ID: 1061747811

View in Genome Browser
Species Human (GRCh38)
Location 9:132753142-132753164
Sequence GTGGCCTGGCTCCTTCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 431}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061747811_1061747814 -1 Left 1061747811 9:132753142-132753164 CCAGGAGGAAGGAGCCAGGCCAC 0: 1
1: 0
2: 2
3: 57
4: 431
Right 1061747814 9:132753164-132753186 CTGTTGACCTCCTTTTGTCCTGG No data
1061747811_1061747819 10 Left 1061747811 9:132753142-132753164 CCAGGAGGAAGGAGCCAGGCCAC 0: 1
1: 0
2: 2
3: 57
4: 431
Right 1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG No data
1061747811_1061747815 0 Left 1061747811 9:132753142-132753164 CCAGGAGGAAGGAGCCAGGCCAC 0: 1
1: 0
2: 2
3: 57
4: 431
Right 1061747815 9:132753165-132753187 TGTTGACCTCCTTTTGTCCTGGG No data
1061747811_1061747816 1 Left 1061747811 9:132753142-132753164 CCAGGAGGAAGGAGCCAGGCCAC 0: 1
1: 0
2: 2
3: 57
4: 431
Right 1061747816 9:132753166-132753188 GTTGACCTCCTTTTGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061747811 Original CRISPR GTGGCCTGGCTCCTTCCTCC TGG (reversed) Intronic
900014680 1:139683-139705 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
900044547 1:494885-494907 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
900044946 1:498292-498314 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
900065951 1:729791-729813 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
900066350 1:733200-733222 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
900066746 1:736606-736628 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
900067144 1:740022-740044 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
900344449 1:2204467-2204489 GTGGCCTGGCGGCTTTTTCCTGG - Intronic
900464086 1:2815630-2815652 GACGCCTGCCTCCTTCCGCCGGG - Intergenic
900534464 1:3170223-3170245 GCAGCCTGGCTGCTTCCCCCAGG + Intronic
900580643 1:3407041-3407063 GGGGCCTGGCTCCTGGCCCCCGG + Intronic
900694941 1:4004024-4004046 GCGGCCTGGTTCCAGCCTCCTGG - Intergenic
901138764 1:7014408-7014430 GGAGACTGGCTCCTTCTTCCTGG + Intronic
902295390 1:15463444-15463466 CTGGCCTGCCTCCCTCCTGCCGG + Exonic
902298282 1:15483322-15483344 CTGGCCTGCCTCCCTCCTGCCGG + Exonic
902680268 1:18038774-18038796 CTGGCATTGCTCCTTCATCCAGG - Intergenic
902787723 1:18744081-18744103 GTGTCCTGGCTCCTTCTGCATGG + Intronic
903098119 1:21000292-21000314 GTGGCCTCTGTCCTTCCTTCAGG - Intronic
903127842 1:21259814-21259836 GTGGCCTGGGTCCCTGCTCACGG + Intronic
904117236 1:28171836-28171858 CTGGCCTGGGTCTCTCCTCCTGG + Intronic
904265290 1:29315218-29315240 GCGTCCTGGCTCCTTACTCGGGG + Intronic
904811923 1:33168993-33169015 GCGGGCTTGCTCCTTCCTCCTGG + Intronic
905240123 1:36576043-36576065 GTTCCCTGGCTCCTTGCTCATGG - Intergenic
905262867 1:36731601-36731623 CAGTCCTGCCTCCTTCCTCCTGG + Intergenic
905356829 1:37390597-37390619 GTGGCCTGGCTCCTCCCACTGGG + Intergenic
905642060 1:39596801-39596823 ATGGCTTGGCCTCTTCCTCCTGG + Intergenic
907592122 1:55685395-55685417 CTGCCCTGGCTCCCTTCTCCAGG - Intergenic
910093723 1:83496048-83496070 GAGGCCATGCTACTTCCTCCAGG + Intergenic
910716355 1:90235752-90235774 GTGGCCTGGCACATCCCTCGTGG - Intergenic
911069575 1:93821996-93822018 CTTGCTTGGCTCCTGCCTCCAGG - Intronic
913140026 1:115931864-115931886 ATGGTTTAGCTCCTTCCTCCTGG + Intergenic
914510533 1:148328675-148328697 GAGGGCTGGGTCCTTCCTGCAGG + Intergenic
915665950 1:157445664-157445686 CTGGAGTTGCTCCTTCCTCCTGG + Intergenic
916818153 1:168372996-168373018 GTGGCCTGGCCCCTCACTCATGG + Intergenic
917165632 1:172109428-172109450 ATGACATGGTTCCTTCCTCCAGG - Intronic
917549447 1:176008685-176008707 GTGGACTCGGTTCTTCCTCCTGG + Intronic
918175798 1:182043957-182043979 GTGGCCTCACTCCTACTTCCTGG + Intergenic
918438332 1:184540457-184540479 TGGGTCTCGCTCCTTCCTCCAGG + Intronic
919810114 1:201404025-201404047 GTGTCCTGGTTACTTCCTCCAGG + Intronic
920209880 1:204320373-204320395 AGGGCATGGCTCCTTCCTCAGGG - Intronic
921958608 1:221010976-221010998 GAGGCCTGCCCCTTTCCTCCTGG + Intergenic
922262175 1:223952278-223952300 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
922909965 1:229207143-229207165 GTGGCCCTGCTCCTCCCTCTAGG + Intergenic
923349886 1:233093689-233093711 GTGGCCAGCCTCCAGCCTCCAGG + Intronic
924344000 1:243057257-243057279 TTGGCCCAGCTCCTACCTCCTGG - Intergenic
924464557 1:244288236-244288258 CTGGCCTAGCTCCTTCCTTTGGG + Intergenic
1063008458 10:1997454-1997476 GCTGCCTGGCTCAGTCCTCCAGG + Intergenic
1063120551 10:3102855-3102877 GAGGCCTGGCTGCTTCCAACGGG - Intronic
1063129180 10:3162735-3162757 GTGGCCTGGCTGTTCCCGCCTGG - Intronic
1063376755 10:5558604-5558626 GTGGCCTCGCCTCTCCCTCCTGG - Intergenic
1063665403 10:8057819-8057841 GTGGCCGGGCTCCATCCTTCAGG + Intronic
1063703307 10:8406849-8406871 GTTTCCTGGCTCCTTCCTAGGGG - Intergenic
1064960719 10:20961914-20961936 GTAGCCTGGCTGTTTCCTTCTGG - Intronic
1066654503 10:37685836-37685858 CTGGCCTGGCTCCTGGCTCCAGG - Intergenic
1066732332 10:38447806-38447828 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1067226428 10:44379218-44379240 CTGGCAGGCCTCCTTCCTCCAGG - Intronic
1067234338 10:44435694-44435716 GTCCCCAGGCTCCCTCCTCCAGG + Intergenic
1067460859 10:46457231-46457253 GTGTCCCAGCTCCTGCCTCCAGG - Intergenic
1067523751 10:47026494-47026516 GTGGCCGGGCTCCTGGCTTCCGG - Intergenic
1067626332 10:47927369-47927391 GTGTCCCAGCTCCTGCCTCCAGG + Intergenic
1068779088 10:60900054-60900076 ATGGCATGGTCCCTTCCTCCAGG - Intronic
1069215193 10:65811459-65811481 CTGGAGTTGCTCCTTCCTCCCGG + Intergenic
1069544267 10:69318036-69318058 GTGGCCTGTCCCCATCCTCTGGG - Intronic
1069935099 10:71910072-71910094 GTCTTCTGTCTCCTTCCTCCTGG + Intergenic
1069962480 10:72087201-72087223 CGGGGCTGGCTCCTTCCTCTCGG - Intronic
1070822877 10:79372980-79373002 CTGGCCTGGCTGCTTTCTCTTGG - Intergenic
1071415546 10:85437641-85437663 ACAGCCTGGCTCCTTCCTGCAGG + Intergenic
1071523761 10:86346618-86346640 AAGGCCTGGCTCCTGCCTCCTGG - Intronic
1072021710 10:91409825-91409847 GTGGCCTTTCGCCTTCTTCCAGG - Intergenic
1072436113 10:95415957-95415979 GTGCCCTGGTTCCTTGCTTCCGG - Intronic
1074002546 10:109387403-109387425 GTGGCCTGGGTCCCTGCTCTGGG + Intergenic
1074174062 10:110978115-110978137 GTGACCTGGAACCTGCCTCCAGG + Intronic
1074453200 10:113575966-113575988 GCTGCCTGGCTCCTTTCTCTGGG + Exonic
1075020910 10:118951872-118951894 GTAGCCTGGCAGCTACCTCCTGG + Intergenic
1075136408 10:119789887-119789909 TTCACCTGGCTCCTTCCTACTGG - Intronic
1075647321 10:124104985-124105007 GAGGCTGGGCTCCTGCCTCCTGG - Intergenic
1075726104 10:124611668-124611690 GTGGCCTGGAGGCTACCTCCTGG - Intronic
1076515718 10:131043419-131043441 CTTGCCTGCCTCCATCCTCCAGG + Intergenic
1076721913 10:132396723-132396745 GTGGCCCGGATCCTCCCGCCTGG - Intergenic
1076871466 10:133197036-133197058 GTGAACTGTCTCCTCCCTCCAGG + Exonic
1076970877 11:131360-131382 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
1076971275 11:134783-134805 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
1077465930 11:2733650-2733672 TTGGCCTGGCTCCTCCCCCAGGG - Intronic
1077474077 11:2778227-2778249 CTGGCCTGGCTCCTTCCATGGGG - Intronic
1077529727 11:3089561-3089583 CTGGGCTGGCACCTTCCTCTAGG + Intronic
1077551597 11:3202961-3202983 GGTGCCTTGCTCCCTCCTCCAGG - Intergenic
1078340495 11:10495181-10495203 GTGGTCTGGCTGCCTGCTCCAGG + Intronic
1078511166 11:11985238-11985260 GTGGCCGGGCTCCTTGGTGCTGG - Intronic
1080559602 11:33450916-33450938 TTGCCCTGACTCCTTCATCCCGG + Intergenic
1081661613 11:44892013-44892035 GTGGCCTGGCTGCTTCCCTGGGG - Intronic
1081669903 11:44937082-44937104 GTGGCCTGACTCCTTCTCCCAGG - Intronic
1083227649 11:61294942-61294964 GTGCCCGGGCGGCTTCCTCCCGG + Exonic
1083301132 11:61740133-61740155 GGGCCCTGGCTCCTCCCTCCAGG + Intronic
1084097313 11:66920241-66920263 GTAGCCTGGCACCTTTCTGCAGG - Intronic
1084106828 11:66985930-66985952 TTGGCCCTGCTCCATCCTCCAGG - Intergenic
1084769636 11:71334359-71334381 ATTGCCTGGCTCCTTCCCACTGG + Intergenic
1085028917 11:73257979-73258001 GTGGCCTCCCTCCTTCTTCCAGG + Intergenic
1088250853 11:107859702-107859724 GAGGCGTGGCTCATTCCTCGCGG + Intronic
1088971516 11:114778703-114778725 ATGGACATGCTCCTTCCTCCAGG - Intergenic
1089295442 11:117464614-117464636 TTGGCCTTCCTCCTTCTTCCTGG - Intronic
1089455019 11:118621099-118621121 TTGGCCTCACTCCTGCCTCCTGG + Intronic
1089528024 11:119109446-119109468 GGGGCCTGGCTAATTCCTCAAGG - Intronic
1090204583 11:124877382-124877404 GTGGCCATGCTCCCTCCACCTGG - Intronic
1090499990 11:127252021-127252043 ATGCCTTGGCTCCCTCCTCCAGG + Intergenic
1091344971 11:134846268-134846290 GTGGGCTGGAACCTTCCTGCAGG + Intergenic
1091705634 12:2691362-2691384 GCAGCCGGGCGCCTTCCTCCCGG - Intronic
1091795964 12:3297670-3297692 CTGGCCTCACTCCTTCCTGCAGG - Intergenic
1091868817 12:3869449-3869471 ATGGCCTGGTTCCTACCTCCTGG + Intronic
1092105389 12:5918328-5918350 GTGGCCTGGCTCATGCCTCATGG - Intronic
1093086313 12:14869579-14869601 GTGGCCTGCCTCTGTCCTCCGGG + Intronic
1093477809 12:19574290-19574312 GTGGCCTGCCTGCATCCTCTAGG + Intronic
1093794768 12:23298132-23298154 ATGGCCTGGAAACTTCCTCCAGG + Intergenic
1097974582 12:65671016-65671038 GGGGCCTGCCCTCTTCCTCCAGG + Intergenic
1098203974 12:68086388-68086410 GTGTCCTGCCTCCTTCTCCCAGG - Intergenic
1098229285 12:68356468-68356490 GGGGCCTTTCTCCATCCTCCAGG - Intergenic
1100048267 12:90411309-90411331 GGGGCCTGCCCCCTACCTCCCGG - Intergenic
1101129597 12:101675116-101675138 CTGGCCTGGCTCCATACTACTGG + Intronic
1101866739 12:108525906-108525928 ATGGCATGGCTCCTTCTTGCTGG - Intronic
1103322468 12:120100052-120100074 GTGGACAGGCCGCTTCCTCCCGG + Intronic
1103680499 12:122690113-122690135 GTGGCTTGGCTCCTTGGTCTGGG - Intergenic
1103958769 12:124594444-124594466 CAGGCCTGGCCCCTTCCTCCTGG + Intergenic
1104900469 12:132187340-132187362 GGCGCGTGGCTCCTCCCTCCGGG - Intergenic
1105830772 13:24161361-24161383 GTGGCGTGGCTGGTGCCTCCGGG + Intronic
1106111793 13:26783886-26783908 AAGTCCTGGCTCCTTCCTCAAGG - Intergenic
1106870581 13:34014583-34014605 GTGGCCTGTCTCTGTCCTCAGGG - Intergenic
1107234265 13:38149977-38149999 GTGGAATGGCTCCCTCCTCTCGG - Intergenic
1108579936 13:51819491-51819513 TTGGGCTGGTTCCTTTCTCCTGG - Intergenic
1108867139 13:54937647-54937669 GTTGTCTGGCTGCTTCCTGCTGG + Intergenic
1111604420 13:90519566-90519588 GTGGCCTGCCTACTTCCTTTGGG - Intergenic
1112185766 13:97126407-97126429 CAGGCCTGCCTCCTGCCTCCAGG - Intergenic
1112438063 13:99405702-99405724 TTGGCCTGTCTCCTTTCCCCAGG + Intergenic
1112730645 13:102357278-102357300 CAGGTGTGGCTCCTTCCTCCTGG - Intronic
1113454284 13:110437141-110437163 GTGTCCTGGGTCCTGCATCCTGG + Intronic
1116110116 14:40568127-40568149 GAGGCCTGGCTAGTTCCTCAAGG + Intergenic
1116540194 14:46093063-46093085 GTGGCCTGGCTCTTCCTTCGTGG + Intergenic
1117069950 14:52047438-52047460 GTGGCCTGGGTCATTCATGCAGG + Intronic
1117537070 14:56712649-56712671 GTGTCCTGGATCCTCCCTTCTGG - Intronic
1118839306 14:69499341-69499363 AGTGGCTGGCTCCTTCCTCCAGG - Intronic
1119668219 14:76499513-76499535 GTGGCCTGCCTCATCCTTCCTGG + Intronic
1119769181 14:77209817-77209839 CTGGCCTGGCTACTTCCTCATGG - Intronic
1121259148 14:92553601-92553623 GTGACCTGGCTCCTTCTTCTAGG + Intronic
1121311711 14:92938938-92938960 GTGGTCTGGCCCCTTGCTCCTGG + Exonic
1121680515 14:95789260-95789282 GGTGCCAGGCTCCCTCCTCCAGG + Intergenic
1122098333 14:99387438-99387460 CTTTCCTAGCTCCTTCCTCCTGG - Intergenic
1122127845 14:99588707-99588729 GTGGCCTGGTTTCTTACTTCAGG - Intronic
1122824072 14:104361169-104361191 GTGGCCTGACTCATTCCTGGGGG + Intergenic
1202902672 14_GL000194v1_random:52473-52495 GAAGCCAGGCTCCCTCCTCCAGG + Intergenic
1123468601 15:20533979-20534001 TGGCCCTGGCCCCTTCCTCCAGG + Intronic
1123649513 15:22467083-22467105 TGGCCCTGGCCCCTTCCTCCAGG - Intronic
1123728919 15:23129190-23129212 TGGCCCTGGCCCCTTCCTCCAGG + Intronic
1123747083 15:23326655-23326677 TGGCCCTGGCCCCTTCCTCCAGG + Intergenic
1124157585 15:27240312-27240334 GTGGACTAGCTCCCACCTCCAGG - Intronic
1124279352 15:28349971-28349993 TGGCCCTGGCCCCTTCCTCCAGG + Intergenic
1124303346 15:28561637-28561659 TGGCCCTGGCCCCTTCCTCCAGG - Intergenic
1124532245 15:30518077-30518099 TGGCCCTGGCCCCTTCCTCCAGG - Intergenic
1124766408 15:32489568-32489590 TGGCCCTGGCCCCTTCCTCCAGG + Intergenic
1126183433 15:45808362-45808384 GTGGCCAGCCTCCTTCCTACAGG - Intergenic
1128228389 15:66018357-66018379 GTGGCTGGGCTCCTTCCTCTAGG + Intronic
1128248687 15:66150178-66150200 GTGGCCTGGCTCCCTGCTCGGGG - Intronic
1128758580 15:70199328-70199350 GCCTCCTGGCTCCTTCCTCCCGG - Intergenic
1129172482 15:73816731-73816753 GTGGCCTGGCTTCTACCTTCAGG - Intergenic
1129614485 15:77087450-77087472 AAGGCCAGGCTCATTCCTCCGGG - Intergenic
1130406601 15:83608630-83608652 GGTGCCTGGCTCCATGCTCCTGG + Intronic
1130838616 15:87676007-87676029 GTGGCCTGGAAACTTCTTCCAGG - Intergenic
1131186696 15:90280240-90280262 GTGTCCTGGCTCCCTCCTGTCGG - Intronic
1131483494 15:92801669-92801691 GTTCCCTGGCTCCTTCTTCCAGG + Intronic
1131511826 15:93053400-93053422 GTGTCCTGGCCCCTTTCTCCTGG - Intronic
1131521127 15:93116520-93116542 GTGGGCTGTCTCCTCCCTCCTGG - Intergenic
1132253200 15:100350006-100350028 GGGGCCTGTGTGCTTCCTCCTGG + Intergenic
1132387464 15:101410558-101410580 TTGGCCTCGCCTCTTCCTCCTGG - Intronic
1132717537 16:1299427-1299449 GGGCCCTGGTTCTTTCCTCCAGG + Intergenic
1133937316 16:10279807-10279829 CTGGCCTGGCTTCTTGGTCCTGG + Intergenic
1135105559 16:19646187-19646209 GTGGCCTTGTTCCCTTCTCCAGG + Intronic
1137274004 16:46921549-46921571 GTGACCAGGTTCCTGCCTCCAGG + Intronic
1137475888 16:48810393-48810415 GAGACCTGGCTCCTGCCTTCAGG + Intergenic
1137668829 16:50267450-50267472 TCGGCCTGGCCCCTACCTCCAGG - Intronic
1138247295 16:55477459-55477481 AGGGCCTGGCTCCCTCCTGCGGG + Intronic
1138607624 16:58099031-58099053 GTGGACTGACTCCTGCCTCAAGG + Intergenic
1138923069 16:61556212-61556234 GTGGCCTGGCTGCTCCCTCTTGG - Intergenic
1140479494 16:75254737-75254759 GTGGCCTGGCACCTCCAGCCAGG + Intronic
1140904750 16:79400737-79400759 GAGTCCTGGCTCCTGCCTCCGGG - Intergenic
1141423562 16:83931882-83931904 GGGGCCTGGCCCCTTCATCCTGG + Intronic
1141640114 16:85335971-85335993 CTGCCCTGGCTCTGTCCTCCTGG - Intergenic
1141702783 16:85650151-85650173 GTGGCCAGGGTCCACCCTCCAGG - Intronic
1141751640 16:85962248-85962270 GTGGTCTCTCTTCTTCCTCCAGG - Intergenic
1141831604 16:86512384-86512406 CAGGCCTGGCTCCTGCCTCCTGG - Intronic
1142194802 16:88734459-88734481 GGTGCCCGGCTTCTTCCTCCTGG - Exonic
1142226058 16:88878112-88878134 GTGGCCAGCTTCATTCCTCCCGG + Intronic
1142448979 16:90162739-90162761 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1142449380 16:90166158-90166180 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1142457716 17:65723-65745 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
1142458117 17:69143-69165 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
1142458511 17:72550-72572 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
1142605915 17:1080989-1081011 GGGGCCTGGCTCTGCCCTCCAGG + Intronic
1143095915 17:4478310-4478332 GAGGCCTAGCTGCTTCCTCCTGG + Intronic
1143274412 17:5699642-5699664 GAGGCCTCTCTGCTTCCTCCAGG + Intergenic
1143569017 17:7742876-7742898 TCGGCCTGCCACCTTCCTCCAGG - Intronic
1144250693 17:13413807-13413829 GTGGCCTTTCTCCTTCTTCATGG - Intergenic
1144713820 17:17420727-17420749 GCGGCTTGGCTCATGCCTCCAGG - Intergenic
1145090237 17:19980089-19980111 GCGGTCTGGCCGCTTCCTCCTGG + Intergenic
1145798798 17:27670816-27670838 CTTCCCTGGCTCCTTCCACCTGG - Intergenic
1146008381 17:29176674-29176696 CTGGCCTGGCCCCGTGCTCCAGG + Intronic
1148081401 17:44969112-44969134 GTGGCCAGGCTGCTTTTTCCTGG + Intergenic
1148086304 17:44995749-44995771 GTGGCCTGGCCCCGGCCTCCCGG + Intergenic
1148237720 17:45980534-45980556 CTAACCTGGCTTCTTCCTCCAGG + Intronic
1148766671 17:50043710-50043732 CTGCCCTGTCTCCCTCCTCCAGG + Intergenic
1150036103 17:61800059-61800081 GTGGCCATGCTCTTTTCTCCAGG + Intronic
1150484390 17:65533660-65533682 CTGGCCAGGCTCTTTCCACCAGG - Intronic
1150484885 17:65536927-65536949 GCGACCTGTCTCCTTCCTCCCGG + Exonic
1150546948 17:66168942-66168964 GTGGCATGCCTCCCTCCTCTTGG + Intronic
1151823971 17:76513233-76513255 CTTCCCTGGCTCCTTCCTCCTGG + Intergenic
1151828097 17:76534877-76534899 TGTGCCTGGCTCCTTCCTCCTGG + Intronic
1151930800 17:77230340-77230362 GTGGCCTGGCTCCGTGGACCAGG + Intergenic
1152101626 17:78304950-78304972 GGGTCCTGGCTGCTTCCTGCTGG + Intergenic
1152235271 17:79135311-79135333 GTGGCCTGGCTCCTTCCCCAGGG - Intronic
1152291230 17:79441251-79441273 TGGGCGTGCCTCCTTCCTCCCGG + Intronic
1152424003 17:80209168-80209190 CTGGCCTTGCCCCTGCCTCCTGG + Exonic
1152611386 17:81316477-81316499 GGGCCCTGGCTCCTGCCTCAGGG + Intronic
1152719476 17:81915894-81915916 CTGGCCTGGCTCATCCTTCCAGG + Intronic
1152860278 17:82692355-82692377 GAGGCCTGGATTCTCCCTCCTGG - Intronic
1153287590 18:3470586-3470608 CTGGCCTGGCTCCACCCACCAGG - Intergenic
1153328547 18:3848100-3848122 GGGGCCTTGCTCCATCATCCAGG - Intronic
1153986128 18:10352473-10352495 GTTGCCTGGCTACATCATCCTGG - Intergenic
1155390910 18:25335600-25335622 GTGGCCTCGCTCAATCCTCTTGG + Intronic
1156801553 18:41120971-41120993 GAGACATGCCTCCTTCCTCCTGG - Intergenic
1157098521 18:44709143-44709165 GTAGCTTGGCTGTTTCCTCCTGG + Intronic
1157359175 18:46962931-46962953 GGAGCCTGGCTGCTTCCTGCGGG + Exonic
1157360169 18:46968858-46968880 GGAGCCTGGCTGCTTCCTGCGGG + Exonic
1157360770 18:47022450-47022472 GGAGCCTGGCTGCTTCCTGCGGG + Exonic
1157361759 18:47028365-47028387 GGAGCCTGGCTGCTTCCTGCGGG + Exonic
1157487835 18:48101070-48101092 GTGGGCTGGCTCCTTCCCCAGGG - Intronic
1159214464 18:65372435-65372457 GTGGCTTGGTGCCATCCTCCTGG - Intergenic
1160510265 18:79449654-79449676 CCGGCCTGGCTCCATCCTGCTGG - Intronic
1160586555 18:79916465-79916487 CTGTGCAGGCTCCTTCCTCCAGG - Intronic
1160647829 19:201649-201671 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
1160648228 19:205063-205085 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
1160663294 19:311442-311464 GTCTCCTGGTTCCCTCCTCCAGG - Intronic
1160811956 19:1016689-1016711 CTGCCCTGGCCCCTCCCTCCTGG - Intronic
1160835896 19:1124303-1124325 CTAGCCGGGCACCTTCCTCCCGG - Intronic
1160861680 19:1239886-1239908 TGGGCCTGGCTCCTCCCACCGGG - Intergenic
1160948752 19:1655679-1655701 GAGGCCTGGGTGCTCCCTCCAGG + Intergenic
1161049604 19:2156130-2156152 GTGGGCTGGCTGCAACCTCCAGG + Intronic
1161252785 19:3290081-3290103 GTGGCCAGGCCCCTTCTTTCTGG + Intronic
1161461478 19:4400256-4400278 CGGGCCTGGCTCCCTCATCCGGG + Intronic
1162003112 19:7760627-7760649 ATGGCCTGGCACTGTCCTCCAGG - Intergenic
1162531511 19:11238763-11238785 GAGTCCTGCCTCCTTCCCCCAGG + Intronic
1162744325 19:12790299-12790321 AGGGCCGGGCTCCTTCCCCCGGG + Intronic
1163653440 19:18532058-18532080 CTGGTCTGGCCCCCTCCTCCGGG - Exonic
1163685421 19:18709420-18709442 CTGTCCTGGCTCCTGCCACCTGG - Intronic
1164145899 19:22512464-22512486 CTGGCCTGGCCACTGCCTCCAGG - Intronic
1164462394 19:28460177-28460199 GCTGCCTGTCTCCTTGCTCCTGG + Intergenic
1164617582 19:29676105-29676127 CTGGCCTAGCACCATCCTCCTGG + Intergenic
1164647931 19:29873051-29873073 GTGGCCAGGCTCCCACCTCGGGG - Intergenic
1164820264 19:31244667-31244689 ATGGCCTGGCTCTGTCCCCCAGG + Intergenic
1164983094 19:32628669-32628691 GAGGCCTGTCTCCTGCTTCCTGG + Intronic
1165074034 19:33270806-33270828 TTGTCCCTGCTCCTTCCTCCTGG + Intergenic
1165159195 19:33805872-33805894 GAGGCCTGGCTCCTTCTCCCCGG + Intronic
1165312462 19:35037132-35037154 ATGGCATGGCTCATTCCTCAGGG - Intronic
1165387214 19:35517594-35517616 GTAGGCAGGCTCCTGCCTCCAGG - Intergenic
1165404775 19:35622872-35622894 CTGGCCTGGCTGCTCCCACCTGG - Exonic
1165862917 19:38918530-38918552 GTGGCCTGGCCTCCTCCCCCAGG - Exonic
1166791309 19:45400297-45400319 GTGGCCTAGCTCCCTCCCACTGG - Intronic
1167561916 19:50231172-50231194 TGCTCCTGGCTCCTTCCTCCTGG + Intronic
1167768683 19:51500604-51500626 GTGTCCCGCCTCCTACCTCCGGG + Intronic
1168346605 19:55652961-55652983 CTCGCCGGGCCCCTTCCTCCTGG + Exonic
1168464270 19:56589421-56589443 GGGCCCTGGCTTCTGCCTCCAGG + Intergenic
925337070 2:3106441-3106463 GTGCCCTGGAACCTGCCTCCAGG - Intergenic
925409754 2:3633152-3633174 GGGGCCTGGCCTCGTCCTCCAGG - Intronic
925904286 2:8530023-8530045 GTGGCCTGGCTGCATGATCCAGG - Intergenic
926251197 2:11156427-11156449 GTGGTCTCGCCCCTTCCCCCTGG + Intronic
926302374 2:11613527-11613549 TGGGCCTGGCTTCTTCCCCCAGG + Intronic
926704074 2:15824360-15824382 GTGATCAGGCTCCTACCTCCGGG - Intergenic
927209909 2:20632749-20632771 GTAAGCAGGCTCCTTCCTCCAGG + Intronic
927939628 2:27095434-27095456 GTGGCCTGGCTTCATCATGCTGG - Intronic
929562044 2:42962117-42962139 CTCGCCTGCCTCCTCCCTCCAGG + Intergenic
931404246 2:61960980-61961002 GTGTCCTGGCTCTCTTCTCCCGG + Intronic
932174868 2:69590483-69590505 CTGCCCTGGCTCTGTCCTCCAGG - Intronic
932810661 2:74823035-74823057 GGGCCCTGGCTCATTCCTGCTGG + Intergenic
933484055 2:82896318-82896340 GTGGCCTGCCTGCTACCTCTGGG - Intergenic
934503990 2:94877921-94877943 GAAGCCAGGCTCCCTCCTCCAGG - Intergenic
936381680 2:111992139-111992161 TGTGCGTGGCTCCTTCCTCCAGG - Intronic
936463382 2:112727180-112727202 GTGACCTGACTCCCTCCACCTGG - Intronic
936733051 2:115407113-115407135 GAGGCCAGGCTCCTTCGCCCTGG + Intronic
938737269 2:134197776-134197798 GGGGCTGGGCTCCTTCCTTCTGG + Intronic
939969499 2:148644411-148644433 TTTGCCCGGCGCCTTCCTCCGGG + Intergenic
940670344 2:156659938-156659960 GTGTCCTGTCTCTTTCCCCCTGG + Intergenic
940826318 2:158416418-158416440 GTGGCCTGGCTTCTTCTAACAGG - Intronic
941073455 2:160980902-160980924 TTGTCCTGACTCCTTGCTCCAGG - Intergenic
941102229 2:161308720-161308742 GAGGCCGGGCTCCTCCCTCGCGG - Intronic
942540345 2:177008855-177008877 CTGGCGTGGTTCCTTTCTCCCGG - Intergenic
944160332 2:196652823-196652845 GAGGCCTGGCAGCTTCCACCTGG - Intronic
944471105 2:200054881-200054903 GCGGCCTGCCTGCTCCCTCCAGG - Intergenic
946189797 2:218002239-218002261 GGGCCATGGCTCCCTCCTCCAGG + Intronic
947551036 2:231047064-231047086 GGGGCCTGGCTCCGTCTTACTGG + Exonic
948493593 2:238330566-238330588 GTGCCATGGCCTCTTCCTCCCGG + Intronic
948633454 2:239317395-239317417 GCGGCCTGGTTCCTTTCTCGGGG - Intronic
1170463031 20:16596860-16596882 GTGGCCTGACTCCCACCTCCTGG + Intergenic
1171181171 20:23091737-23091759 AGGGCCTGGCTCCATCTTCCAGG - Intergenic
1171783894 20:29445672-29445694 ATGGCCTTGCCTCTTCCTCCAGG + Intergenic
1172913846 20:38429476-38429498 GCTGCCCTGCTCCTTCCTCCCGG - Intergenic
1173334172 20:42099565-42099587 GTGGTCTGGCAGCTTCATCCAGG + Intronic
1173785435 20:45789721-45789743 ATGGCCTGGGTCATTCTTCCTGG - Intronic
1173908325 20:46645037-46645059 TTGGCCAGGCTGGTTCCTCCTGG + Intronic
1174576851 20:51542857-51542879 GCGGACAGCCTCCTTCCTCCCGG - Intronic
1175378527 20:58546438-58546460 CGGGCCTGGCTCATTCCTTCAGG + Intergenic
1175561556 20:59934153-59934175 GAGGCCTGGCTCCTGCCGGCAGG + Intronic
1175653550 20:60749685-60749707 ATGGCCTTGCTCCAGCCTCCAGG - Intergenic
1176022824 20:62970832-62970854 GTGTGCTGGCTCCTTCTTCCAGG + Intergenic
1176064912 20:63189271-63189293 GTTGTCTGGCTTCTTCCTGCTGG - Intergenic
1176108022 20:63398723-63398745 TAGGCCTGGCTCCTGGCTCCTGG - Intergenic
1176622036 21:9067240-9067262 GAAGCCAGGCTCCCTCCTCCAGG + Intergenic
1177301101 21:19246173-19246195 GGAGCCTGGCCCTTTCCTCCAGG + Intergenic
1179543838 21:42101254-42101276 GTGGACTGGCGGCCTCCTCCAGG - Intronic
1180122895 21:45765662-45765684 GTCTCCTGGCTCCTGCCTCCTGG + Intronic
1180695081 22:17746802-17746824 GTTGCCCGGCTGCTTCCTTCTGG - Intronic
1180752044 22:18131245-18131267 GGGGCCAGGCACCCTCCTCCTGG - Exonic
1181031039 22:20149027-20149049 CAGCCCTGGCCCCTTCCTCCTGG + Intronic
1181444041 22:22954940-22954962 GTGGCCTCGCAGCTTCCCCCAGG - Intergenic
1181445365 22:22968574-22968596 GTGGCTTTGCTCCTCCCTCCTGG + Intergenic
1181512287 22:23394375-23394397 CAGCCCTGGCCCCTTCCTCCTGG - Intergenic
1181542298 22:23580006-23580028 CTGGACCGGCTGCTTCCTCCAGG + Exonic
1182275557 22:29186150-29186172 GCTGCCTGGCTCCTTTCTCTGGG - Intergenic
1182902617 22:33910963-33910985 GAGTCCTGGCTCCTTCTTCATGG + Intronic
1183112303 22:35659338-35659360 TTGTCCTTGCTCCTTCCTTCAGG - Exonic
1183422419 22:37719697-37719719 CTGGTCTGCCTCCTTCCTCACGG + Intronic
1184071778 22:42151402-42151424 TTTGCCTGCCTCATTCCTCCCGG + Intergenic
1184130141 22:42512738-42512760 GTGGCCTGGTCCTTCCCTCCTGG + Exonic
1184202364 22:42979652-42979674 ATTCTCTGGCTCCTTCCTCCTGG + Intronic
1184643667 22:45885046-45885068 AAGGCCAGGCTCCTTCCTGCTGG + Intergenic
950004733 3:9684484-9684506 GGGGCCTGGCTCCCTCCACCAGG + Intronic
950307594 3:11928403-11928425 CTTGCCAGGCTCCTTCCTCCTGG + Intergenic
950569328 3:13790496-13790518 GTGGCCCTGCTGCTTCCTCTTGG - Intergenic
951574818 3:24102777-24102799 ATGGCCTGGTCCCTTCCTCATGG + Intergenic
952884793 3:38005870-38005892 GTGGCCGGGCTCCTCCCTGCTGG - Exonic
954109478 3:48426179-48426201 CAGGCATGGCACCTTCCTCCAGG - Intronic
954237186 3:49265844-49265866 GTTGTCTGTCTCCTTCCTTCTGG + Intergenic
954809251 3:53238081-53238103 ATGCCCTGGCCCCTTCCCCCAGG + Intronic
955067588 3:55546251-55546273 CTAGGCTGGCTCCTACCTCCAGG + Intronic
955106350 3:55902361-55902383 GTGACTTGGCTCCCTCCTCTCGG + Intronic
955403946 3:58613614-58613636 TTTGCCTGGCTTCTTCCTTCAGG + Intronic
955617794 3:60827213-60827235 GTGACCTGAATACTTCCTCCTGG + Intronic
955948910 3:64222512-64222534 GTGGTCTGCCTCCTTCATGCCGG - Intronic
956195895 3:66652527-66652549 CTGGAGTTGCTCCTTCCTCCCGG - Intergenic
960629211 3:119712064-119712086 GTGTCCTGGCTCCTGCCCTCAGG - Intronic
961213010 3:125140377-125140399 GAGGCCTGGCTTCTGCCACCGGG - Intronic
961812035 3:129527606-129527628 GTGCCCTGTCTGCTGCCTCCAGG + Intergenic
962409428 3:135128357-135128379 GTGGCTTAGCATCTTCCTCCAGG + Intronic
962801997 3:138898319-138898341 AAGGCCTGGTTCCTTCCTCTTGG + Intergenic
968369618 3:198215052-198215074 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
968370018 3:198218466-198218488 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
969870184 4:10099676-10099698 GTGGCCTGGCGGCCTCCACCTGG + Intronic
970194823 4:13543323-13543345 GAGGCCTCTCTCCTGCCTCCAGG + Intronic
972368269 4:38396126-38396148 CTTGCCTGAGTCCTTCCTCCAGG + Intergenic
972391129 4:38614626-38614648 TTCGACTGGCTCCTTCATCCTGG + Intergenic
972766452 4:42156079-42156101 CGGGCCTGGCTCTGTCCTCCAGG - Intergenic
978556416 4:109985503-109985525 GTGGCCTGCTTCCCTCATCCTGG + Intronic
979329632 4:119410125-119410147 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
981456878 4:144962694-144962716 GAGGCCAGGCTCTTCCCTCCTGG - Intergenic
983649480 4:170024362-170024384 GAGGCCTTGCTGCTTCCTCCAGG + Intronic
984832524 4:183988785-183988807 CTGGACTGGCTCCATCCCCCAGG - Intronic
984906157 4:184627947-184627969 GAGGCCTGGAGCCTGCCTCCCGG + Exonic
986759663 5:10868464-10868486 GGGGCCTGGGTCCTTGCTCAGGG + Intergenic
987365342 5:17143556-17143578 GCCACCTGTCTCCTTCCTCCAGG + Intronic
988462475 5:31452557-31452579 GTGGGCTGGGTCCATCCTCCAGG - Intronic
992366233 5:76092969-76092991 GTGGCTTGGCCTCTTCCTCAAGG - Intronic
992385511 5:76280669-76280691 GTGGCCTGGCTGCTTTCCCCGGG + Intronic
992557009 5:77913783-77913805 CTGGCCTTTCTCATTCCTCCTGG + Intergenic
992731436 5:79673779-79673801 GTGGCCTGTCTCCTGACTCTAGG - Intronic
995374082 5:111453865-111453887 GTTGCCTGGCTCCTGGCTCTTGG + Intronic
996639162 5:125731045-125731067 GGTGCCCGGCTCCTTCCTCTGGG - Intergenic
997667959 5:135647598-135647620 ATGCCCTGGCTCTGTCCTCCAGG - Intergenic
997716833 5:136048827-136048849 GTGGCCAGGCCCAATCCTCCAGG + Intronic
997903897 5:137795032-137795054 CTGCCCTGGCCCCTCCCTCCCGG - Intergenic
998367304 5:141639722-141639744 GGGCCTTGGCTCTTTCCTCCTGG + Exonic
998379826 5:141716253-141716275 GTGGCCTGCCTCATCCTTCCTGG - Intergenic
998815911 5:146013874-146013896 CTGCCCAGGCACCTTCCTCCTGG - Exonic
1001915239 5:175554987-175555009 GCGGCCAGGCTCCTGCCCCCTGG + Intergenic
1002177398 5:177409019-177409041 GTGGCCTGGCTCCTCCTCCCGGG - Intronic
1002279528 5:178122324-178122346 CTGGGCTGGGGCCTTCCTCCAGG + Exonic
1002310824 5:178312716-178312738 CTGGCCTGGCTGCTTCCTGTGGG + Intronic
1002529690 5:179836796-179836818 GTGCCCTGGCTCCTTGCAGCAGG + Exonic
1002548825 5:179972131-179972153 GTGGAGTGGTTCCTTACTCCAGG + Intronic
1002728898 5:181320637-181320659 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1002729297 5:181324044-181324066 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1003905086 6:10692081-10692103 GTGCCCTGTCTCCTTACCCCAGG - Intronic
1003980015 6:11380584-11380606 GTGTCCTGCCTCCCTCCTCCAGG - Intronic
1005303786 6:24495082-24495104 GCGGCCTGGTCCCTGCCTCCGGG + Exonic
1005950714 6:30629267-30629289 GTAGCCTTGCTCCATCGTCCAGG + Intronic
1006099953 6:31680425-31680447 GTTGCCTCTCTCCTTCCTCTTGG - Intronic
1006792833 6:36714881-36714903 CTAGCCTGGCTCCTGCCTCAGGG + Intronic
1008773981 6:55012082-55012104 GTGGCCTGGAAACTGCCTCCAGG + Intergenic
1010373008 6:75133658-75133680 GTGGCCAGGATTCTTCCCCCTGG - Intronic
1011504722 6:88028908-88028930 GTGGCCTGGCTGCTTCTAACAGG - Intergenic
1011633829 6:89352579-89352601 CTGGCTTGGCTCCGGCCTCCCGG + Exonic
1012200144 6:96395965-96395987 GAGGCCTTGCTCCTTTTTCCAGG + Intergenic
1012451899 6:99361620-99361642 GTGCCCTTCCTCCTTCCTGCTGG - Intergenic
1014266640 6:119285337-119285359 ATGGCTTGGTGCCTTCCTCCAGG - Intronic
1014422389 6:121261405-121261427 GGTGCCTGGCTCTTTCCTCTGGG - Intronic
1016944015 6:149511258-149511280 GTGGTCTGGCTCTGTCATCCAGG + Intronic
1017377351 6:153786659-153786681 GTGGCCAGGCTGCTTCATACTGG + Intergenic
1018372216 6:163178564-163178586 GTAGCCTGGTTGCTTCCTTCTGG + Intronic
1018541843 6:164889263-164889285 GAGGCCCTGCTCCTTCCTGCTGG + Intergenic
1018952440 6:168387834-168387856 GTGGCCTAGCTCCGGCCACCAGG + Intergenic
1019089783 6:169518888-169518910 GTGGCCTGGCTGCTTCTAACAGG - Intronic
1019197886 6:170292491-170292513 GTGGCCAGGCTGCTTCCTTGGGG - Intergenic
1019494028 7:1329279-1329301 GTGGACTCTCTCCTTCCTCTGGG + Intergenic
1019515637 7:1438698-1438720 CGGGGCTGGGTCCTTCCTCCAGG + Intronic
1019521219 7:1461345-1461367 GTGTCCTGGCTCCTGGCTTCGGG - Intergenic
1019562454 7:1665529-1665551 GCGGCCTCGCCCCCTCCTCCTGG - Intergenic
1019687893 7:2391864-2391886 GAGGCCTGGCGGCTTCCACCTGG - Intergenic
1022103317 7:27182005-27182027 GTGGCCTGGCTGCAGCCTCTTGG + Exonic
1022216927 7:28272547-28272569 GTGGCCTTCCTCCTTCCTCTGGG + Intergenic
1023020941 7:36011242-36011264 GTGGCCTGGCTCTGCCCTCTGGG + Intergenic
1023400691 7:39791735-39791757 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1025131897 7:56378523-56378545 TTGGCCCAGCTCCTACCTCCCGG - Intergenic
1029271542 7:99380023-99380045 GTGTCCTGGATCCCTCCCCCAGG + Intronic
1029273867 7:99392947-99392969 GGGGCCTGGAGTCTTCCTCCTGG + Intronic
1029443529 7:100600922-100600944 GGGGCCGGACTCCCTCCTCCAGG - Exonic
1029490607 7:100868087-100868109 CTGCCCTGGCTCCATCCTCAGGG + Exonic
1031083344 7:117278950-117278972 GGGGCCTTTCTCCTTCCTCAGGG - Intronic
1031992547 7:128207662-128207684 GTTGCCTGCCTCCTGCCTCTGGG + Intergenic
1032051019 7:128651180-128651202 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1032344796 7:131107750-131107772 CTTGCCTCGTTCCTTCCTCCCGG + Intergenic
1032797424 7:135288971-135288993 AGGGCCTGACTCCTTCCTCCTGG - Intergenic
1032803512 7:135335175-135335197 TTGTCATGGCTCCTGCCTCCAGG - Intergenic
1033536607 7:142318245-142318267 ATCTCCTGGCTCCTTCCTCAGGG - Intergenic
1034274950 7:149819937-149819959 GGGGCCTGGCTGCTACCTCATGG + Intergenic
1034276084 7:149824454-149824476 GCGCCCTGGCCCCTGCCTCCAGG + Intergenic
1034509207 7:151520294-151520316 GTGGGCTGGCTCCTCCCTCGGGG + Intergenic
1035058971 7:156055250-156055272 GTGCCCCAGCTCCTGCCTCCAGG + Intergenic
1035376123 7:158407563-158407585 GTGTCCTGGGTCCTGCGTCCTGG + Intronic
1035483626 7:159205645-159205667 GTGGGCTGCCTCCTTCCCGCTGG - Intergenic
1035592068 8:823839-823861 GCGGCCTGGGTCCATCCACCCGG + Intergenic
1036032679 8:4991576-4991598 GTGGCCGGGCGCCCTCCTGCCGG + Intronic
1037656380 8:20887758-20887780 GTGTCCTGGCTCCATCCAGCAGG + Intergenic
1037910833 8:22742687-22742709 GTGGCCTGGCTGCTTTCTCAAGG - Intronic
1037967849 8:23147479-23147501 GTGGCCAGGCTCTCTCCTCCCGG - Intronic
1040911303 8:52521712-52521734 GTGGTCTGGCTCTGTCCCCCAGG - Intergenic
1044886547 8:96784489-96784511 GTGTCCTTGCTCCCTCCACCAGG - Intronic
1045320726 8:101080039-101080061 GAGGCCTGGCTCTGCCCTCCTGG + Intergenic
1045476581 8:102557725-102557747 GAGGCCTGGCTGCATCATCCTGG + Intronic
1047252258 8:123189671-123189693 GTGGCCTGGATGCTCCCTCCTGG + Intronic
1047940286 8:129822629-129822651 GTGGCCTGGCTCCCCACCCCTGG - Intergenic
1049455094 8:142682630-142682652 GAGGCCTGGCCCCTTCCTCCAGG - Exonic
1049568896 8:143359299-143359321 GTGACCTGCCTCCCTTCTCCTGG - Intronic
1055849001 9:80602593-80602615 GCAGCCTCTCTCCTTCCTCCAGG - Intergenic
1057198110 9:93126379-93126401 GTGGCCTGGCTGCCCCCACCTGG + Intronic
1057291557 9:93810402-93810424 GAGCCCTGGGTCCTTCCTTCCGG + Intergenic
1057701607 9:97366776-97366798 GTGGCCTGGATCCTCCCCTCTGG + Intronic
1058651262 9:107177322-107177344 GTGGCATAGCTCCTCCCCCCAGG + Intergenic
1058674786 9:107391022-107391044 AATGCCTGGCTCCCTCCTCCAGG - Intergenic
1058766486 9:108187253-108187275 ATGGCCTGGCGCCCTCATCCAGG - Intergenic
1058876890 9:109252350-109252372 GCGTTCTGGCCCCTTCCTCCCGG + Intronic
1059390165 9:113994172-113994194 ATAGCCTGGCTGCTGCCTCCTGG - Intronic
1059403413 9:114084960-114084982 CTCGGCTGGCTCCTTCCTCCAGG - Intergenic
1060520773 9:124292709-124292731 GGGGCCAGGCTTCTCCCTCCTGG + Intronic
1060670687 9:125466747-125466769 GTGGCCTTCCTCCTTCCCCTGGG + Intronic
1061235739 9:129341635-129341657 GGGGCATGGCTCCTTCACCCCGG + Intergenic
1061242288 9:129381709-129381731 GTCCCCGGGCTCCCTCCTCCGGG + Intergenic
1061625983 9:131840943-131840965 GTGGCCTGGCTTCCTCCCTCAGG - Intergenic
1061661277 9:132131996-132132018 GTGGCCTCTCTCCAGCCTCCTGG + Intergenic
1061719599 9:132543476-132543498 GTGGACAGCCTCCTTCCTCAAGG - Intronic
1061747811 9:132753142-132753164 GTGGCCTGGCTCCTTCCTCCTGG - Intronic
1061898012 9:133658550-133658572 GTGGTCTGGCCCCTTCATCCTGG - Exonic
1062021096 9:134319740-134319762 CAGGCCTGGCCCCATCCTCCCGG - Intronic
1062133603 9:134913215-134913237 GTGGCCCTCCTCCTCCCTCCTGG - Intronic
1062165517 9:135105541-135105563 GTGGCCAGGCCGCGTCCTCCCGG + Intronic
1062433244 9:136535227-136535249 GGGGCCTGGCCCCTCCCACCTGG - Intronic
1062524139 9:136971546-136971568 TTGGCCTGGGTCCCTTCTCCTGG - Exonic
1062572899 9:137193778-137193800 GGGGCCCGGCTCCTGCCTCCGGG - Intronic
1062753958 9:138277736-138277758 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1203745229 Un_GL000218v1:37662-37684 GAAGCCAGGCTCCCTCCTCCAGG + Intergenic
1203564879 Un_KI270744v1:81822-81844 GAAGCCAGGCTCCCTCCTCCAGG - Intergenic
1203576477 Un_KI270745v1:12515-12537 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1203576874 Un_KI270745v1:15924-15946 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1203577276 Un_KI270745v1:19345-19367 TTGGCCCAGCTCCTACCTCCCGG + Intergenic
1203577797 Un_KI270745v1:21662-21684 GTGGCCCAGCTCCTCCCTCACGG + Intergenic
1185765881 X:2725565-2725587 CTGCCTGGGCTCCTTCCTCCAGG + Intronic
1187456253 X:19443756-19443778 GTGGCCTGGCCCGTCCCTCCCGG - Intronic
1189700662 X:43714640-43714662 GTGGCCTGGTTGCATCTTCCAGG + Intronic
1190505230 X:51119593-51119615 GGGGGCTGCCTCCCTCCTCCTGG + Intergenic
1196857872 X:120000450-120000472 GCAGCTTGGCCCCTTCCTCCTGG - Intergenic
1197962724 X:132023546-132023568 TCGGACTGGCTCCTCCCTCCGGG - Intergenic
1198996890 X:142582746-142582768 ATGGCCTGGCACATGCCTCCAGG + Intergenic
1200034713 X:153319883-153319905 GCAGCCTGGCTGCTCCCTCCCGG + Intergenic
1200045327 X:153397854-153397876 GCAGCCTGGCTGCTCCCTCCTGG + Intergenic
1200069753 X:153522379-153522401 GTGGCCTCAGTCCATCCTCCCGG - Intronic
1200258309 X:154597625-154597647 GGGGCCAGGCTCCTCCCGCCTGG - Intergenic
1201158556 Y:11152697-11152719 GAAGCCAGGCTCCCTCCTCCAGG + Intergenic
1202373189 Y:24211773-24211795 GTCCCCTGGCCCCTTGCTCCAGG + Intergenic
1202497593 Y:25458347-25458369 GTCCCCTGGCCCCTTGCTCCAGG - Intergenic