ID: 1061747810

View in Genome Browser
Species Human (GRCh38)
Location 9:132753141-132753163
Sequence TGGCCTGGCTCCTTCCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 435}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061747810_1061747819 11 Left 1061747810 9:132753141-132753163 CCCAGGAGGAAGGAGCCAGGCCA 0: 1
1: 0
2: 6
3: 45
4: 435
Right 1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG No data
1061747810_1061747814 0 Left 1061747810 9:132753141-132753163 CCCAGGAGGAAGGAGCCAGGCCA 0: 1
1: 0
2: 6
3: 45
4: 435
Right 1061747814 9:132753164-132753186 CTGTTGACCTCCTTTTGTCCTGG No data
1061747810_1061747816 2 Left 1061747810 9:132753141-132753163 CCCAGGAGGAAGGAGCCAGGCCA 0: 1
1: 0
2: 6
3: 45
4: 435
Right 1061747816 9:132753166-132753188 GTTGACCTCCTTTTGTCCTGGGG No data
1061747810_1061747815 1 Left 1061747810 9:132753141-132753163 CCCAGGAGGAAGGAGCCAGGCCA 0: 1
1: 0
2: 6
3: 45
4: 435
Right 1061747815 9:132753165-132753187 TGTTGACCTCCTTTTGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061747810 Original CRISPR TGGCCTGGCTCCTTCCTCCT GGG (reversed) Intronic
900322936 1:2093941-2093963 TGGCCTGGCTCCCTCTGCCCTGG - Intronic
900374085 1:2345416-2345438 TGTCTTGCCTCCGTCCTCCTTGG + Intronic
900593078 1:3468420-3468442 CGCCCGGGCTCCCTCCTCCTCGG - Intronic
901138765 1:7014409-7014431 GAGACTGGCTCCTTCTTCCTGGG + Intronic
901733487 1:11297298-11297320 CTGCCTTGCTCCTTCCTCCATGG + Intergenic
901826182 1:11863065-11863087 GAGCCTGCCTCCTGCCTCCTGGG - Intergenic
901953864 1:12770241-12770263 TGGCCTGACTCTGTGCTCCTGGG + Intergenic
902680267 1:18038773-18038795 TGGCATTGCTCCTTCATCCAGGG - Intergenic
902994310 1:20211895-20211917 TGGGCTTGGTCCTTCCTGCTGGG + Intergenic
903650370 1:24918199-24918221 TGGGCTGGCCCCTCCCTTCTTGG - Intronic
904647927 1:31982262-31982284 TGCCCTGGATACCTCCTCCTTGG - Intergenic
905465698 1:38151525-38151547 AGGGCTGGCTCCTCTCTCCTGGG + Intergenic
906066455 1:42984610-42984632 GGGCCTGTCTCCCACCTCCTGGG - Intergenic
906208585 1:43999916-43999938 TGACTTGGCTCCTTCCTGTTTGG - Intronic
906232118 1:44172577-44172599 TGGCCTGGCTCTGCCCACCTGGG - Intergenic
907924554 1:58943715-58943737 GGGCCTGGTTCCTTCCTTCAAGG + Intergenic
908801212 1:67882475-67882497 TTGCTTTTCTCCTTCCTCCTTGG - Intergenic
908957520 1:69651745-69651767 TGTCCTGGCTCCCTGCTTCTCGG + Intronic
909523071 1:76591729-76591751 TGGCCTGGCTGCCTCTACCTGGG + Intronic
910283629 1:85529494-85529516 TGGACTGGCCCCTTCCTCAGTGG + Intronic
910757344 1:90707193-90707215 AGGCCCGGCTCCTCCCTCCTCGG + Intergenic
911047338 1:93639374-93639396 GGGACTGCCTCCTGCCTCCTTGG - Intronic
911657776 1:100464219-100464241 ATGCCAGGCTCCCTCCTCCTGGG + Intronic
912417081 1:109516650-109516672 TGGGCTGTCTCCTGCATCCTTGG + Intergenic
913140027 1:115931865-115931887 TGGTTTAGCTCCTTCCTCCTGGG + Intergenic
913374129 1:118132275-118132297 TGGCCTCAGTCCTTCTTCCTGGG - Intronic
913374136 1:118132312-118132334 TGGCCTCAGTCCTTCTTCCTGGG - Intronic
914206386 1:145533496-145533518 TGGACTGGCCCCTTCCTCAGTGG - Intergenic
915607040 1:156958971-156958993 GGCCCTGGCTCCTTCCCTCTGGG - Intronic
915646109 1:157273830-157273852 TTGTCTGGCTACTTCCTGCTGGG + Intergenic
917735455 1:177915893-177915915 TGGCCTGGCTCGTTGCTCTCAGG + Intergenic
918093008 1:181313712-181313734 TAGCCTGGCCCTTTCTTCCTGGG - Intergenic
919810115 1:201404026-201404048 TGTCCTGGTTACTTCCTCCAGGG + Intronic
920507187 1:206524981-206525003 AGGCCTGTCTCCTTTGTCCTGGG + Intronic
921174485 1:212582276-212582298 TGGCCTGGTTCCTTCCTAAAAGG - Intronic
921571321 1:216782321-216782343 TGGCATGATTCCTTCCTTCTTGG + Intronic
921958609 1:221010977-221010999 AGGCCTGCCCCTTTCCTCCTGGG + Intergenic
922236195 1:223724341-223724363 TGGCCAGGCCACCTCCTCCTGGG - Intronic
922814657 1:228439915-228439937 TGGGCAGCATCCTTCCTCCTGGG - Intergenic
923624440 1:235602441-235602463 TAGCCTGGCTTCTTACTTCTGGG + Intronic
924172994 1:241360401-241360423 TTGCCTGGCTACTGCCTCTTTGG - Intergenic
924464558 1:244288237-244288259 TGGCCTAGCTCCTTCCTTTGGGG + Intergenic
924616457 1:245615780-245615802 TGGCCGGGATCCTTTCCCCTCGG - Intronic
1062829814 10:598121-598143 TTGCCTGGCACTTTCCTCGTGGG - Intronic
1062830869 10:604816-604838 TGGTCTGGCTTCTCCCTGCTTGG - Intronic
1062841063 10:672323-672345 TGGCCTGTTTCCTTCGTCCGTGG - Intronic
1062863008 10:824697-824719 TGGCCTGGCGCCCTCCAGCTGGG - Intronic
1063217363 10:3936797-3936819 TGGTCTGACACCATCCTCCTGGG + Intergenic
1063375289 10:5551013-5551035 TGGCAGGGCTGCTTCCTCCAAGG + Intergenic
1063376754 10:5558603-5558625 TGGCCTCGCCTCTCCCTCCTGGG - Intergenic
1063382080 10:5591763-5591785 AGGCCCGGCTCCTTGTTCCTGGG - Intergenic
1066177257 10:32921188-32921210 TGGCTTGAATCCTTCCTTCTTGG - Intronic
1067703287 10:48588899-48588921 TGGCCTGGGGCCTCCCTCCACGG - Intronic
1068657051 10:59586737-59586759 TGGCTGGACTCCTTCTTCCTTGG + Intergenic
1069994443 10:72333831-72333853 TGACCTGGCACCTGCCTCCATGG + Exonic
1070377550 10:75848563-75848585 TTTCCTGCCTCCTTCTTCCTGGG + Intronic
1070822876 10:79372979-79373001 TGGCCTGGCTGCTTTCTCTTGGG - Intergenic
1070951138 10:80431841-80431863 TGGCCTGGCTCCTGCCCTCAAGG - Intronic
1071523760 10:86346617-86346639 AGGCCTGGCTCCTGCCTCCTGGG - Intronic
1071710834 10:88047533-88047555 TGGCATGGGTCCTTCCTCAAAGG + Intergenic
1072564211 10:96603891-96603913 GTGCCTGGCTCCTTTCACCTGGG + Intronic
1073286050 10:102389128-102389150 TGGTCTCCCTCCTTCCTCCTAGG + Intergenic
1074079170 10:110153746-110153768 TAGCGTGTCTCCTTCCTCCCTGG - Intergenic
1074182260 10:111075946-111075968 AGGCCAGGATCCTGCCTCCTTGG - Intergenic
1074783051 10:116815924-116815946 CAGCCCGGCTCCTTCCTCTTAGG - Intergenic
1075746696 10:124732987-124733009 TGGCCTGGCTGCGTCCGCATAGG - Intronic
1076094704 10:127721445-127721467 TGGCCTGTCTCCTTCCCTTTAGG - Intergenic
1076721912 10:132396722-132396744 TGGCCCGGATCCTCCCGCCTGGG - Intergenic
1076786881 10:132754327-132754349 GGGCCTGCCTCCATCCTCATTGG - Intronic
1076858123 10:133127418-133127440 AGGCCTTGCTGCTTCGTCCTGGG - Intronic
1077325971 11:1964275-1964297 GGGCCCGGCTCGCTCCTCCTGGG - Intronic
1077474076 11:2778226-2778248 TGGCCTGGCTCCTTCCATGGGGG - Intronic
1078411157 11:11120006-11120028 TGGGCTGCCTCCTGCCTCCAAGG - Intergenic
1080857855 11:36128016-36128038 TGGGGTAGCTCCTGCCTCCTCGG - Intronic
1080932813 11:36830487-36830509 TGCCCTCTCCCCTTCCTCCTGGG + Intergenic
1081589060 11:44408280-44408302 GGGCCTGGCTACCTCTTCCTGGG - Intergenic
1082225608 11:49703133-49703155 TGGTCTAAATCCTTCCTCCTTGG + Intergenic
1082854624 11:57795607-57795629 TGCCCCGGCTCCTGCATCCTGGG - Exonic
1083160194 11:60849828-60849850 GGGCCTTTCCCCTTCCTCCTGGG + Intronic
1083255104 11:61490824-61490846 TAGCCTGGCTCCTGTCCCCTAGG - Exonic
1083301133 11:61740134-61740156 GGCCCTGGCTCCTCCCTCCAGGG + Intronic
1083409604 11:62482939-62482961 TGCCCTGTCTTTTTCCTCCTAGG - Intronic
1083640867 11:64144607-64144629 GGGCCGGGCTCCCTCCTCCTCGG - Intronic
1084165616 11:67373509-67373531 CCGCCTGGCTCCTACCTGCTCGG + Exonic
1084270788 11:68028068-68028090 GCGCCTGCCTCCTCCCTCCTGGG + Exonic
1084312746 11:68326346-68326368 TGGGCTGGCTGCTTCCTCTGTGG + Intronic
1084577961 11:70002548-70002570 TGGCGTGGCCCATTGCTCCTAGG - Intergenic
1084958516 11:72703954-72703976 AGGCCTGGCTCCTCCCTGCATGG + Intronic
1085402245 11:76241940-76241962 TCCCCAGGCTCCTTCCTTCTTGG + Intergenic
1086623469 11:88916449-88916471 TGGTCTAAATCCTTCCTCCTTGG - Intronic
1088125932 11:106423381-106423403 TGACATGGCCCCTTCCTACTTGG - Intergenic
1088971515 11:114778702-114778724 TGGACATGCTCCTTCCTCCAGGG - Intergenic
1089062977 11:115641460-115641482 TGACCTGGCTCATCCTTCCTTGG - Intergenic
1090204582 11:124877381-124877403 TGGCCATGCTCCCTCCACCTGGG - Intronic
1090499991 11:127252022-127252044 TGCCTTGGCTCCCTCCTCCAGGG + Intergenic
1090988796 11:131797367-131797389 TGACCTGGCTCCTGCCCTCTAGG + Intronic
1202808951 11_KI270721v1_random:19454-19476 GGGCCCGGCTCGCTCCTCCTGGG - Intergenic
1091795963 12:3297669-3297691 TGGCCTCACTCCTTCCTGCAGGG - Intergenic
1091868818 12:3869450-3869472 TGGCCTGGTTCCTACCTCCTGGG + Intronic
1092029943 12:5275585-5275607 TGGCCTGGCTCCCACCCTCTAGG - Intergenic
1092086476 12:5767130-5767152 TGGCCCTGCCCCTTCCTCCCTGG + Intronic
1100166379 12:91922605-91922627 TAGCCTGGCACTTTCCGCCTAGG + Intergenic
1101374252 12:104157214-104157236 TTCCCTGGCTTCTTCCTGCTGGG + Intergenic
1101800751 12:108020011-108020033 TGGCCTGGCCTCATGCTCCTGGG - Intergenic
1101866738 12:108525905-108525927 TGGCATGGCTCCTTCTTGCTGGG - Intronic
1102032888 12:109753207-109753229 TGCCTTGGCTCCACCCTCCTTGG - Intronic
1102351578 12:112196418-112196440 TCTCCTGTCTCCTCCCTCCTTGG + Intronic
1103614851 12:122145599-122145621 TGGCGAGGCCCCTTCCTCCAAGG + Exonic
1106310322 13:28548579-28548601 TGCTCTGTCTCCTTCCTCTTTGG - Intergenic
1108756791 13:53512809-53512831 TTTCCTGGCTGCTTCCTCCCTGG - Intergenic
1108867140 13:54937648-54937670 TTGTCTGGCTGCTTCCTGCTGGG + Intergenic
1109111917 13:58331720-58331742 TGTCTTGGCTCCTTCCTCACTGG - Intergenic
1109659710 13:65441705-65441727 TGGCCTGGCTCATTGATCCTTGG - Intergenic
1112185765 13:97126406-97126428 AGGCCTGCCTCCTGCCTCCAGGG - Intergenic
1112435865 13:99390780-99390802 GGGACTGGCTTCTTGCTCCTTGG + Intergenic
1113454285 13:110437142-110437164 TGTCCTGGGTCCTGCATCCTGGG + Intronic
1113743277 13:112725424-112725446 TCGCCTGGCCCCTGCCACCTGGG + Intronic
1113767095 13:112888440-112888462 GGGCCAGGCTTCCTCCTCCTTGG - Intergenic
1113927222 13:113948263-113948285 CTGCCTGGCACCTGCCTCCTGGG + Intergenic
1114317860 14:21524324-21524346 TGGAGTGGCTGCCTCCTCCTCGG + Exonic
1114393611 14:22337004-22337026 GGGCCTGGCTCCTCCCTCATAGG - Intergenic
1117284377 14:54272560-54272582 CAGCCTGGCACCTTGCTCCTTGG - Intergenic
1117537069 14:56712648-56712670 TGTCCTGGATCCTCCCTTCTGGG - Intronic
1118839305 14:69499340-69499362 GTGGCTGGCTCCTTCCTCCAGGG - Intronic
1119099611 14:71867846-71867868 GGCCTTGGCTCCTTGCTCCTTGG - Intergenic
1119400562 14:74359580-74359602 TGACCTGGCACCTTCTCCCTTGG - Exonic
1119739132 14:77002755-77002777 TTGCCTCCCTCCTCCCTCCTAGG + Intergenic
1122044365 14:99012710-99012732 TGGGCTGGCTCCAGCCTCTTGGG - Intergenic
1122364322 14:101185498-101185520 TGGCTTTCCTCCTTCCTCCAAGG + Intergenic
1122371585 14:101231966-101231988 TGGCCCTGGTCCTTCCTTCTAGG + Intergenic
1122407827 14:101510734-101510756 GGTCCAGGGTCCTTCCTCCTGGG - Intergenic
1122627977 14:103093969-103093991 AGGCCTGGATCCGTTCTCCTTGG + Intergenic
1123044981 14:105507534-105507556 CTGTCTGGCTCCTACCTCCTGGG + Intergenic
1124911295 15:33923707-33923729 TGGCCTGGTTCCTAACCCCTAGG - Intronic
1125933391 15:43615770-43615792 ACCCCTGGCCCCTTCCTCCTTGG - Exonic
1125946489 15:43715232-43715254 ACCCCTGGCCCCTTCCTCCTTGG - Intergenic
1127547378 15:60003969-60003991 TCGCCTGGCTCCCTCTTCCGCGG + Intergenic
1127722870 15:61719972-61719994 TGGTTTGGTCCCTTCCTCCTAGG - Intergenic
1128248686 15:66150177-66150199 TGGCCTGGCTCCCTGCTCGGGGG - Intronic
1129388963 15:75211020-75211042 TGGCCTGGCTCTGCCCACCTGGG + Exonic
1129614484 15:77087449-77087471 AGGCCAGGCTCATTCCTCCGGGG - Intergenic
1129909278 15:79212801-79212823 TGGCCTGGGTGCCTCCTCCCAGG + Intergenic
1130877680 15:88028584-88028606 TGGCCTGTCTCCATCCTGGTTGG - Intronic
1131093634 15:89642151-89642173 TGGGGTGACTCCTGCCTCCTAGG - Intronic
1131270908 15:90947239-90947261 CGGCATGGCTCCTCCCTCCATGG + Intronic
1131387579 15:92019805-92019827 TGGGGTGGCTCCTTTCTACTTGG + Intronic
1132253201 15:100350007-100350029 GGGCCTGTGTGCTTCCTCCTGGG + Intergenic
1132319746 15:100917565-100917587 TGGCTTTGCTCCTTGCTCCTAGG + Intergenic
1132390170 15:101433095-101433117 TGGCCTGGTGCCTTGATCCTTGG - Intronic
1132514392 16:359501-359523 TGGCCTGGCACCTGCCTCCCAGG + Intergenic
1132726120 16:1339065-1339087 TGCCCTCGCTCCCACCTCCTGGG + Intronic
1133044631 16:3080889-3080911 GGGTCTGGTTCCTTCCACCTTGG - Intronic
1136533463 16:30885201-30885223 TCTCCTGCCTCCTTCCTCCAAGG - Intronic
1137268904 16:46889902-46889924 GGGGCTTGCTCTTTCCTCCTGGG + Intronic
1138247296 16:55477460-55477482 GGGCCTGGCTCCCTCCTGCGGGG + Intronic
1138539983 16:57682275-57682297 TGTCCTGTCCCCTGCCTCCTGGG + Intronic
1140099270 16:71900458-71900480 TGGACTGAGTCCTTCCTCTTAGG - Intronic
1140278154 16:73529525-73529547 CTGCTTGGCTCCTGCCTCCTGGG + Intergenic
1141087684 16:81108653-81108675 GTGCTTGGCTCCTTCCTCATTGG - Intergenic
1141640113 16:85335970-85335992 TGCCCTGGCTCTGTCCTCCTGGG - Intergenic
1141831603 16:86512383-86512405 AGGCCTGGCTCCTGCCTCCTGGG - Intronic
1142622013 17:1171281-1171303 TGGGCTAACCCCTTCCTCCTGGG - Intronic
1143095916 17:4478311-4478333 AGGCCTAGCTGCTTCCTCCTGGG + Intronic
1143569016 17:7742875-7742897 CGGCCTGCCACCTTCCTCCAGGG - Intronic
1143699479 17:8647563-8647585 TGGCCAGGCTCCTTCCAACAAGG - Intergenic
1144753807 17:17667774-17667796 TGCCATGGCCCCTCCCTCCTTGG + Intergenic
1144758184 17:17692888-17692910 TTGCCTGGCTCCCTCTACCTAGG - Intronic
1144875600 17:18395479-18395501 TTCCCTGGCTCCTTCCAGCTGGG + Intergenic
1145156626 17:20548942-20548964 TTCCCTGGCTCCTTCCAGCTGGG - Intergenic
1145798797 17:27670815-27670837 TTCCCTGGCTCCTTCCACCTGGG - Intergenic
1145992328 17:29086577-29086599 TGGGCTGCCCCCTTCCTCCTAGG - Exonic
1146008382 17:29176675-29176697 TGGCCTGGCCCCGTGCTCCAGGG + Intronic
1148081402 17:44969113-44969135 TGGCCAGGCTGCTTTTTCCTGGG + Intergenic
1148086305 17:44995750-44995772 TGGCCTGGCCCCGGCCTCCCGGG + Intergenic
1148156532 17:45427944-45427966 TGGGCAGTCTCCTTCCTCTTTGG + Intronic
1148237721 17:45980535-45980557 TAACCTGGCTTCTTCCTCCAGGG + Intronic
1148323152 17:46769596-46769618 TGTCCACCCTCCTTCCTCCTTGG - Intronic
1148565035 17:48627544-48627566 AGCCCAGGCTCCTTCCTCTTTGG - Intronic
1148766672 17:50043711-50043733 TGCCCTGTCTCCCTCCTCCAGGG + Intergenic
1148885910 17:50772579-50772601 TAGCTTGGCTGCTTGCTCCTAGG + Intergenic
1149361532 17:55900490-55900512 TTGCCTGGCTCCTTCCTATATGG - Intergenic
1149604878 17:57917397-57917419 TGGCCTTGCCCCTTCGTCCCAGG - Intronic
1150388210 17:64776591-64776613 TGGGCAGTCTCCTTCCTCTTTGG + Intergenic
1150484886 17:65536928-65536950 CGACCTGTCTCCTTCCTCCCGGG + Exonic
1150500938 17:65650264-65650286 TGGCCAAGCTCCCTCCCCCTGGG - Intronic
1150600424 17:66646218-66646240 GGGCCTGGTTACTCCCTCCTCGG + Intronic
1150791244 17:68201360-68201382 TGGGCAGTCTCCTTCCTCTTTGG - Intergenic
1151442072 17:74135959-74135981 TGGCCTTGCCTCTTCCTGCTGGG - Intergenic
1151565236 17:74893816-74893838 CGGCCTGGCTCCTCCCTCCGCGG - Intergenic
1151826919 17:76528964-76528986 CGGCCTGTCTCGTCCCTCCTCGG + Intronic
1152101627 17:78304951-78304973 GGTCCTGGCTGCTTCCTGCTGGG + Intergenic
1152229991 17:79109632-79109654 AGGCGTGGGTCTTTCCTCCTCGG + Intronic
1152250868 17:79211983-79212005 TGGCCTGGCCACAACCTCCTGGG - Intronic
1152286247 17:79414891-79414913 TGCCCTGGCTCCCGCCACCTCGG - Intronic
1152424004 17:80209169-80209191 TGGCCTTGCCCCTGCCTCCTGGG + Exonic
1152483762 17:80575226-80575248 AATCCTGGCTCCTTCCGCCTTGG + Intronic
1152600800 17:81261206-81261228 TGGCCCGGCTCCTGCCACCCCGG + Intronic
1152805203 17:82352410-82352432 TGGTCTGGATCCTACCTCCTAGG - Intergenic
1152860277 17:82692354-82692376 AGGCCTGGATTCTCCCTCCTGGG - Intronic
1152914940 17:83029454-83029476 TCCCCTGCCTCCTTCCGCCTGGG - Intronic
1152922478 17:83072945-83072967 TGGCCTCGCTCCTGCCTGCCTGG + Intergenic
1154051381 18:10962458-10962480 AGGGCTCGCTCCTTGCTCCTTGG + Intronic
1154470837 18:14699399-14699421 ATGCCTGCCTCCCTCCTCCTGGG + Intergenic
1156042292 18:32836075-32836097 TTCCCAGGCTCCTGCCTCCTAGG - Intergenic
1156509157 18:37621001-37621023 TGCCCTGGCTTCTTCCTTCATGG + Intergenic
1157538988 18:48485765-48485787 AGGCCTTGCTGCTTCTTCCTTGG + Intergenic
1160009220 18:75090719-75090741 TGGCCTGGCTTCTTTCTTCCCGG + Intergenic
1160458711 18:79021164-79021186 TGGCCTGGCGTGTTCCACCTGGG - Intergenic
1160835895 19:1124302-1124324 TAGCCGGGCACCTTCCTCCCGGG - Intronic
1161252786 19:3290082-3290104 TGGCCAGGCCCCTTCTTTCTGGG + Intronic
1161332988 19:3697104-3697126 TCGTCTGGCTCGGTCCTCCTTGG - Intronic
1161589361 19:5122133-5122155 GGGCAGGGCTGCTTCCTCCTGGG + Intronic
1161771868 19:6235328-6235350 TGGCCACGGTCCTGCCTCCTAGG + Intronic
1162567319 19:11451619-11451641 TGGCCTGGCCCCTGCCCCCCAGG + Exonic
1162744326 19:12790300-12790322 GGGCCGGGCTCCTTCCCCCGGGG + Intronic
1162908190 19:13835836-13835858 TGACCTGGCCCCTTCTTGCTGGG - Intergenic
1162967324 19:14162046-14162068 TGGCTATGCTCCTTCCTTCTGGG + Intronic
1163328062 19:16618051-16618073 TGGCCTGGCTTCTTCCCCTTCGG - Intronic
1163491189 19:17618035-17618057 AGGCCTGGCTTCTCCCACCTTGG + Intronic
1164617583 19:29676106-29676128 TGGCCTAGCACCATCCTCCTGGG + Intergenic
1165227491 19:34365209-34365231 TGCCGGCGCTCCTTCCTCCTCGG + Intronic
1165312461 19:35037131-35037153 TGGCATGGCTCATTCCTCAGGGG - Intronic
1165404774 19:35622871-35622893 TGGCCTGGCTGCTCCCACCTGGG - Exonic
1165818014 19:38654965-38654987 TGTGCTGGCTCCTTCCTTCCTGG + Intronic
1165841812 19:38792650-38792672 TGGCCTGGCTCCTCGGTCCCCGG - Intergenic
1165901784 19:39172686-39172708 TGGCCAGGCTGCTGCCCCCTGGG - Intronic
1166753031 19:45173777-45173799 TCCCCTCACTCCTTCCTCCTGGG - Intronic
1166766449 19:45254209-45254231 TGGCCTGGCTCCCTCCCGCCCGG - Intronic
1166791308 19:45400296-45400318 TGGCCTAGCTCCCTCCCACTGGG - Intronic
1166835864 19:45667616-45667638 TGTCCTGGCTCTACCCTCCTGGG + Intergenic
1168063846 19:53908606-53908628 TGGCCCGGCTCCTGGCTCCGCGG + Intergenic
925098102 2:1223675-1223697 ACGCCTGGCTCCTCCCTCTTTGG - Intronic
925214739 2:2084680-2084702 TGGGCTGGATCCTCCCTCATAGG - Intronic
925844126 2:8020418-8020440 TGGCCTGGCCCCTCCCTACAAGG - Intergenic
926144086 2:10386295-10386317 TGGGCTTGGTCCTTCCTCCCTGG + Intronic
926751683 2:16203232-16203254 TGGCAGAGCTTCTTCCTCCTCGG - Intergenic
926794079 2:16604434-16604456 GGGCTGGGCCCCTTCCTCCTGGG - Intronic
928906843 2:36377218-36377240 TGGCCCTGTTGCTTCCTCCTTGG + Intronic
929562045 2:42962118-42962140 TCGCCTGCCTCCTCCCTCCAGGG + Intergenic
929568850 2:43007069-43007091 TGGCCTGCTCCCTTCCTCCTTGG - Intergenic
930869051 2:56151428-56151450 TGGCCTTGCTGCTTACGCCTGGG + Intergenic
931261985 2:60628211-60628233 TTGCCCAGCTCCTTCCTCCTCGG - Intergenic
931721352 2:65069744-65069766 TGGCCTGCCTCCTGCCACCATGG + Exonic
932447850 2:71791639-71791661 TTGCCTGGCTTCTTCCACCCAGG + Intergenic
932810662 2:74823036-74823058 GGCCCTGGCTCATTCCTGCTGGG + Intergenic
933607031 2:84393952-84393974 ATGCCTGGCTCCTTCCTCCTTGG + Intergenic
933708802 2:85310196-85310218 TGGTCTGGCTCCTGTCACCTGGG + Exonic
933976717 2:87517999-87518021 TGAGCAGGCTCCATCCTCCTTGG + Intergenic
934568680 2:95354578-95354600 TGCCCTTGCTCCTCCATCCTGGG + Intronic
934574508 2:95391616-95391638 TGGCCTTGCTCTTTTTTCCTTGG - Intergenic
936317100 2:111432805-111432827 TGAGCAGGCTCCATCCTCCTTGG - Intergenic
936381679 2:111992138-111992160 GTGCGTGGCTCCTTCCTCCAGGG - Intronic
937911529 2:127077963-127077985 TGGGCTGGCCCTTTGCTCCTGGG - Intronic
939143193 2:138379548-138379570 TGGCCTGGAGGCTTCATCCTTGG - Intergenic
940178376 2:150904379-150904401 TTTCCTGGCTCCTTCCAGCTGGG + Intergenic
941674386 2:168328423-168328445 TGGCATTGCTCCTGGCTCCTGGG + Intergenic
943735495 2:191349143-191349165 TGGCATGGCTCCTGCCTTCAAGG - Intronic
946255782 2:218440848-218440870 TGACCTACCTCCTTCCTGCTGGG - Exonic
947791509 2:232871812-232871834 GGCCCTGGCTCCTGCCTGCTGGG + Intronic
947875788 2:233467541-233467563 TGCCCTGCCTGCTCCCTCCTGGG + Intronic
947884196 2:233551811-233551833 TGGCCTTTCACCTTCATCCTTGG + Intronic
948237367 2:236400941-236400963 TGCCCTGGCCCCTTGCTCCAAGG + Intronic
1169195828 20:3681628-3681650 GGGCATGGCTCCCTCCCCCTCGG - Intronic
1170677673 20:18497282-18497304 AGGCCGGGCTCTTTCCTCCTTGG + Intergenic
1171135641 20:22692247-22692269 TTGCCTGGAAGCTTCCTCCTTGG + Intergenic
1171401469 20:24875288-24875310 TGGGCTGGCTGGTCCCTCCTGGG - Intergenic
1171783895 20:29445673-29445695 TGGCCTTGCCTCTTCCTCCAGGG + Intergenic
1172042179 20:32053059-32053081 TGCCCTGTCTCTTTCCTCCTTGG + Intronic
1173091459 20:39975975-39975997 TGTCCTGGCCCTTTCCCCCTGGG - Intergenic
1174390150 20:50213977-50213999 ATGCCTGACTTCTTCCTCCTAGG + Intergenic
1174509628 20:51041274-51041296 TGGCCTGCATCCCTTCTCCTTGG + Intergenic
1174536185 20:51253395-51253417 TGACCTGGCCCCTTCATCCCAGG + Intergenic
1174572208 20:51509874-51509896 TGTCCAGGCTACTGCCTCCTGGG - Intronic
1175534742 20:59701409-59701431 TTGCCTGGCTGCTGCCTCTTTGG + Intronic
1175848087 20:62069581-62069603 TAGCCTGGCCCCTTCACCCTGGG + Intergenic
1175963993 20:62651114-62651136 TGGCCTGGCTCCTGCCATCCAGG - Intronic
1175986586 20:62766919-62766941 TGCTCCAGCTCCTTCCTCCTTGG - Intergenic
1176031581 20:63015564-63015586 TTGCCTGGCTCCTTGCTATTTGG + Intergenic
1176061268 20:63173950-63173972 CGGCCTGGCCCCCTCCTCCCTGG - Intergenic
1176064911 20:63189270-63189292 TTGTCTGGCTTCTTCCTGCTGGG - Intergenic
1176108021 20:63398722-63398744 AGGCCTGGCTCCTGGCTCCTGGG - Intergenic
1176803646 21:13458538-13458560 AGGCCTGCCTCCCACCTCCTGGG - Intergenic
1177735302 21:25081732-25081754 TGGCTTAGCACCATCCTCCTTGG - Intergenic
1178637827 21:34320510-34320532 TTGCCTGGCTCCTTAGTTCTTGG + Intergenic
1178777390 21:35565323-35565345 TGACATGGCTGCCTCCTCCTCGG - Intronic
1178906879 21:36643933-36643955 AGGCCTGGTTCCTTCCCCCCAGG + Intergenic
1179542022 21:42089195-42089217 TAGCCTGGCTGCCTCCTGCTTGG - Intronic
1179642452 21:42756579-42756601 TGGCCTGCCTCTATCCTCCGAGG + Intronic
1179642466 21:42756626-42756648 TGGCCTGCCTCTATCCTCCGAGG + Intronic
1179915978 21:44478616-44478638 TTGTCTGCCTCCTTCCTCCCTGG + Intergenic
1179946671 21:44682816-44682838 AGCGCTGGCCCCTTCCTCCTCGG - Intronic
1180143898 21:45909211-45909233 TGGCCTGGCCACTTTGTCCTCGG + Intronic
1180232734 21:46437108-46437130 TGGCCTGGCTCCTCCCCCAGAGG + Intronic
1180695080 22:17746801-17746823 TTGCCCGGCTGCTTCCTTCTGGG - Intronic
1180752043 22:18131244-18131266 GGGCCAGGCACCCTCCTCCTGGG - Exonic
1180873499 22:19162049-19162071 GTTCCTGGCTCCTTCCTCATGGG + Intergenic
1180945057 22:19688257-19688279 TGGCTTCCTTCCTTCCTCCTGGG + Intergenic
1181522707 22:23458738-23458760 CGGCCTGGCTCCATCCAGCTTGG - Intergenic
1181542299 22:23580007-23580029 TGGACCGGCTGCTTCCTCCAGGG + Exonic
1182426908 22:30278425-30278447 TGCCCTGGCTCCCTCAGCCTTGG - Intergenic
1183296047 22:37030177-37030199 TGGGCTGGGACATTCCTCCTTGG - Intergenic
1183422420 22:37719698-37719720 TGGTCTGCCTCCTTCCTCACGGG + Intronic
1183615646 22:38943620-38943642 TGTGCTGACTCCTTCCTGCTTGG + Intergenic
1183708975 22:39491437-39491459 TGGCCTGGGGCCTCCCTCCTTGG + Exonic
1184202365 22:42979653-42979675 TTCTCTGGCTCCTTCCTCCTGGG + Intronic
1184235912 22:43182965-43182987 TGGCCAGGCTCCTACCTGTTGGG + Exonic
950015345 3:9751041-9751063 TAGCCTGGCTCTTGTCTCCTCGG - Exonic
950253192 3:11484072-11484094 TGGCCTATCACCTTCCTCTTAGG - Intronic
950307595 3:11928404-11928426 TTGCCAGGCTCCTTCCTCCTGGG + Intergenic
950331140 3:12157275-12157297 TGGCCTGGCTCAGTAATCCTTGG - Intronic
950649128 3:14396380-14396402 AGGTCTGGCTCCTTCTCCCTAGG - Intergenic
951574819 3:24102778-24102800 TGGCCTGGTCCCTTCCTCATGGG + Intergenic
951581353 3:24167514-24167536 AGGCCTGGATCCTTTTTCCTGGG - Intronic
952393903 3:32904127-32904149 TGGACTTGTTCATTCCTCCTGGG - Intergenic
952884449 3:38003886-38003908 TGGCTTGCCTCCTTCCACTTTGG + Intronic
952884792 3:38005869-38005891 TGGCCGGGCTCCTCCCTGCTGGG - Exonic
953046605 3:39298497-39298519 TGGCCTGCCTTCTGCCTCCCAGG - Intergenic
953885750 3:46713515-46713537 TGGCCTGTCTCCTGTCTCCCAGG - Intronic
954535986 3:51359596-51359618 TGGCCAGGCTCCAGCCTGCTTGG - Intronic
954709085 3:52496097-52496119 TGGCCTGTCCCCATCATCCTAGG - Intronic
954711922 3:52509411-52509433 TGGCCTTCGTCCCTCCTCCTGGG - Intronic
954711945 3:52509497-52509519 TGGCCTTCGTCCCTCCTCCTGGG - Intronic
954715645 3:52525411-52525433 TGGCCTTGCTGCTCCCTCCCTGG + Intronic
954873857 3:53787771-53787793 TGCCCTGCCTCCTTCATCCACGG - Intronic
954918460 3:54168649-54168671 TGGCCTGGTCCCATGCTCCTAGG - Intronic
955617795 3:60827214-60827236 TGACCTGAATACTTCCTCCTGGG + Intronic
955939253 3:64132382-64132404 TGTCCTGGCTCCCTCCTGCTAGG + Intronic
960647190 3:119899192-119899214 TGTCCTGCTTCATTCCTCCTGGG - Intronic
962426538 3:135273663-135273685 TGGCCTGACTGCTGCCTCCTTGG + Intergenic
962686489 3:137852825-137852847 CGGCATTGTTCCTTCCTCCTGGG - Intergenic
965289889 3:166865366-166865388 TGCCCTGAGTCCCTCCTCCTCGG - Intergenic
965609000 3:170525502-170525524 TGGCCTGGCTTCCTTCTCCTTGG + Intronic
966410381 3:179641083-179641105 TGGCTTAGCACCATCCTCCTTGG + Intergenic
967956448 3:194881028-194881050 TTGCTTTGCTACTTCCTCCTTGG + Intergenic
968704807 4:2072884-2072906 TGGCCTGGCTCTTTTGCCCTGGG + Intronic
969519358 4:7666809-7666831 TGGCCTGTCTCCTTCTCCATCGG + Intronic
969870185 4:10099677-10099699 TGGCCTGGCGGCCTCCACCTGGG + Intronic
969968935 4:11026365-11026387 TGGCCTGGCCCCATCCTCACAGG + Intergenic
970352967 4:15224146-15224168 TGGCTTTGCTCTTTCCTCTTAGG - Intergenic
970646486 4:18127264-18127286 TGGCCTGGCTCTTTAATCTTTGG + Intergenic
971343491 4:25791607-25791629 AGGCCTGGCTCCTTCTTCTCTGG - Intronic
971492200 4:27224980-27225002 TGGCCTGACTACTTTCCCCTGGG - Intergenic
972368270 4:38396127-38396149 TTGCCTGAGTCCTTCCTCCAGGG + Intergenic
973679934 4:53306977-53306999 TTGCCTGGCTTCTTCCTGCCAGG - Intronic
973943384 4:55932896-55932918 TGCCATGGATCCTTCCTGCTGGG + Intergenic
975302944 4:72812802-72812824 TTGCCTGACTCCTTCCTCTTTGG + Intergenic
975862386 4:78691360-78691382 TGGTCTTGCTGCTTCCTCCCTGG + Intergenic
976634033 4:87269569-87269591 TGGCCTTGATCCTCCCACCTTGG + Intergenic
978554744 4:109967770-109967792 TGGTCTAGCTTCTTGCTCCTAGG + Intronic
979674962 4:123399575-123399597 TGCGCTGGCTTCTTTCTCCTCGG + Intronic
982047017 4:151458315-151458337 AGGCCTGGCTTCTTCCCCCAAGG - Intronic
982722329 4:158871374-158871396 TGGCCTGTTACCTACCTCCTTGG + Intronic
984827785 4:183942742-183942764 TGGCCTGCCTCCATTCTCCTAGG - Intronic
985630385 5:1010867-1010889 TGGCCTGGAGCCTTCTCCCTGGG + Intronic
985846610 5:2354214-2354236 TGGCCTGGCTCTGGCCTCCCTGG + Intergenic
985931829 5:3064465-3064487 TGTCCTGGATGCTTCCTCTTAGG - Intergenic
986706820 5:10459659-10459681 ATGACTGGCTCCTTCCCCCTGGG + Intronic
986827062 5:11533365-11533387 TCTCATGGCTCCTTCCACCTAGG + Intronic
987284635 5:16443562-16443584 TGGCCCCTCTCCTTCCTCCCTGG + Intergenic
989364528 5:40640703-40640725 TCTCCTGGAGCCTTCCTCCTTGG - Intergenic
989438828 5:41446263-41446285 TTGCTTGGCTCCTTCCTACCAGG + Intronic
990602094 5:57369317-57369339 TGCCCTGACTCTTTCTTCCTTGG + Intergenic
990793911 5:59518462-59518484 TGTCCTGCCCCCCTCCTCCTGGG - Intronic
992385512 5:76280670-76280692 TGGCCTGGCTGCTTTCCCCGGGG + Intronic
992458427 5:76938208-76938230 TGGCTTCACTCTTTCCTCCTGGG + Intergenic
992822120 5:80507859-80507881 TGGCTACGCTCCCTCCTCCTTGG + Intronic
995220612 5:109643427-109643449 TGGCCTGGCCCTTTCCTCTTCGG - Intergenic
995442335 5:112205831-112205853 TAGCCCAGGTCCTTCCTCCTTGG - Intronic
995494896 5:112731417-112731439 TGTCCTTCCTCCTTCCACCTTGG - Intronic
997282515 5:132657616-132657638 TGGCTTGCCTAATTCCTCCTTGG - Intronic
997725402 5:136116336-136116358 TCGAGTGGCTCCTTCCTTCTAGG - Intergenic
999443776 5:151622627-151622649 TGGCCTGGCTTCTGCCTGCCTGG - Intergenic
999938274 5:156512431-156512453 TGGCATGGCCTATTCCTCCTAGG - Intronic
1001834765 5:174822617-174822639 TGCACTTGCTCCTTCTTCCTAGG - Intergenic
1002279529 5:178122325-178122347 TGGGCTGGGGCCTTCCTCCAGGG + Exonic
1003052840 6:2795718-2795740 AACCTTGGCTCCTTCCTCCTTGG + Intergenic
1003366569 6:5480797-5480819 TATCCTTCCTCCTTCCTCCTAGG + Intronic
1003870599 6:10399601-10399623 TGGGCTGGCTCCCTTCTCCAAGG + Intronic
1004540680 6:16546966-16546988 GGGCCTGCCTTTTTCCTCCTTGG - Intronic
1004934083 6:20490730-20490752 TGTCCTTCCTCCTTCCTCCCCGG + Exonic
1005591517 6:27333308-27333330 TTGCTTGGCGCCCTCCTCCTAGG - Intergenic
1006296731 6:33173173-33173195 TGCCTGGGATCCTTCCTCCTGGG - Intronic
1007210003 6:40185773-40185795 TGTCCTGACTACTCCCTCCTGGG - Intergenic
1007684272 6:43655965-43655987 TTTCCTATCTCCTTCCTCCTTGG + Intronic
1007687628 6:43676413-43676435 AACCCTGGTTCCTTCCTCCTTGG - Intronic
1007709397 6:43812187-43812209 TGGCATGTCTCCCTCCTCCAAGG - Intergenic
1007828144 6:44617265-44617287 TGGCTTGGCCCTTTCTTCCTAGG - Intergenic
1009982118 6:70739155-70739177 TTGCTTTGATCCTTCCTCCTGGG + Intronic
1011633830 6:89352580-89352602 TGGCTTGGCTCCGGCCTCCCGGG + Exonic
1012857824 6:104523866-104523888 TCTCCCGTCTCCTTCCTCCTAGG - Intergenic
1014266639 6:119285336-119285358 TGGCTTGGTGCCTTCCTCCAGGG - Intronic
1014445827 6:121526376-121526398 TTGCAAGGCTCCTTCCTCCTTGG + Intergenic
1017349676 6:153425715-153425737 TCACCTACCTCCTTCCTCCTGGG + Intergenic
1017500607 6:155019647-155019669 TGGCCTGACTTCTTGCTCGTGGG + Intronic
1017827888 6:158095873-158095895 GGGGCTGACTTCTTCCTCCTCGG - Exonic
1017861175 6:158398482-158398504 TGCCCATGCTCCTTCCTCATAGG - Intronic
1018171550 6:161147159-161147181 TGCCCTGGCTACTTCCATCTGGG - Intronic
1018701422 6:166430438-166430460 AGGCATGGCTCCTACCCCCTGGG + Exonic
1019104368 6:169656618-169656640 CTTCTTGGCTCCTTCCTCCTGGG - Intronic
1019588618 7:1817799-1817821 CGGCCTGGCTCCATCCAGCTTGG + Intronic
1019695033 7:2440923-2440945 GGGCCTGGCTTTTTCATCCTAGG - Intergenic
1019994505 7:4715432-4715454 TGCCCTGCCTCCCTCCTTCTAGG + Intronic
1021358431 7:19683220-19683242 TGGCCTGGATTCTCCCACCTGGG + Intergenic
1022216928 7:28272548-28272570 TGGCCTTCCTCCTTCCTCTGGGG + Intergenic
1022332439 7:29392680-29392702 TGGCCTAGCTCCATCCTCCAAGG - Intronic
1022516119 7:30976001-30976023 AGACCTGGCCCCTTCCTTCTAGG + Intronic
1023018332 7:35987346-35987368 TGGCCTGGAGCCCTTCTCCTTGG + Intergenic
1024123793 7:46271158-46271180 TGGCCTGGCCCCATCTCCCTGGG - Intergenic
1024816552 7:53277741-53277763 TGGCCTTGCCCATTTCTCCTAGG + Intergenic
1026570988 7:71530641-71530663 TTGGCTGCCTCCTGCCTCCTGGG + Intronic
1029273868 7:99392948-99392970 GGGCCTGGAGTCTTCCTCCTGGG + Intronic
1029490608 7:100868088-100868110 TGCCCTGGCTCCATCCTCAGGGG + Exonic
1029529624 7:101116772-101116794 TCGCCTGGCCTCTTCCTGCTTGG - Intergenic
1030672322 7:112351506-112351528 TGGCCTCCCTCCTTCCTCTCTGG + Intergenic
1032344797 7:131107751-131107773 TTGCCTCGTTCCTTCCTCCCGGG + Intergenic
1032402544 7:131633809-131633831 AGGCCTGGAACATTCCTCCTCGG - Intergenic
1032797423 7:135288970-135288992 GGGCCTGACTCCTTCCTCCTGGG - Intergenic
1032803511 7:135335174-135335196 TGTCATGGCTCCTGCCTCCAGGG - Intergenic
1033249516 7:139746772-139746794 TGGCTCAGCTCCTTCCTTCTAGG + Intronic
1033536606 7:142318244-142318266 TCTCCTGGCTCCTTCCTCAGGGG - Intergenic
1034274951 7:149819938-149819960 GGGCCTGGCTGCTACCTCATGGG + Intergenic
1034430572 7:151039262-151039284 TGGGCTGGCTCCTTCCTGCCTGG + Intronic
1034976170 7:155450255-155450277 TGGCCGAGCTCCTGTCTCCTAGG - Intergenic
1035068027 7:156122104-156122126 TGACCTGTCCCCGTCCTCCTGGG - Intergenic
1035376124 7:158407564-158407586 TGTCCTGGGTCCTGCGTCCTGGG + Intronic
1035483625 7:159205644-159205666 TGGGCTGCCTCCTTCCCGCTGGG - Intergenic
1035628845 8:1093075-1093097 AGGCCGAGCTCCTTCCTCCTTGG + Intergenic
1037967848 8:23147478-23147500 TGGCCAGGCTCTCTCCTCCCGGG - Intronic
1038007120 8:23441421-23441443 CGTCCTGTCTCCTTTCTCCTGGG + Intronic
1038333692 8:26629594-26629616 TTGCCTGCCTCCCTCATCCTCGG - Intronic
1039758940 8:40553147-40553169 TTCCATGGCTCTTTCCTCCTAGG - Intronic
1040481700 8:47832934-47832956 AGGCCTGGTGCCATCCTCCTTGG - Intronic
1040982960 8:53264282-53264304 TGGCTGGGCTGCTTCCTTCTGGG - Intergenic
1043501927 8:80866900-80866922 TGGCTTGGCTCCTCCCTACTAGG + Intronic
1043734254 8:83724257-83724279 GGACCTGCCTCCTTCCACCTAGG + Intergenic
1045350416 8:101333121-101333143 GGCGCTGGCTCCTTCCTGCTGGG + Intergenic
1045800096 8:106092341-106092363 TGGGCTGGCTCCTGACTTCTTGG + Intergenic
1046313756 8:112473757-112473779 TGGCCCTGCTCCTTCACCCTTGG + Intronic
1047452945 8:124982912-124982934 TTGCTTGGCTACTTTCTCCTTGG + Intergenic
1048854197 8:138672825-138672847 AGGACTTGCTCCTTCCTACTCGG - Intronic
1049352782 8:142172958-142172980 TGGCAGGGCTGGTTCCTCCTGGG - Intergenic
1049400517 8:142424714-142424736 TGCCCTGCCTCCTTCCTGCCCGG + Intergenic
1049606210 8:143530313-143530335 TGGCCTGCCCCCTTCCCCCGTGG - Intronic
1049750706 8:144282333-144282355 TGGCCTGGTTCCTACTCCCTGGG - Intronic
1049775435 8:144401753-144401775 AAGCCTGGCCCCTGCCTCCTGGG + Intronic
1050106356 9:2170345-2170367 CCGCCCGGCTCCTTCTTCCTAGG - Intronic
1050780719 9:9331355-9331377 TTGCCTGGCTCATTCTTTCTCGG + Intronic
1052864463 9:33456724-33456746 TGGCCTCGCTTCCTCCTCCATGG - Intergenic
1054451270 9:65404633-65404655 TGCCCTGGCTGATGCCTCCTGGG + Intergenic
1056180341 9:84076578-84076600 AGGACTGGCTCCTTCCTTCAAGG - Intergenic
1056913838 9:90728230-90728252 TGGCCTTGCTCACTCCACCTTGG + Intergenic
1057125560 9:92613519-92613541 TATCCTGGTTCCTGCCTCCTGGG + Exonic
1057198111 9:93126380-93126402 TGGCCTGGCTGCCCCCACCTGGG + Intronic
1057231498 9:93324313-93324335 GGGCCCGGCTCCGTCCTCCTAGG + Intronic
1057236595 9:93366304-93366326 GGGCCCGGCTCCGTCCTCCTAGG - Intergenic
1057701608 9:97366777-97366799 TGGCCTGGATCCTCCCCTCTGGG + Intronic
1059403412 9:114084959-114084981 TCGGCTGGCTCCTTCCTCCAGGG - Intergenic
1060134307 9:121136883-121136905 TTCCCTGACTACTTCCTCCTTGG - Intronic
1060212071 9:121716686-121716708 TGCTCTTGCTCCTGCCTCCTTGG + Intronic
1060522980 9:124304344-124304366 TAGCCTGGCTCCTTCCTCTGAGG - Intronic
1060770523 9:126328408-126328430 TGCCCTGTCTCCATCCTGCTAGG + Intronic
1060800868 9:126545292-126545314 AGGCCTGGCCCCTTGCACCTTGG + Intergenic
1061139279 9:128754456-128754478 TGGCTTGGCTGCTTCCTACCTGG + Intronic
1061747810 9:132753141-132753163 TGGCCTGGCTCCTTCCTCCTGGG - Intronic
1061898011 9:133658549-133658571 TGGTCTGGCCCCTTCATCCTGGG - Exonic
1061978495 9:134086054-134086076 GGTCCTGGCTCCTTCCCCATGGG + Intergenic
1062006197 9:134239695-134239717 TGGCCTGGCTCCGGCCAGCTGGG - Intergenic
1062021095 9:134319739-134319761 AGGCCTGGCCCCATCCTCCCGGG - Intronic
1062129533 9:134885146-134885168 TGGCCCTGCTTCTTCCTCCCAGG + Intronic
1062133602 9:134913214-134913236 TGGCCCTCCTCCTCCCTCCTGGG - Intronic
1062278406 9:135741307-135741329 TGGCTGGGCTCCTCCCTGCTGGG - Intronic
1062528878 9:136991121-136991143 AGTCCTGGCTCCTGCCCCCTGGG - Intergenic
1062573429 9:137195753-137195775 TGGCCTGGCTCCTACCTGTCTGG - Intronic
1203654383 Un_KI270752v1:8695-8717 TGGCCTGGCTACGTTCACCTTGG - Intergenic
1186437519 X:9555806-9555828 GGGCCTGACTCCTTTCTCCCAGG - Intronic
1186830986 X:13390033-13390055 TGGCTTGGCACCATCCCCCTTGG + Intergenic
1187873333 X:23782834-23782856 TGACCTTGCTCTTTTCTCCTTGG - Intergenic
1188013370 X:25081164-25081186 TAGAGTGGCTCTTTCCTCCTGGG - Intergenic
1188714124 X:33439980-33440002 TGGCTTGACACCTTCCCCCTAGG - Intergenic
1189095821 X:38138295-38138317 AAGCCTGGCTCCCTCCTGCTGGG + Intronic
1189165595 X:38857839-38857861 AGGCCTGGCTGCTTCATCCCTGG - Intergenic
1190227718 X:48559136-48559158 TGGCCTCCCTCCCTCCTCATAGG + Exonic
1190242389 X:48667656-48667678 TGCCCTCCCTCCTTCCTCTTAGG + Intergenic
1194487918 X:94509342-94509364 TAGCCTTGCTCATTCCTACTGGG - Intergenic
1196103778 X:111874481-111874503 TGTCCTTTCTCCTTCCTTCTAGG + Intronic
1197962723 X:132023545-132023567 CGGACTGGCTCCTCCCTCCGGGG - Intergenic
1198766037 X:140080146-140080168 TGCCCTGGATTCTTCCTCTTAGG + Intergenic