124066787 GCACCTCCCTCCTGGGGAGGTGG + Intronic
1076298082 10:129403060-129403082 CCTCCTGCCTCCTGGGCTTGAGG + Intergenic
1076446357 10:130516813-130516835 GCTCCCTCCTCCTTGGAAGTTGG + Intergenic
1076606825 10:131694804-131694826 GGTCCTTTCTCCTGGGCAAGGGG - Intergenic
1076838418 10:133032733-133032755 TCTCCCTCCTCATGGGAATGTGG + Intergenic
1077116654 11:888241-888263 GCTGCTTCCGCCTCTGAATGGGG - Intronic
1077348152 11:2073850-2073872 GCCCCCTACTCCTGGAAATGTGG - Intergenic
1077634189 11:3830920-3830942 GCTACTTCCTCTTGGCCATGGGG + Intronic
1078004697 11:7523784-7523806 TCTCTTTCCTCCTGGGAATAGGG + Intronic
1078090036 11:8259420-8259442 CCTCCTTTCTGCTGGGAATGAGG - Intronic
1078257633 11:9673652-9673674 TTTCCTTCCTCCAGGGTATGGGG + Intronic
1078921897 11:15838433-15838455 GCTCTTAACTCCTGGGAATGAGG - Intergenic
1079084462 11:17435336-17435358 GCTCCTTCTTCCTGAGACAGTGG - Intronic
1079132351 11:17754629-17754651 GCTCCTTCCTCCAGGAAATGGGG - Intronic
1079404076 11:20129823-20129845 GTTCCTTCCTCCCTGGTATGGGG + Intergenic
1079927447 11:26512284-26512306 TCTCCTTTCTCTTGGGAATTTGG + Intronic
1080553033 11:33390505-33390527 GATTCTCCCTCATGGGAATGTGG - Intergenic
1081589058 11:44408273-44408295 GCTACCTCTTCCTGGGAATGTGG - Intergenic
1083020207 11:59499172-59499194 ATTCCTTGCTCCTGGGTATGAGG + Intergenic
1083141880 11:60728887-60728909 ACTTCTTTCTCCTGGGAATTTGG - Intergenic
1083210731 11:61183829-61183851 ATTCCTTCCTCCAGGGTATGGGG - Intergenic
1083355684 11:62064398-62064420 TGTCCTTCCTCCAGGGTATGGGG + Intergenic
1083756320 11:64793534-64793556 GTTTCTTCCTCTGGGGAATGGGG + Intronic
1084170092 11:67396848-67396870 GCTCCTGTCCCCTGGGAAGGTGG + Intronic
1084302422 11:68260250-68260272 GCTTCTTCCTCTGGGAAATGGGG - Intergenic
1084599458 11:70136238-70136260 GCTGCTGCCCCCTGGGAATCAGG - Intronic
1085486550 11:76868637-76868659 ATTCCTTCCTCCAGGGTATGAGG - Intronic
1085502206 11:77034496-77034518 GCTTCTTCCTATTGGGAAGGAGG + Intronic
1086140576 11:83494380-83494402 GCTCCTGCATCCTGGGATGGTGG - Intronic
1086524968 11:87714405-87714427 GTTCCTTCTTTCTGGGTATGGGG + Intergenic
1086869274 11:92017661-92017683 TCCCCTTCCCCCTAGGAATGGGG + Intergenic
1087533610 11:99415418-99415440 TCTCCTTCCTTCTGGGTATGGGG + Intronic
1089369259 11:117942561-117942583 GTTCCTTCCTTCTGGGTATGAGG - Intergenic
1089603913 11:119630716-119630738 GCTGCTTCCTTCTGGAAAAGAGG - Intronic
1089736138 11:120551382-120551404 ATTCCTTCCTCCTGGGTATGAGG - Intronic
1090417070 11:126547958-126547980 GTTTCTTCCTCCTCAGAATGTGG + Intronic
1090952335 11:131484649-131484671 TCTCATTGCTCCTGGGAAAGGGG - Intronic
1091105701 11:132917543-132917565 GATGCTTCTTCCTGGGAATTGGG + Intronic
1091785913 12:3243347-3243369 GCCCCTGCCTCCTGGGGCTGCGG - Intronic
1091879210 12:3963078-3963100 GATCCCTCCTGCTGGGAGTGGGG - Intergenic
1091950838 12:4591700-4591722 GCTCCTTCCTCTTGATAAGGAGG + Intronic
1092470200 12:8771260-8771282 ATTCCTTCCTCCAGGGTATGGGG + Intronic
1094141190 12:27183385-27183407 TCTCCTTCCTCCTAGGAGTGAGG + Intergenic
1095507330 12:42911458-42911480 ATTCCTTCCTTCTGGGTATGGGG + Intergenic
1095704575 12:45222798-45222820 ATTCCTTCCTCCAGGGTATGGGG - Intronic
1096175748 12:49517262-49517284 GCTCCTGACTCCTGAGAAAGTGG + Intronic
1097157316 12:57022412-57022434 ATTCCTTCCTTCTGGGTATGGGG - Intronic
1098845765 12:75533944-75533966 GATCCTTAGTCCTGGGAAAGTGG + Intergenic
1100236147 12:92662944-92662966 TCTCTTTCCTCTTGGGAAGGAGG + Intergenic
1100373417 12:93990643-93990665 TTTCCTTCCTTCTGGGTATGGGG + Intergenic
1100647248 12:96544619-96544641 GTTCCTTCCTCCTGGGTATGGGG - Intronic
1100963925 12:99991926-99991948 AGTCCTTCCTCCTGGGTATGGGG + Intergenic
1101214190 12:102564175-102564197 GTTCCTTCCTTCTGGGTGTGGGG - Intergenic
1101995483 12:109522401-109522423 TTTCCTTCCTCCTGGGAAACAGG - Intronic
1102637377 12:114335942-114335964 GTTCCATTCCCCTGGGAATGGGG - Intergenic
1102678287 12:114673229-114673251 GCTCCCTCCTCCCTGGAGTGGGG + Intronic
1102856649 12:116300004-116300026 GGCCCTGCCTCCTGGGGATGAGG - Intergenic
1102992916 12:117327718-117327740 TCTTCCTCCTCCTGGGGATGAGG + Intronic
1104522194 12:129486151-129486173 GCTGTCTCCTCCTGGGAGTGAGG - Intronic
1104605296 12:130183670-130183692 GCTCCTGTCTCCAGGGAATAGGG + Intergenic
1105906480 13:24815840-24815862 TCTCCTTCATCCTGTCAATGTGG + Intronic
1107446284 13:40472684-40472706 TCTCCCTCCCCCTGGGACTGTGG - Intergenic
1107709180 13:43135384-43135406 GCTCCTTCCTGCTTGGAACCCGG - Intergenic
1108061401 13:46537023-46537045 ATTCCTTCCTTCTGGGTATGGGG + Intergenic
1108165345 13:47687287-47687309 GTTCCTTCCTCCTGGGCACATGG - Intergenic
1108970472 13:56368887-56368909 GGTTCTTCCTCTTGGGAATCTGG - Intergenic
1109055064 13:57536651-57536673 GTTTCTTCCTTCTGGGTATGGGG + Intergenic
1110623882 13:77629889-77629911 ATTCCTTCCTTCTGGGCATGGGG + Intronic
1112444410 13:99451027-99451049 AGTCCTTCCTCCTGGGTATGGGG - Intergenic
1113632428 13:111897468-111897490 CCTTCTTTCTCCTGGGAGTGAGG - Intergenic
1113821636 13:113218445-113218467 TCTCCTTCCTGATGGGAAGGTGG + Intronic
1114282601 14:21207215-21207237 GCTCCTTCTTAGTGTGAATGAGG + Intergenic
1115689301 14:35826732-35826754 GCTGCGTCCTGCTGGGAAAGCGG + Intronic
1115877893 14:37881123-37881145 GCTCTTGCCTCCTAAGAATGAGG - Intronic
1116851294 14:49912087-49912109 GCCACTTACTCCTGGGGATGTGG + Intergenic
1118471927 14:66082260-66082282 GCTCCTGCACCCTGGGCATGTGG + Intergenic
1118747589 14:68785393-68785415 TAGCCTTCCTCCTGAGAATGAGG + Intergenic
1118788367 14:69066014-69066036 GATCCTTTTTCCTGGGTATGTGG - Intronic
1118996412 14:70840559-70840581 GCTGCATTCTCCGGGGAATGGGG + Intergenic
1119263085 14:73249826-73249848 GGTCCCTTCTCCTGGGGATGGGG + Intronic
1119294568 14:73522558-73522580 GCTTCTGCCTCCTGAGAAGGAGG - Exonic
1119752257 14:77087898-77087920 ACTCCTTCCTTCTGGGTATGGGG + Intergenic
1120317768 14:82917762-82917784 TCTCCTTGCTCTTGGGAAAGAGG + Intergenic
1120450849 14:84665447-84665469 TCCCCTTTCTCCTGGGGATGGGG + Intergenic
1120494776 14:85221699-85221721 GCTCCTTTCCCCTGGGCATAGGG + Intergenic
1121053066 14:90831775-90831797 AGTCCTTCCTCCTGGGGAGGAGG - Intergenic
1121248715 14:92483716-92483738 TCTCTTTGCTCCTGGGAATGAGG - Intronic
1121694631 14:95902784-95902806 ACCCCTTCCTCTTGGGAAGGTGG - Intergenic
1122082350 14:99274489-99274511 GCTACTTCCTGCTGGGAGTGGGG - Intergenic
1122141452 14:99665362-99665384 AGTCCTTCCTTCTGGGTATGGGG + Intronic
1122481054 14:102047781-102047803 CCTCCTTCCTGCTGCGACTGTGG + Intronic
1122552556 14:102557730-102557752 CCTCCATCCTCGTGTGAATGGGG - Intergenic
1122845906 14:104498752-104498774 GGGCCTCCCTCCTGGGCATGTGG + Intronic
1122941418 14:104983097-104983119 GCCCCTTCCTCCTGAGACTAGGG + Intergenic
1123020955 14:105397740-105397762 GGTCTTTCCATCTGGGAATGAGG - Exonic
1125179331 15:36863824-36863846 GGTCATTCTTCCTGGTAATGAGG - Intergenic
1125725325 15:41865631-41865653 ACTCCTTCCTCTTTAGAATGGGG - Intronic
1126697502 15:51338750-51338772 ATTCCTTCCTCCAGGGTATGGGG + Intergenic
1126795799 15:52259848-52259870 GCTGCTGCCTCCTGGGGAGGAGG - Intronic
1127262773 15:57338038-57338060 GCTGCTTCCTCCTGGTCATCTGG + Intergenic
1127927632 15:63562121-63562143 CCTTCTTCCTGCTAGGAATGAGG - Intronic
1127985913 15:64070279-64070301 ATTCCTTCCTCCTGGGTATGGGG - Intronic
1127993574 15:64138138-64138160 GCTGCTTCCCTCTGGAAATGGGG + Exonic
1128624542 15:69186192-69186214 ATTCCTTCCTCCAGGGTATGAGG + Intronic
1129104303 15:73295444-73295466 CCTCCTTCCTCCTGGGTTTGGGG + Intronic
1129227956 15:74180757-74180779 GCGCCCTCCCACTGGGAATGGGG - Intronic
1129324880 15:74794571-74794593 GCTCTTTCATCCAGGGGATGGGG + Intronic
1129960377 15:79679283-79679305 GCTTCTGCCTACTGGGGATGTGG + Intergenic
1131001979 15:88946345-88946367 ATTCCTTCCTTCTGGGTATGGGG + Intergenic
1131002568 15:88950424-88950446 ATTCCTTCCTTCTGGGTATGGGG - Intergenic
1132112070 15:99109009-99109031 GCTCCTGCCTCCAGGGGAGGGGG - Intronic
1132418908 15:101647469-101647491 GCTCCTACCACCAGGGCATGTGG + Intronic
1133339056 16:5025159-5025181 TCTCCCTCCTCCTGGGGAAGGGG - Exonic
1133422747 16:5660912-5660934 ACTCCTTCCTCCTGGGTTGGAGG - Intergenic
1134447936 16:14344869-14344891 GTTACTTCCTCTGGGGAATGTGG - Intergenic
1135141639 16:19927188-19927210 GTTCCTTCCTTCTGGGTGTGGGG + Intergenic
1135785953 16:25348998-25349020 GCTCCTTCCTAAGGGTAATGGGG + Intergenic
1136631248 16:31490395-31490417 GCTGCCTCCTCCTGGGTAAGGGG - Exonic
1137595689 16:49722065-49722087 GTTCCTTCCTGGTGGTAATGTGG - Intronic
1137726030 16:50657360-50657382 GCCCCTTCCTGCTGGGCTTGGGG - Intergenic
1138656668 16:58495540-58495562 GACCCTTCCTCCTGGTAAGGTGG + Intronic
1140335714 16:74103307-74103329 ATTCCTTCCTCTTGGGTATGGGG + Intergenic
1141551887 16:84811739-84811761 CCTCCTTCCTACCTGGAATGAGG - Intergenic
1141889744 16:86918702-86918724 ACTGCTTCCTCCTGGGAACGAGG + Intergenic
1141989289 16:87601498-87601520 GGTCCTCGCTCCTGGGAGTGTGG - Intergenic
1142423876 16:89990437-89990459 GCCCCTGCCTGCTGGGAAAGGGG - Intergenic
1142731023 17:1857702-1857724 GCTCCTTCTTCCTGAGACAGTGG - Intronic
1143124854 17:4635563-4635585 GCACCTCCCACCTGGGAAAGTGG - Intronic
1143378670 17:6482185-6482207 ATTCCTTCCTCCTGGGTATGGGG - Intronic
1144506628 17:15836997-15837019 GCTCCCTCCACCTGGGACAGGGG - Intergenic
1144582953 17:16470242-16470264 GGGCCTTCCTTCTGGGAGTGGGG - Intronic
1145904919 17:28511021-28511043 GCTCCTTCCTCCAGGTGCTGGGG - Intronic
1147335880 17:39726799-39726821 TCTCCTTCCTCCACAGAATGAGG + Exonic
1147449623 17:40496053-40496075 GCTGCTTCCCCCAGGGACTGGGG - Exonic
1147508035 17:41039801-41039823 CTTCCTTCCTCCAGGGCATGGGG + Intergenic
1148225940 17:45897636-45897658 GCTCCCGCCTGCTGGGAATGGGG - Intronic
1148766676 17:50043718-50043740 TCTCCCTCCTCCAGGGAAGGAGG + Intergenic
1148792594 17:50181959-50181981 GGTCCTTCATCCTAGGATTGTGG - Intergenic
1150125662 17:62632902-62632924 GCCCCTTCCTCCTGTAGATGAGG + Intronic
1150455541 17:65304074-65304096 GCTGCTTCTTCCTGGGGAGGGGG + Intergenic
1150617789 17:66785429-66785451 GTTCCTTTCTCGTGGGAAAGAGG - Intronic
1151054684 17:71017780-71017802 GTTCCTTCCTCTAGGGTATGGGG + Intergenic
1151308565 17:73279707-73279729 TCTACTTTCTTCTGGGAATGTGG + Intergenic
1151343471 17:73486796-73486818 GCTCCTACTTCCTGGGGAAGGGG + Intronic
1151569267 17:74917958-74917980 GGTCCTTGCTCCTGGGGAAGGGG + Exonic
1151828099 17:76534885-76534907 GCTCCTTCCTCCTGGCTCTGCGG + Intronic
1152556342 17:81055010-81055032 TCTCCTCCCTGCTGGGGATGTGG - Intronic
1152748749 17:82052862-82052884 CCTCCTGCCTCCTGGGGTTGAGG + Intronic
1153157749 18:2168189-2168211 ATTCCTTCCTTCTGGGGATGGGG - Intergenic
1153191254 18:2542128-2542150 GCTGCTCTCTACTGGGAATGAGG + Intronic
1155128145 18:22901236-22901258 GATTCTTCCTCCTGGAGATGTGG + Intronic
1155937385 18:31767806-31767828 ATTCCTTCCTCCTGGGTGTGGGG - Intergenic
1156029059 18:32691206-32691228 TCTGCCTCCTCCTGGCAATGGGG + Intronic
1158780159 18:60639342-60639364 TCTCCTGTCTCCTAGGAATGAGG - Intergenic
1159084579 18:63774266-63774288 CCCCCTTCTTCCTGGGAAAGAGG + Intronic
1159879063 18:73840752-73840774 GATGCGTCCTCCTGGGAAGGTGG + Intergenic
1160571449 18:79820021-79820043 GCTCCTTCCTTCTCCGAAGGAGG + Intergenic
1160589619 18:79936032-79936054 CCTCCTTCCTGCTGGCCATGTGG - Intronic
1160739239 19:678265-678287 GCACCTAGCTCCTGGGAAGGTGG + Intronic
1160856227 19:1219134-1219156 GCTCCTTCCTCCTGGGACGCTGG + Intronic
1161138030 19:2632076-2632098 GCTCCTTTCTCTAGAGAATGGGG - Intronic
1162397155 19:10423903-10423925 CCTCCTTTTCCCTGGGAATGGGG - Intronic
1164117515 19:22236588-22236610 GCTCGTTCCTCAAGGGAATCTGG + Intergenic
1164582244 19:29441846-29441868 GCTCCTTCCTTCTCTGCATGAGG - Intergenic
1164591450 19:29509759-29509781 GCTCCTCACTCCTGGGCTTGAGG - Intergenic
1166185247 19:41135268-41135290 GCTCCTTCCTCCCTGAGATGCGG - Intergenic
1166475773 19:43123549-43123571 GCTTCTTCCTTCTGGGTGTGGGG + Intronic
1167597289 19:50434542-50434564 GCTTCTTCATGCAGGGAATGGGG + Intronic
1168022868 19:53622540-53622562 GCAACTTCCTGCTGGGCATGGGG + Intergenic
1168097124 19:54122241-54122263 GCGCCTTGCTGGTGGGAATGCGG - Intronic
925251503 2:2442725-2442747 GGTCCTTCCACCTGGGAACATGG - Intergenic
927181590 2:20450402-20450424 CCACCTTTGTCCTGGGAATGGGG - Intergenic
927209913 2:20632757-20632779 GCTCCTTCCTCCAGGGCCAGGGG + Intronic
927895414 2:26778544-26778566 GCTCCTTCTCCCTGAGACTGAGG + Exonic
929461364 2:42104026-42104048 ATTCCTTCCTCCTGGGTGTGGGG + Intergenic
930111294 2:47681052-47681074 GATCCTTGCTCCTGAGATTGGGG + Intergenic
931205145 2:60139637-60139659 TCTGCTTTCCCCTGGGAATGAGG - Intergenic
931283325 2:60812395-60812417 ATTCCTTTCTCCTGGGTATGGGG + Intergenic
931633482 2:64321993-64322015 CGTCCTGCCTCCTGGGAATTGGG + Intergenic
932223199 2:70016956-70016978 TGTCCTTCCTCCTGTTAATGTGG - Intergenic
933805884 2:85997807-85997829 GCCCCTCCCTCCTGGGGCTGAGG - Intergenic
934103911 2:88679060-88679082 ATTCCTTCCTTCTGGGTATGGGG + Intergenic
936237399 2:110754929-110754951 ACTCCTACCTCCAGCGAATGAGG + Intronic
936600575 2:113890498-113890520 GTTTCTCCCTCCTGGGACTGGGG + Intronic
936635232 2:114248731-114248753 ACTCCTTCATCGTGAGAATGTGG + Intergenic
936731380 2:115385222-115385244 ACTCCTTCCTCCCAGGTATGGGG - Intronic
937147127 2:119656982-119657004 GATGCTTCCTCCTGGGAAACTGG - Intronic
937311217 2:120904592-120904614 GGTCCCTCCTCCTGGGAAGGTGG - Intronic
938599525 2:132822487-132822509 TCCCCTTACCCCTGGGAATGGGG - Intronic
939576486 2:143901284-143901306 GTTCTTTCCTCCTGGGTATCAGG + Intergenic
940223822 2:151381634-151381656 ACTCCTTCCTTCTGGGTGTGGGG - Intergenic
941673342 2:168318463-168318485 ATTCCTTCCTCCTGGGTAGGGGG - Intergenic
941724068 2:168841988-168842010 CTTCCTTCCTGCTGGGAATGGGG + Intronic
941995398 2:171597049-171597071 CTTCCTTCCTCTTGGGTATGGGG + Intergenic
942083816 2:172426757-172426779 GCTCCTGCCTCCAGGACATGAGG - Intergenic
944173180 2:196801256-196801278 GATCCTTCCTCATGAGAAAGGGG - Intergenic
944444222 2:199773538-199773560 GGTCCTTCCTCCTGGAGATCTGG + Intronic
945010690 2:205459920-205459942 GCTTCTTTCTCCTGGCAGTGAGG + Intronic
945448111 2:209962071-209962093 ATTCCTTCCTTCTGGGAATGGGG + Intronic
947732190 2:232437437-232437459 AGTCCTACCTCCAGGGAATGAGG - Intergenic
948145052 2:235702433-235702455 GCTCCTGCAGCCTGGGAAGGTGG + Intronic
948261622 2:236608052-236608074 GCTCCAGCCTCCTGGGGCTGGGG + Intergenic
1168904430 20:1392327-1392349 GCTGCTTCCTCCGGGGAACTCGG - Intronic
1169000424 20:2164086-2164108 GCTCCCTCATCCTGGGGAGGAGG + Intronic
1169183233 20:3589798-3589820 GCTCCTTCCTTCTTCCAATGAGG - Intronic
1169261689 20:4143802-4143824 AGTCCTTCCTCCAGGGAATGGGG - Intronic
1169293633 20:4374108-4374130 ATTCTTTCCTCCTGGGGATGGGG - Intergenic
1169528976 20:6463997-6464019 GATCCTTACTCCTGAGCATGTGG + Intergenic
1169540611 20:6595570-6595592 GCTCCTTCCTACTCAAAATGTGG + Intergenic
1169731226 20:8787280-8787302 GCTCCTCCCTGCTGCAAATGGGG + Intronic
1170978391 20:21188244-21188266 GTTCCTTCCTCCCTGGTATGGGG - Intronic
1172840656 20:37901390-37901412 GCCCCTTCCTCCAAGGCATGTGG + Intergenic
1172893391 20:38283008-38283030 GCTCCTTCCTTCTGGGGATGGGG - Intronic
1173178219 20:40781448-40781470 GCTGCCTTCTCCTGGGAAAGGGG + Intergenic
1174841490 20:53905397-53905419 GTTCCTGCCTACAGGGAATGAGG + Intergenic
1174985561 20:55447870-55447892 GGTCCTTCCTTCTGGGAACCTGG + Intergenic
1175405573 20:58723729-58723751 GCTCCTGCCTCTTGGGAATGTGG - Intergenic
1175840306 20:62022359-62022381 GCTCCTCTCTGCTGGGGATGAGG - Intronic
1175923748 20:62462150-62462172 CCTCCTTCCTTCTGGGTCTGTGG + Intergenic
1176265633 20:64207905-64207927 GCTGCATCCTCCAGGGACTGGGG - Exonic
1176886437 21:14261377-14261399 GTTCCTTCCCCCTGCAAATGGGG - Intergenic
1176945173 21:14971262-14971284 CTTCCTTCCTACTGGGAATTTGG - Intronic
1176961696 21:15166069-15166091 TCTCTTTCCTCCTGAGAATTTGG - Intergenic
1177181961 21:17753866-17753888 AATCCATCCTCCTGGGTATGGGG - Intergenic
1178480608 21:32976844-32976866 GCTGCTGCCTCCTGGGAAGAGGG - Intergenic
1178891845 21:36526501-36526523 GCTGCTTCCTCCTGGCAAAGTGG + Intronic
1181038038 22:20179273-20179295 GTCCCTCCCTCCTGGGGATGGGG - Intergenic
1181437762 22:22920343-22920365 GCTCCTTCCGCCTCAGAAGGAGG - Intergenic
1181693897 22:24583356-24583378 GTTCCCTCATCTTGGGAATGAGG - Intronic
1182028399 22:27138187-27138209 GCTCCTTTGTCCTGGGCAAGGGG - Intergenic
1183562459 22:38586325-38586347 GCTCCTGCCTCCAGAGAAAGTGG + Intronic
1183833139 22:40429843-40429865 TCTCCTTCCTCCTGGGCAAGAGG + Intronic
1184641993 22:45877717-45877739 GCTCCTCCCTCCTGCGCAGGTGG - Intergenic
1185143507 22:49117003-49117025 GCTCCTTCCTTCTGGGTTGGTGG + Intergenic
1185313707 22:50170091-50170113 GGTCCCTCTTCCTGGGAACGCGG - Intergenic
949690158 3:6627425-6627447 ATTCCTTTCTCCTGGGTATGGGG - Intergenic
950392512 3:12707726-12707748 GCATCCTCCTGCTGGGAATGAGG + Intergenic
950447259 3:13045489-13045511 GCTCTGTCCTCCAGGGAGTGAGG + Intronic
950964075 3:17134134-17134156 GCTCCTTCCTGCTGGGGACCTGG + Intergenic
951527567 3:23668484-23668506 TCTCATTCCTCCTGGGACTCAGG + Intergenic
951539396 3:23767722-23767744 TCCTCTTCCTCCTGAGAATGTGG - Intergenic
952421460 3:33135272-33135294 GTTCCTTCCTTTAGGGAATGGGG - Intronic
952496847 3:33923764-33923786 GCTCCTTCCACTTGGGATTCTGG + Intergenic
952979063 3:38720674-38720696 TGAGCTTCCTCCTGGGAATGTGG + Intronic
953010933 3:39024724-39024746 ATTCCTTCCTTCTGGGTATGGGG - Intergenic
954200457 3:49020778-49020800 GGGTCTTCCTCCTGGGACTGGGG - Intronic
955372805 3:58368168-58368190 CTTCCTTCCTCCTGGGTATGGGG + Intronic
958843941 3:99242477-99242499 ATTCCTTCCTCCTGAGTATGAGG + Intergenic
959863012 3:111236600-111236622 GCTCCATCCTCCTGCCCATGAGG - Intronic
960251588 3:115461413-115461435 GTTCCTTCCTTCTGGGTATGAGG - Intergenic
960425504 3:117502097-117502119 ACTTCTTCCTTCTGGGTATGAGG - Intergenic
961101244 3:124201083-124201105 CCTCCTTCCTCCCTAGAATGGGG + Intronic
961116735 3:124336198-124336220 GCCCATTTCTCCTGGGACTGAGG - Intronic
961778577 3:129307555-129307577 GCTCCTATCCCCAGGGAATGAGG - Intergenic
961814848 3:129544195-129544217 GCATCTTCCTTCTGGGAAGGAGG + Intronic
962119206 3:132544341-132544363 AGTCCTTCCTTCTGGGTATGGGG + Intergenic
963557240 3:146807604-146807626 GCTCCTTGCTTCTGGGTAGGGGG + Intergenic
963670172 3:148241628-148241650 GCTCTTACCTCCTGGCAAAGAGG - Intergenic
964017568 3:151965514-151965536 TCCCCTTTCTCCTAGGAATGGGG - Intergenic
964257842 3:154797382-154797404 ATTCCTTCCTCCAGGGTATGGGG + Intergenic
964673005 3:159247593-159247615 ATTCCTTCCTCTTGGGCATGGGG + Intronic
964842408 3:161008262-161008284 ATTCCTTCCTCCTGGGTATGGGG - Intronic
965350555 3:167607094-167607116 ATTCCTTTCTCCTGGGTATGGGG + Intronic
965371739 3:167871215-167871237 ATTTCTTCCTCCTGGGTATGGGG + Intergenic
968474808 4:799199-799221 GTTCCTTCCTCCAGGGCACGGGG - Intronic
968609611 4:1551085-1551107 GCTCCTTCCCCCTGGAGACGGGG - Intergenic
969333937 4:6495662-6495684 GAGCCTTCCTCCAGGGGATGTGG + Intronic
969703559 4:8780497-8780519 CCTCCTTCCTCCAGGAACTGTGG + Intergenic
971850184 4:31975390-31975412 GTTCTTTTCTTCTGGGAATGGGG + Intergenic
973221107 4:47729085-47729107 GCTTCTTTATCCTGGGTATGTGG + Intronic
974550122 4:63361442-63361464 ATTCCTTCTTCCTGGGAATAGGG - Intergenic
974706973 4:65531359-65531381 CCTCCTTCCTCCCTGGAAAGTGG + Intronic
975895100 4:79079454-79079476 ATTCCTTCCTCCAGGGTATGGGG + Intergenic
977536353 4:98260565-98260587 GCTCCATCCTGCTGTGAAAGCGG - Intergenic
977623368 4:99163119-99163141 GGTCCTTCATTCTGTGAATGAGG - Intergenic
978151865 4:105445759-105445781 GTTACCTCTTCCTGGGAATGAGG + Intronic
979135300 4:117103827-117103849 ATTCCTTCCTGCTGGGTATGAGG - Intergenic
979511461 4:121558809-121558831 GCTCTTGCCACATGGGAATGAGG - Intergenic
981483829 4:145264071-145264093 ACTCCTTCCTCCAGAGTATGGGG + Intergenic
982138262 4:152293510-152293532 GCTAGTTCCTCCTGGGACAGGGG - Intergenic
983082214 4:163400402-163400424 ATTCCTTTCTCCTGGGTATGGGG - Intergenic
985049413 4:185974085-185974107 CTTCCTTCCTCCTGGGTGTGGGG + Intergenic
985250715 4:188022037-188022059 ATCCCTTCCTCCTGGGTATGGGG + Intergenic
985564329 5:607778-607800 GCTCCTGCCGCCCGGGGATGTGG + Intergenic
986757458 5:10851580-10851602 GTTCCTTCCTTCTGGGGATGGGG + Intergenic
987310789 5:16679316-16679338 GCTCCCTGCTCATGGGGATGTGG - Intronic
988492976 5:31720743-31720765 GTTCTTTCCTCCTGGGGATGGGG + Intronic
988838010 5:35052739-35052761 ATTCCTTCCTTCTGGGTATGGGG - Intronic
989073072 5:37532972-37532994 TCCCCTTTCTCCTAGGAATGAGG + Intronic
989344335 5:40412203-40412225 GCTCATTCCATCTGGGCATGTGG + Intergenic
989539664 5:42604394-42604416 ATTCTTTCCTCCAGGGAATGGGG + Intronic
990330333 5:54719428-54719450 GCTCCTCCCTCCTGTGGAGGAGG - Intergenic
990604583 5:57395948-57395970 ATTCCTTCCTCCTGGGAATGGGG + Intergenic
991493386 5:67205041-67205063 GCTTCTTCCTCCTGTGAGGGAGG + Intergenic
992411655 5:76511062-76511084 GATCCTTGTTCCTGGGAATGTGG - Intronic
992909885 5:81385714-81385736 GCTCCTTTCTCCTGGGTTTGTGG - Intronic
993034419 5:82741303-82741325 GGTCCTTCCTCCTGGGGACCTGG + Intergenic
993109083 5:83633125-83633147 TTTCCTTCCTCCTGGGTATGGGG - Intergenic
993628164 5:90251168-90251190 GTTCCTTACACCTGGGAAGGAGG - Intergenic
995805495 5:116047661-116047683 GTTCCTTCCTTCTGGGTATAAGG + Intronic
995897949 5:117036680-117036702 ATTCCTTCCTCCTGGGTATAAGG - Intergenic
996085909 5:119305005-119305027 CCTCCTCCCTCCCAGGAATGTGG - Intronic
996215372 5:120859345-120859367 ATTCCTTTCTCCTGGGAATCGGG - Intergenic
998408087 5:141885864-141885886 GCTCCTTTCCTCTGGGTATGGGG - Intergenic
998864039 5:146476868-146476890 CCTCCTGCCTCCTGGGTAGGTGG + Intronic
1000201984 5:159020184-159020206 ACTGCTGCCTCATGGGAATGTGG - Intronic
1000241013 5:159408054-159408076 ATTCCTTCCTTCTGGGAATGGGG - Intergenic
1002050215 5:176566413-176566435 TATCCTGCCTTCTGGGAATGTGG - Intronic
1002160429 5:177311416-177311438 GCTTCTTCCTCCTGTGGATGGGG + Exonic
1002177965 5:177412968-177412990 GCTCCTTCCTCTTGGGGAGAAGG + Intronic
1002181108 5:177431547-177431569 GCTTCCACCTCCTGGGAAGGAGG + Intronic
1002279531 5:178122332-178122354 GGGCCTTCCTCCAGGGAAGGAGG + Exonic
1002401536 5:178994067-178994089 GCTCCTGCCCCCTGGGCCTGCGG - Intronic
1002580703 5:180208266-180208288 TCTCCTGCCTCCTGGGGCTGTGG - Intronic
1003483638 6:6555751-6555773 GCTCATCCCTCCTAGGTATGAGG - Intergenic
1003665696 6:8109386-8109408 GAGCCTTCCTCCAGGGAGTGTGG - Intergenic
1004380603 6:15129097-15129119 ATTCCTTCCTTGTGGGAATGGGG - Intergenic
1004831142 6:19477687-19477709 ATTCCTTCCTTCTGGGTATGGGG - Intergenic
1005364124 6:25060423-25060445 GATTCTTCCTCCTGAGAATTTGG - Intergenic
1005413481 6:25575969-25575991 ACTCCTTCCACCTGGGGCTGGGG - Intronic
1005652570 6:27897986-27898008 ATTCCTTCCTTCTGGGTATGGGG - Intergenic
1006066646 6:31466991-31467013 GGTCCTTCCTCCTAGGAATATGG + Intergenic
1006521463 6:34573574-34573596 GCTCCTCCTTTCTGGGAATGGGG - Intergenic
1007209553 6:40181289-40181311 ATTCCTTCCTCCTGGGTATGGGG - Intergenic
1007237008 6:40397805-40397827 GCTTCTCTCTCCTGGGGATGAGG - Intronic
1007312181 6:40955252-40955274 GCTCCTTCTCTCTGGGAGTGGGG - Intergenic
1008005165 6:46402614-46402636 GTTCCTTCCTTCTGGGTGTGCGG - Intronic
1010201647 6:73287564-73287586 GGTCCTTCCTCCTGGGGATCTGG - Intronic
1011047307 6:83098913-83098935 ATTCCTTCCTTCTGGGTATGGGG + Intronic
1011068890 6:83360184-83360206 GGTCCTTCCTCCAGGGGATCTGG - Intronic
1011489261 6:87874071-87874093 ATTCCTTCCTCCTGGGTATGGGG + Intergenic
1011821456 6:91257696-91257718 GTTCCTTCCTCTTGGGTATGGGG + Intergenic
1013455533 6:110326188-110326210 GTTTCTTCCTCCTGGGTATGGGG - Intronic
1014460959 6:121694917-121694939 AGTCTTTCCTGCTGGGAATGTGG + Intergenic
1014740916 6:125146918-125146940 GCTCCTCCCTCCAGGGTGTGGGG + Intronic
1014818743 6:125961898-125961920 TTTCCTTCCTCCAGGGTATGAGG + Intronic
1015634464 6:135262167-135262189 GTTCCTTCCTCTTAGGAGTGAGG - Intergenic
1016932986 6:149427766-149427788 GATCCTCCTTCCTAGGAATGTGG + Intergenic
1017870367 6:158481554-158481576 GCGCAGTCCTCCTGGGAGTGAGG + Intronic
1018065105 6:160119051-160119073 GCCCCACCCTCCTGGGACTGTGG - Intergenic
1018461914 6:164006589-164006611 ATTCCTTCCTTCTGGGTATGTGG - Intergenic
1018683874 6:166286827-166286849 GCCCCTTCCACCTGACAATGAGG - Intergenic
1018695906 6:166391253-166391275 CCTCCTTCCTCCTGGGTATTGGG + Intergenic
1018971470 6:168532315-168532337 TGTCCTTCGTCCTGGGATTGGGG + Intronic
1019347640 7:538594-538616 GCTCCTTCCTCCTGTCTAGGGGG - Intergenic
1019843057 7:3468622-3468644 ACTCCTTCCTTCTGGGTATAAGG - Intronic
1019999213 7:4745299-4745321 ACTCCCGACTCCTGGGAATGAGG - Intronic
1020026779 7:4905104-4905126 GCCCCCTCCTCCTGGGCATCTGG - Intergenic
1020564421 7:9777901-9777923 GGTCCTTCCTCCTGGGCATCTGG - Intergenic
1020798192 7:12701211-12701233 ATTCTTTCCTCCAGGGAATGGGG + Intergenic
1021938337 7:25653622-25653644 TCTCCTTCCTTCAGTGAATGAGG + Intergenic
1022282007 7:28920414-28920436 GCTCCTTACTCCTGGGTTGGAGG - Intergenic
1022787534 7:33653330-33653352 ATTCCTTCCCCCTGGGGATGGGG + Intergenic
1023667981 7:42544504-42544526 CTTCCTTCCTTCTGGGTATGGGG - Intergenic
1024906500 7:54388147-54388169 GCTACTTCCTGCTGAGAGTGGGG + Intergenic
1025239058 7:57256586-57256608 GCTCCTCCCACCCAGGAATGCGG + Intergenic
1027723441 7:81772137-81772159 ACTCATTCCTTCTGGGTATGGGG - Intergenic
1028843956 7:95459554-95459576 GCTCCTTCCTCCAGGGTCTGTGG - Intergenic
1029128003 7:98308472-98308494 GCACCTTCCTCCTGGGAGCCTGG - Intronic
1029245318 7:99195262-99195284 ACTCCACCATCCTGGGAATGAGG + Exonic
1029542312 7:101191070-101191092 GTTCCTTCCTCCAGGGGATGGGG + Intergenic
1029731036 7:102438391-102438413 GCTCTTTCATCGTGAGAATGGGG - Intronic
1030493187 7:110264900-110264922 ATTTCTTCCTCCTGGGTATGGGG + Intergenic
1031049964 7:116935002-116935024 CCTTCTTCCTCCCTGGAATGTGG + Intergenic
1031560304 7:123230500-123230522 GGTTCCTCCTCCTGGGAATCTGG + Intergenic
1032379268 7:131459207-131459229 ACTTCTTCCTCCTGGGAATGGGG + Intronic
1034324438 7:150217746-150217768 CCTCCTTTCTCCTGAGCATGGGG - Intergenic
1034397597 7:150838995-150839017 ACTCCTTCCTTCTGCCAATGGGG + Intronic
1034768756 7:153751485-153751507 CCTCCTTTCTCCTGAGCATGGGG + Intergenic
1034783647 7:153905085-153905107 ATTCCTTCCTTCTGGGCATGGGG + Intronic
1034818427 7:154195230-154195252 GATCCTTCCTCCTTGAAATATGG + Intronic
1034952939 7:155313262-155313284 GGTGCTTCCTCCTGGGCCTGTGG - Intergenic
1034976168 7:155450248-155450270 GCTCCTGTCTCCTAGGAATGCGG - Intergenic
1035036251 7:155897112-155897134 GTTCCTTCCTCCCTGGAGTGAGG - Intergenic
1035100499 7:156392330-156392352 GCTTCCTCCTCCCTGGAATGAGG - Intergenic
1035237531 7:157508601-157508623 GCTCTGTCCCCCTGGGAAGGTGG + Intergenic
1036575927 8:10027655-10027677 GATCCTTCCTTCTGGGTATGAGG + Intergenic
1037168226 8:15857270-15857292 GCTTCTTCCTCCTGGGTTAGGGG - Intergenic
1037264655 8:17045352-17045374 ATTCCTTCCTCCAGGGTATGGGG - Intronic
1037391564 8:18398282-18398304 ACTCCTTCCTTCTGGGTATAGGG + Intronic
1039441412 8:37597929-37597951 CTTCCTTCCTCCTGGTGATGGGG - Intergenic
1039585913 8:38706888-38706910 ACTCCTTCCTTCTGGGTTTGGGG + Intergenic
1039586104 8:38708344-38708366 GCGCCTTCCTTCTGGGTATGGGG - Intergenic
1039771815 8:40694956-40694978 ACTCCTTCCTTCTGGGTGTGGGG - Intronic
1040680543 8:49803217-49803239 CCTCATTCCTTCTGGGTATGGGG + Intergenic
1041042376 8:53860617-53860639 GATCCTCTCTCCTGGGAATTTGG - Intronic
1041150414 8:54926391-54926413 TCCCCTTTCCCCTGGGAATGGGG - Intergenic
1041599175 8:59695414-59695436 ACTCCTTACTTCTGGGAATTAGG - Intergenic
1041709017 8:60876256-60876278 TTTGCTTCCTCCTGGGAAGGAGG - Intergenic
1041797717 8:61763108-61763130 GCTACTTACTCCTGGAAATAAGG + Intergenic
1042207966 8:66347924-66347946 GCTCCTTTCACCTGGGTATAGGG - Intergenic
1043545209 8:81307161-81307183 TCCCCCTTCTCCTGGGAATGGGG - Intergenic
1044218031 8:89635832-89635854 GCTCACTCTACCTGGGAATGGGG - Intergenic
1045320495 8:101078466-101078488 GCTCCCTCCTTCTAGGAATCAGG + Intergenic
1046980512 8:120331564-120331586 AATCCTTCCACCAGGGAATGAGG + Intronic
1047301002 8:123613375-123613397 ACTCTTTCCTCCTGGGTATGGGG + Intergenic
1047735932 8:127765032-127765054 TCTCCCTCCTCCTGGGAACATGG + Intergenic
1048411925 8:134183881-134183903 GTACTCTCCTCCTGGGAATGGGG + Intergenic
1049225603 8:141449138-141449160 GCTCCTGGCTCCTGGGAGTGTGG + Intergenic
1049495441 8:142928910-142928932 GCTCTTTAACCCTGGGAATGAGG - Intergenic
1049676202 8:143890397-143890419 GCTCATTCCTCCTGGGATCACGG - Intergenic
1049966554 9:785285-785307 ATTCCTTCCTCCTGGGTATGGGG + Intergenic
1050206248 9:3199464-3199486 ATTCCTTCTTCCTGGGTATGGGG + Intergenic
1050341697 9:4646478-4646500 GCTAGTTCCTCCAGGTAATGTGG - Intronic
1050754933 9:8990756-8990778 ATTCCTTCCTCCTGGGTATGGGG - Intronic
1051380911 9:16457670-16457692 GCGCTTTCCTTCTGGGAATCTGG - Intronic
1051838307 9:21365350-21365372 ATTCCTTCCTCTTGGGTATGTGG + Intergenic
1051845403 9:21446452-21446474 ATTCCTTCCTCTTGGGTATGTGG - Intergenic
1052326115 9:27218227-27218249 GGTTTTTCCTCCTGGAAATGGGG - Intronic
1053538848 9:38952629-38952651 ATTCCTTCCCCCTGGGAATGGGG + Intergenic
1053669825 9:40348676-40348698 GCTCCTTCCTCCGGGGACACGGG - Intergenic
1053919623 9:42974931-42974953 GCTCCTTCCTCCGGGGACATGGG - Intergenic
1054380957 9:64488677-64488699 GCTCCTTCCTCCGGGGACACGGG - Intergenic
1054514787 9:66027620-66027642 GCTCCTTCCTCCGGGGACACGGG + Intergenic
1054627292 9:67411290-67411312 ATTCCTTCCCCCTGGGAATGGGG - Intergenic
1055685977 9:78775281-78775303 TCTCCTTCCTCCTGTGACTCAGG + Intergenic
1056884997 9:90433394-90433416 TCTTCTTCCTCCTGGGACTCAGG + Intergenic
1056890522 9:90487867-90487889 CTTCCTTCCTCCAGGGTATGGGG - Intergenic
1057319786 9:94001981-94002003 GCTCCTTGCTACTGGGAAATGGG - Intergenic
1057354196 9:94321365-94321387 GCAGCTCCCTCCTGGGACTGGGG - Intronic
1057613989 9:96571860-96571882 ATTCCTTCCTCCAGGGTATGGGG - Intronic
1057653568 9:96936270-96936292 GCAGCTCCCTCCTGGGACTGGGG + Intronic
1057816636 9:98300796-98300818 ATTCCTTCCTCCAGGGTATGGGG - Intronic
1058031031 9:100197748-100197770 ATTCCTTCCTCCAGGGTATGGGG + Intronic
1058207288 9:102124636-102124658 GCTCCTCCCTGCTGCAAATGGGG + Intergenic
1058957580 9:109963479-109963501 GTTCCCACCTCCTGGAAATGTGG - Intronic
1059309602 9:113378941-113378963 GTTCCTTCCTCCAGGGTATGCGG - Intergenic
1059649273 9:116300110-116300132 GCTCCAACCTCATGTGAATGTGG - Intronic
1059817848 9:117938033-117938055 GCTTGTTGCTCCTGGGACTGTGG - Intergenic
1059882594 9:118708127-118708149 GCTCCTTCCTCATGTGATTTAGG + Intergenic
1060129467 9:121081102-121081124 ATTCCTTCCTCCTGGGTATTGGG + Intronic
1060495948 9:124118641-124118663 GCTCCTTCCCCATGGGGCTGTGG + Intergenic
1060518832 9:124282536-124282558 CCTGTCTCCTCCTGGGAATGAGG - Intronic
1060548951 9:124476281-124476303 GCTCCCCCATCCTGGGAGTGGGG - Intronic
1060656649 9:125376667-125376689 GCTGCTTCCTCCCGGGCCTGCGG - Intergenic
1060923438 9:127438654-127438676 ATTCCTTCCTCCAGGGTATGGGG + Intronic
1061747808 9:132753134-132753156 GCTCCTTCCTCCTGGGAATGCGG - Intronic
1061944387 9:133900568-133900590 GCCCCTTCCTTCTGGGTGTGGGG - Intronic
1062673313 9:137724280-137724302 GCTCCTCCCTCCTGGCAGGGCGG - Intronic
1185703433 X:2248734-2248756 GCGCCTTCCTTCTGGGGGTGGGG - Intronic
1185771123 X:2766462-2766484 GCTCCTTCCTTCCGGGTATGGGG + Intronic
1185915237 X:4027553-4027575 GCTCCTTCCTTCTGGGTGTGCGG + Intergenic
1186180408 X:6967906-6967928 GCTCTTTCCTTCTGGGTGTGAGG - Intergenic
1186218579 X:7325873-7325895 TTTCCTTCCTTCTGGGCATGGGG + Intronic
1186314060 X:8349839-8349861 ACTTCTTCCTTCTGGGTATGGGG + Intergenic
1186758608 X:12699946-12699968 GTTCCTTCCTTCTGGGTGTGGGG + Intronic
1186856891 X:13635439-13635461 CCTCCTTCCTGCTTGCAATGTGG + Intergenic
1187570614 X:20496976-20496998 CCTTCTTCCTCCCTGGAATGTGG - Intergenic
1187752117 X:22478400-22478422 TCTCCTTTCCCCTAGGAATGGGG + Intergenic
1188479984 X:30627539-30627561 ACTCCTTCCTTCTGGGTATGGGG - Intergenic
1189377919 X:40480274-40480296 TCTCCTTTCTGCTGGGAATTGGG + Intergenic
1189794854 X:44635808-44635830 GCTCCCTTCTCCTGGGACTTAGG + Intergenic
1189861133 X:45273653-45273675 ATTCCTTCCTCCTAGGTATGGGG + Intergenic
1190550135 X:51571199-51571221 ATTCCTTCCTTCTGGGTATGTGG - Intergenic
1190627721 X:52352727-52352749 ATTCCTTCCTTCTGGGTATGGGG - Intergenic
1191101927 X:56738968-56738990 ATTCCTTCCTCCTGGGTATGGGG + Intergenic
1194066897 X:89271729-89271751 GCTCCTCCCTGCTGCAAATGTGG + Intergenic
1194470168 X:94284804-94284826 ACTCCTTTCCCCTAGGAATGGGG + Intergenic
1195254503 X:103079368-103079390 GCTCCTTCCTGGTGGACATGTGG - Exonic
1195342090 X:103916265-103916287 ATTTCTTCCTCCTGGGTATGGGG + Intergenic
1195350918 X:103996335-103996357 AGTCCTTCCTCCTGGGTATGGGG - Intergenic
1195621141 X:106956091-106956113 CCTCCTTCCTCTTGGGAAGAAGG - Intronic
1198028798 X:132735236-132735258 GCTCCAGCTTCCTGGGAAAGAGG + Intronic
1198851149 X:140966573-140966595 ATTCCTTCCTTCTGGGAGTGCGG + Intergenic
1198983154 X:142422361-142422383 ACTCCTTCCTTCTGGATATGGGG - Intergenic
1199184179 X:144895821-144895843 CCTTCTTCTTCCTGGGAGTGAGG - Intergenic
1199482041 X:148308346-148308368 GAACCTTCCTCCTGAAAATGTGG - Intergenic
1200721062 Y:6605888-6605910 GCTCCTCCCTGCTGCAAATGTGG + Intergenic
1201299312 Y:12492028-12492050 ACTCCTTCCTTCTGGGTGTGAGG - Intergenic
1201891698 Y:18949474-18949496 ACTTCTTCCTCCAGGGAATAAGG + Intergenic