ID: 1061747812

View in Genome Browser
Species Human (GRCh38)
Location 9:132753156-132753178
Sequence AAAGGAGGTCAACAGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 308}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061747812_1061747819 -4 Left 1061747812 9:132753156-132753178 CCAGGCCACTGTTGACCTCCTTT 0: 1
1: 0
2: 1
3: 26
4: 308
Right 1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061747812 Original CRISPR AAAGGAGGTCAACAGTGGCC TGG (reversed) Intronic
900496534 1:2978475-2978497 CAGAGAGGTAAACAGTGGCCAGG - Intergenic
902786221 1:18734335-18734357 CCAGGAGGTCATCAGGGGCCTGG + Intronic
904141901 1:28360312-28360334 ACAGGAGTTCAAGACTGGCCTGG - Intergenic
904210149 1:28881947-28881969 AAGAGAGATCATCAGTGGCCAGG - Intergenic
905256270 1:36687512-36687534 AAAGAAGGTCAACAGCCACCGGG + Intergenic
905660978 1:39724720-39724742 AAAGCAGATCAATAGTTGCCTGG - Intronic
905680640 1:39868762-39868784 AAAGAAGCTCAACACTGGCTGGG + Intronic
906036344 1:42752424-42752446 AGAGGTGGTCAACTGTGGCCAGG + Intronic
906288037 1:44600979-44601001 AAAAGAGGTCAACAGTGCTGTGG - Intronic
907296655 1:53460007-53460029 AAAGTCGGTGAACAGTGGGCCGG - Exonic
907479762 1:54737278-54737300 AAAGGAGGGCTACATAGGCCTGG + Intronic
907848509 1:58231492-58231514 AAGGGAGGACCACAGTGGACTGG + Intronic
908875693 1:68672514-68672536 AAGGAAAGTCAACAGTGCCCAGG + Intergenic
909300184 1:74003029-74003051 AAAGGAGGTCAACAGTTCAAGGG - Intergenic
909615171 1:77600584-77600606 AAAGAAGTTCAACAGAGACCAGG + Intronic
909940142 1:81602162-81602184 AAATGAAGTGACCAGTGGCCAGG + Intronic
912183923 1:107251738-107251760 AAAGTAAGACAACAGTGGACAGG - Intronic
914413666 1:147457236-147457258 AAAATAGGTCAACAGAGGCCGGG + Intergenic
915350628 1:155222852-155222874 AAAAGGGGTCTCCAGTGGCCGGG + Intergenic
918312435 1:183294495-183294517 TAAGAATGTCAACAGGGGCCGGG + Intronic
919121186 1:193342223-193342245 AAAGGAGCTCAGCAGGAGCCAGG - Intergenic
920217072 1:204368518-204368540 CAAGGAAGTTGACAGTGGCCAGG + Intronic
920228405 1:204454619-204454641 TGAGCAGGTCTACAGTGGCCTGG + Intronic
922038918 1:221876554-221876576 AAAGAAGGGCATCAGAGGCCGGG - Intergenic
922295440 1:224245910-224245932 AATAGAGGTCAACTTTGGCCGGG - Intronic
922596562 1:226818219-226818241 AAAGCAGATCAGCAGTTGCCTGG + Intergenic
1064056597 10:12103011-12103033 CCAGGAGTTCAACACTGGCCTGG + Intronic
1064140677 10:12787704-12787726 TAAGAAGGTCACCAGAGGCCGGG + Intronic
1064557941 10:16566446-16566468 GAGGGAGGTGAATAGTGGCCTGG + Intergenic
1064962367 10:20979412-20979434 AAAGGTGGTCAAGAGAGCCCAGG + Intronic
1064981157 10:21168751-21168773 AAAATGGCTCAACAGTGGCCGGG + Intronic
1070529085 10:77320557-77320579 AAAGGAGGGCAGGAGTGGACTGG - Intronic
1071216359 10:83407120-83407142 AAAGAAGATACACAGTGGCCAGG + Intergenic
1072659618 10:97355769-97355791 AAAGGTGGTCAGGAGTGGCTAGG - Intergenic
1072842522 10:98790462-98790484 AAAGGAGGTTACCAGAGGCTGGG + Intronic
1073188281 10:101630680-101630702 ACAGGAGGTCAACAGAAGTCAGG + Intronic
1073470742 10:103720704-103720726 AAGGGAGGTGCACAGTCGCCTGG + Intronic
1075922610 10:126225618-126225640 AAATGAGGGCAAGAGGGGCCTGG + Intronic
1076871394 10:133196717-133196739 AAGGGAGGACAGGAGTGGCCGGG + Intronic
1077485298 11:2835755-2835777 AAAGGAGGGAAAGGGTGGCCTGG + Intronic
1078620895 11:12906706-12906728 AAAGTAGATCCACAGTTGCCTGG - Intronic
1079086340 11:17448157-17448179 ACAGGAGTTCAAGACTGGCCTGG - Intronic
1079233871 11:18673394-18673416 AAAAGAAGTCAAAAGCGGCCGGG - Intergenic
1079250587 11:18784467-18784489 AACGGAGGTCACCAGAGGCTGGG + Intronic
1080788521 11:35498701-35498723 GAAGGTGGGAAACAGTGGCCAGG - Intronic
1083809345 11:65094940-65094962 CCAGGAGGTCAATACTGGCCTGG - Intronic
1084583622 11:70040465-70040487 AAAGGAGTTCGAGAGTGGCCTGG + Intergenic
1084783219 11:71425045-71425067 AAAGGAAGGAAAGAGTGGCCGGG + Intergenic
1084902062 11:72317133-72317155 AAAGGAGCACATCATTGGCCAGG - Exonic
1086095867 11:83049420-83049442 AAAGGAGGCCAACATTTGCCTGG + Intronic
1086318678 11:85621125-85621147 AAAGTAGGTCAACAAAAGCCTGG + Intronic
1088230935 11:107672609-107672631 CAAGGAGTTCAAGACTGGCCTGG - Intergenic
1088251183 11:107862109-107862131 ATAGGAGGGAAACAGAGGCCAGG + Intronic
1088624163 11:111717017-111717039 AAAAAAGCTCAACAGCGGCCGGG + Intronic
1090610804 11:128468642-128468664 GAAGGAGGTCAACGCTGGGCAGG + Intronic
1091269886 11:134300627-134300649 AAATGTGGTCAATAGGGGCCGGG - Intronic
1091501161 12:1019332-1019354 TAAGGAGTTCAAGACTGGCCTGG - Intronic
1092992620 12:13917545-13917567 AAAAGAGGACAGCAGTGACCAGG + Intronic
1094450663 12:30580175-30580197 GCAGGAGGTCAACAGTGCTCAGG + Intergenic
1095604024 12:44045546-44045568 AAAGAAGTGCAGCAGTGGCCGGG + Intronic
1096510172 12:52123463-52123485 AAGGGAGGGCCACAGTGGACTGG + Intergenic
1097207146 12:57332112-57332134 ATAGAATGTAAACAGTGGCCAGG + Intronic
1097813455 12:64044887-64044909 TTAGGAGTTCAACATTGGCCTGG - Intronic
1098244722 12:68504522-68504544 AAAGCAGGTCAGCAGTTGCCTGG - Intergenic
1099788297 12:87296137-87296159 AAAGCAGATAAATAGTGGCCTGG + Intergenic
1099976152 12:89547195-89547217 AAAAGAGGGTGACAGTGGCCTGG - Intergenic
1100062036 12:90591392-90591414 AAAGGAGATCACCAGTCACCAGG + Intergenic
1100095142 12:91024652-91024674 ATAGTAGGTAAACAGTGGCAGGG + Intergenic
1100759488 12:97791577-97791599 AAGGGAGGTAAACAGAGACCAGG + Intergenic
1101321786 12:103679078-103679100 AAAGGTGGTCAACATGGGCCGGG + Intronic
1101685288 12:107013613-107013635 AAAGGTGGTCAACAATGACAAGG + Intronic
1104177797 12:126349975-126349997 CCAGGAGTTCAAGAGTGGCCTGG - Intergenic
1104845128 12:131842932-131842954 AAAGGAGGTCAGGGGTTGCCAGG - Intronic
1105456761 13:20548198-20548220 AAAGGATGTCAGAAGTGGACAGG - Intergenic
1106307670 13:28527879-28527901 AAAGGAGCGGAACAGAGGCCGGG + Intergenic
1107505703 13:41030949-41030971 CTAGGAGTTCAACAGTAGCCTGG + Intronic
1107839399 13:44440275-44440297 AAAAGAGTAGAACAGTGGCCGGG + Intronic
1108824946 13:54401572-54401594 AAATGAGGTCAAAAGAGGCATGG - Intergenic
1110388658 13:74945533-74945555 AAGGGAGGGCAACAGAGGCAGGG + Intergenic
1110771682 13:79356059-79356081 AAAAGAGATTAACAGTGGCCTGG + Intronic
1111444814 13:88333625-88333647 AGAGGTGGTCAACAGTAACCAGG + Intergenic
1111651307 13:91093887-91093909 AAAGCAGATCAATAGTGGCTAGG - Intergenic
1112447555 13:99478870-99478892 AAAAATGGTGAACAGTGGCCGGG + Intergenic
1112458562 13:99583382-99583404 TTAGAAGGTCAAAAGTGGCCTGG - Intergenic
1113295994 13:108959207-108959229 AAAGGAGAAAAACAGAGGCCGGG - Intronic
1114322313 14:21557407-21557429 AAAAGAGGCCAACAGGTGCCGGG - Intergenic
1114868277 14:26624474-26624496 AAAAGAAGACAATAGTGGCCAGG - Intergenic
1115817420 14:37178024-37178046 CAAGGAGTTCAACACTAGCCTGG + Intergenic
1116022096 14:39473591-39473613 AAAGGAGATCAATGGTTGCCAGG + Intergenic
1117066811 14:52019426-52019448 AAATGAGGTAAATAGTGGCAAGG - Intronic
1117415299 14:55490124-55490146 TAAGGAGTTCAAGACTGGCCTGG - Intergenic
1117482565 14:56162273-56162295 AAAGATGGTCACCAGTGGCTGGG - Intronic
1118038381 14:61892397-61892419 AATGGAGGCCAAGGGTGGCCAGG - Intergenic
1119454031 14:74738803-74738825 AAAGGATCTTAACTGTGGCCGGG + Intergenic
1119478401 14:74945214-74945236 AAAGAATTTCAAAAGTGGCCGGG - Intronic
1119510739 14:75209150-75209172 TGAGGAGGTCAACATTGGGCAGG - Intergenic
1120780251 14:88480044-88480066 GAAGCAGCTCAACAGGGGCCTGG - Exonic
1121527013 14:94626075-94626097 AAGGGAGGACCACAGTGGGCTGG + Intergenic
1122070723 14:99203941-99203963 CAAGAAGGTCAGCAGTGCCCAGG + Intronic
1123999624 15:25744170-25744192 AAAGGAGCTCAGCAGTGTTCTGG - Intronic
1124646641 15:31441619-31441641 ACACGAGGTCAGGAGTGGCCTGG - Intergenic
1125080583 15:35668206-35668228 GGAAGAGGTCATCAGTGGCCAGG + Intergenic
1126400779 15:48267581-48267603 TAAGGAGATGAACAGTGGCATGG + Exonic
1130419121 15:83724708-83724730 AATGGTGGTCACCAGTGGCTAGG - Intronic
1130918395 15:88323954-88323976 AAGGGAGGTCCAAAGAGGCCAGG - Intergenic
1133183299 16:4075701-4075723 AAAGGAGGTAAAAAGAGACCTGG + Intronic
1133198337 16:4186595-4186617 ACAGGAGTTCAAGACTGGCCTGG - Intergenic
1133786575 16:8978368-8978390 AAAGGAGGTCAAGACTAGCTTGG + Intergenic
1134022631 16:10931666-10931688 AAATGAGGTCAAGACTAGCCTGG + Exonic
1134804940 16:17116186-17116208 AAAGGAGGTGAAAAGGGGCGGGG + Intronic
1135064620 16:19298980-19299002 TCAGGAGTTCAAGAGTGGCCTGG - Intronic
1135188978 16:20338968-20338990 TCAGGAGGTCAAGACTGGCCTGG - Intronic
1135969927 16:27064992-27065014 AAAGGATGACAGCAGGGGCCAGG + Intergenic
1136012010 16:27369888-27369910 ACAGGAGGTGGACTGTGGCCAGG - Intergenic
1136654671 16:31702791-31702813 AAAGGAAATGAGCAGTGGCCTGG + Intergenic
1139780170 16:69344791-69344813 AAAGAAAGTGAAAAGTGGCCGGG + Intronic
1139805585 16:69563169-69563191 AAAGGAGTTCAAGACTAGCCTGG + Intergenic
1140130944 16:72160717-72160739 AAAGGAAGTTAACACTGTCCGGG + Intronic
1140894153 16:79310477-79310499 AAAGGTGGTCAACCTAGGCCTGG - Intergenic
1141800093 16:86301774-86301796 AAAGCAGGTCAACAGCAGCATGG - Intergenic
1143280414 17:5750064-5750086 AAAGGAACTCAACAGTGGCAAGG - Intergenic
1143693517 17:8591165-8591187 AAAAGAAGGCAACATTGGCCAGG - Intronic
1143741483 17:8957279-8957301 AGAGCAGGTCAACAGTGGAATGG - Intronic
1144217538 17:13069512-13069534 AAAGAAATTCAAAAGTGGCCAGG - Intergenic
1144364531 17:14529442-14529464 ATAAGAGGTCAACTGTGGCAGGG - Intergenic
1144641874 17:16941785-16941807 AAAAGAGATGAACAGTTGCCAGG - Intronic
1146089385 17:29860952-29860974 TCAGGAGTTCAAGAGTGGCCTGG - Intronic
1146189102 17:30749285-30749307 ATAGGAGTTCAAAACTGGCCTGG - Intergenic
1146333989 17:31953615-31953637 ATAGGAGTTCAAAACTGGCCTGG - Intronic
1147706631 17:42429824-42429846 CCAGGAGTTCAAGAGTGGCCTGG - Intergenic
1148367645 17:47068784-47068806 AAAGAAGGTATACAGTGGCTAGG - Intergenic
1149528980 17:57379903-57379925 AAAGGATTTCTAAAGTGGCCAGG - Intronic
1150363937 17:64564392-64564414 AAAGCAGGTCAGCAGTTGGCTGG + Intronic
1151578117 17:74963009-74963031 AGAGCAGGTCAGCAATGGCCAGG + Exonic
1151677057 17:75604016-75604038 TAAGGAGGTCCACAGAGCCCTGG - Intergenic
1151727063 17:75891357-75891379 AAAGGAGGACAGCAGTGGGCTGG + Intronic
1156421642 18:36960281-36960303 TCAGTAGGTAAACAGTGGCCGGG + Intronic
1157724698 18:49954932-49954954 AAGTGAGATCAACAGTGGTCAGG - Intronic
1157999378 18:52598545-52598567 ATGGGAGGTAAACGGTGGCCAGG + Intronic
1161665325 19:5572640-5572662 AAAGGAGGGAAACTGAGGCCCGG + Intergenic
1161701577 19:5798789-5798811 AAAAGAGAGAAACAGTGGCCGGG - Intergenic
1162098380 19:8324529-8324551 ACAGGAGGGCACCAGTGCCCTGG - Exonic
1162149592 19:8635425-8635447 AGAGGAAGTCAGCAGGGGCCAGG - Intergenic
1162741026 19:12773825-12773847 AGATGAGGTCATCAGGGGCCTGG - Intronic
1162867810 19:13562137-13562159 AAAGGAGGTCTAGGGTGGCTTGG - Intronic
1164162713 19:22639133-22639155 AAAGAAGATCAATATTGGCCAGG - Intronic
1166104004 19:40588823-40588845 AGCGGAGGTCAACAGGGGTCAGG - Intronic
1167025340 19:46912337-46912359 AAAGGAAGAGAACACTGGCCGGG - Intergenic
925173764 2:1768188-1768210 AGAGGAGCTCAAAGGTGGCCTGG - Intergenic
927348430 2:22075757-22075779 AAGGGAGATCATCAGTAGCCTGG + Intergenic
929239484 2:39639360-39639382 AAAGGAGGACCACAGTGGCAAGG - Intergenic
929471666 2:42199970-42199992 TAATGAGATGAACAGTGGCCGGG + Intronic
929678915 2:43968696-43968718 AAAGTAGGACAGCAGTTGCCAGG + Intronic
930535776 2:52644426-52644448 GAAGCAGGTCAACAGTGCACTGG - Intergenic
931908645 2:66870183-66870205 AGATGAGGTCAGAAGTGGCCAGG + Intergenic
931971934 2:67597615-67597637 ACAGGAGTTCAAGACTGGCCTGG - Intergenic
932507478 2:72249509-72249531 AAAGGAGGTAAACAGTTTCTTGG + Intronic
933703022 2:85269528-85269550 CCAGGAGTTCAACAGTAGCCTGG - Intronic
933882597 2:86685103-86685125 AAAGGAGGTGCAAATTGGCCAGG - Intronic
936464982 2:112739861-112739883 CTAGGAGTTCAAGAGTGGCCTGG - Intronic
939014541 2:136886647-136886669 AAAGAATCTCAACAGTGCCCAGG + Intronic
940868669 2:158841319-158841341 AAAGAACTTAAACAGTGGCCAGG - Intronic
940972154 2:159905927-159905949 CAAGGAGATTAACAGTGGACTGG + Intergenic
943997314 2:194786834-194786856 AAAGGAGGTCATCTGTGGTTTGG - Intergenic
944053949 2:195503671-195503693 AAAAAAGGCTAACAGTGGCCGGG + Intergenic
944078623 2:195759639-195759661 AAAGGAGTTCAAGACTAGCCTGG + Intronic
947351541 2:229251313-229251335 ACAGAAAGTTAACAGTGGCCTGG + Intronic
1169899311 20:10536630-10536652 AGAAGAGGGCAACGGTGGCCAGG - Intronic
1170592797 20:17783777-17783799 AAAGCAGCTCAGCAGTTGCCAGG + Intergenic
1170891360 20:20378727-20378749 AAAAGAGGTCATCAGTTGCCAGG - Intergenic
1171309411 20:24134567-24134589 AAAGGGGGTCAGCCCTGGCCTGG + Intergenic
1172193342 20:33075483-33075505 AAAGGAGGTCAAGGATGGGCAGG - Intergenic
1172432603 20:34905125-34905147 ACAGGAGTTCAAGACTGGCCTGG - Intronic
1173448899 20:43144634-43144656 AAAGGAGGTTAACGGTTGCCTGG + Intronic
1174264995 20:49324908-49324930 ACAGCAGGTCAAGAGTGGCCAGG - Intergenic
1175061927 20:56251474-56251496 AATGGAGAACGACAGTGGCCCGG - Intergenic
1175167741 20:57057308-57057330 TCAGGAGGTCAAGACTGGCCTGG - Intergenic
1176033110 20:63023363-63023385 AAAGGAGGTGCACCCTGGCCCGG + Intergenic
1176289958 21:5038459-5038481 AAGGGAGGTCTGGAGTGGCCTGG - Intronic
1177938708 21:27382367-27382389 AAAGCAGATCAACATTGGCAAGG - Intergenic
1179867294 21:44225180-44225202 AAGGGAGGTCTGGAGTGGCCTGG + Intronic
1179936305 21:44606836-44606858 AAAGGTGGTTACCAGAGGCCGGG + Intronic
1180072811 21:45445137-45445159 AAAGGAGATGACCGGTGGCCAGG - Intronic
1180230493 21:46424218-46424240 AGAGGTGGCCAAGAGTGGCCGGG - Intronic
1180733571 22:18000271-18000293 AATGAAGGTCAACTGTGGACAGG - Intronic
1180830329 22:18902468-18902490 AGAGGAAGTGACCAGTGGCCTGG + Intergenic
1181288701 22:21773950-21773972 AAGGGAGGTCAAAATTGGCCGGG - Intronic
1181573906 22:23782154-23782176 CAAGCAGGTCCACAGTGGCGGGG + Intronic
1181639216 22:24187999-24188021 AAAGGAGGGCAACAGGTACCTGG + Exonic
1181835362 22:25602773-25602795 AAAGCAGGTCAATAGTTGCCTGG + Intronic
1183477731 22:38045142-38045164 TAAGGAGGCCAGCAGAGGCCAGG - Intergenic
1184040841 22:41942453-41942475 AAAGTAAATAAACAGTGGCCGGG + Intronic
1184313080 22:43661163-43661185 CCAGGAGTTCAAGAGTGGCCGGG + Intronic
1184667424 22:45996379-45996401 AAAGGAGGTCAGCAGCAGGCAGG + Intergenic
1203280418 22_KI270734v1_random:127739-127761 AGAGGAAGTGACCAGTGGCCTGG + Intergenic
949622302 3:5827382-5827404 AAATGAAATCAACAGTGACCTGG + Intergenic
950458812 3:13108924-13108946 AAATGCGGTAAACAGTGGACAGG + Intergenic
950981100 3:17305180-17305202 AAAGAAGGTCAAGAGTGCCCAGG - Intronic
951534746 3:23730445-23730467 AAAAGAGGATAATAGTGGCCCGG - Intergenic
951967980 3:28409413-28409435 AAAGGGAGAAAACAGTGGCCGGG - Intronic
952034127 3:29178917-29178939 AGAGCATGTCAACAGTGTCCTGG + Intergenic
952649698 3:35710406-35710428 TAAGGATGCCTACAGTGGCCTGG + Intronic
953454819 3:43032933-43032955 TCAGGAGCTCATCAGTGGCCTGG + Exonic
955123276 3:56083368-56083390 AAATGAGAGCAACAGTTGCCTGG + Intronic
955261274 3:57393330-57393352 AAATGAGGTCTAAAGTGGCCGGG + Intronic
956675905 3:71731532-71731554 AAAGGTGGACAAGAGAGGCCTGG - Intronic
960099889 3:113730088-113730110 CCAGGAGTTCAACACTGGCCTGG + Intronic
960665643 3:120106254-120106276 AAAGTAGGCCTATAGTGGCCTGG - Intergenic
961056385 3:123792456-123792478 AAAGGTGGTCACCAGGGGCTGGG - Intronic
962172983 3:133122568-133122590 AAAATTGGTCAACATTGGCCAGG + Intronic
963068625 3:141283466-141283488 AAAGGATTTCAAAAGGGGCCAGG + Intronic
963233756 3:142935610-142935632 GCAGGAGGTCAGCAGTGGGCTGG + Intergenic
965609142 3:170526563-170526585 AAAGGGGATGAACAGTGACCAGG + Intronic
967147577 3:186618999-186619021 TAAAGAAGTCATCAGTGGCCAGG + Intronic
967998410 3:195184349-195184371 AAAGGAGGTCAACTGAGGTATGG - Intronic
968414302 4:416890-416912 AAAGGAGGTCATCAGTAGCCCGG + Intergenic
971385749 4:26139299-26139321 GAAGGAGCTCAACAATGGGCTGG - Intergenic
972937228 4:44151447-44151469 ACAGGAGTTCAAGACTGGCCTGG + Intergenic
972954536 4:44373067-44373089 AAAAAAGGTCAATAGAGGCCGGG + Intronic
973259515 4:48148053-48148075 AAAGTAGGTTAATAGTTGCCTGG + Intronic
975421712 4:74172133-74172155 AAAAGAGGTCAATGGTTGCCTGG + Intronic
975789796 4:77936913-77936935 CAAGGAGTTCAAGAGTAGCCTGG + Intronic
977120365 4:93092207-93092229 AAAGATGCTCAACAATGGCCTGG - Intronic
977399566 4:96515084-96515106 AAAGATGGTCATCAGTGGCTAGG + Intergenic
977835354 4:101639525-101639547 CAAGGAGGTAGAGAGTGGCCAGG - Intronic
978740182 4:112128329-112128351 TAAGGAGCACAACAGGGGCCAGG + Intergenic
979321993 4:119335687-119335709 AAAGGTGGATAACAGTGGTCAGG + Intergenic
981703023 4:147627688-147627710 CCAGGAGGTCAAGAGTAGCCTGG + Intronic
981703043 4:147627820-147627842 CCAGGAGGTCAAGAGTAGCCTGG + Intronic
981703064 4:147627951-147627973 CCAGGAGGTCAAGAGTAGCCTGG + Intronic
983239968 4:165221296-165221318 AAAGGTGGATAACAGTGGTCAGG + Intronic
983388284 4:167094291-167094313 AAAAGAGCTCAACAGTGAGCAGG - Intronic
983692698 4:170491602-170491624 AGAGGAGGGAAAGAGTGGCCTGG - Intergenic
984425883 4:179585011-179585033 AAAGTATGTCAAAAGTTGCCAGG - Intergenic
985489534 5:171315-171337 CAAGGAGGCCAGCTGTGGCCTGG + Exonic
986426502 5:7636805-7636827 AATGGTGGTCACCAGTGGCCTGG + Intronic
989790136 5:45388962-45388984 AAAGGAAGGCAAAACTGGCCTGG - Intronic
990326753 5:54684561-54684583 ACAGGAAGCCTACAGTGGCCAGG - Intergenic
992506762 5:77394917-77394939 AAAGGTGATCAACAATTGCCTGG - Intronic
992519162 5:77531918-77531940 AAAGGAGATCAGTAGTTGCCAGG + Intronic
993083116 5:83327220-83327242 AAATCAGGTCAGCAGTTGCCAGG - Intronic
994097862 5:95863309-95863331 TAAGGAGGTGACCAGTGACCTGG + Intergenic
996973112 5:129396834-129396856 AAGGCAGCTCAACAATGGCCTGG - Intergenic
997837671 5:137209012-137209034 AATGGAGGTCAAAAGGGGCTAGG - Intronic
997952835 5:138255687-138255709 TCAGGAGTTCAACACTGGCCTGG + Intronic
998620133 5:143784549-143784571 AAAGAAGGTCAGTAGTTGCCTGG - Intergenic
999208468 5:149867559-149867581 TAATGAGGTTGACAGTGGCCTGG + Intronic
999273954 5:150316172-150316194 TCAGGAGTTCAAGAGTGGCCTGG - Intronic
999409991 5:151342340-151342362 AAAGAAGGTGGACAGGGGCCTGG - Intronic
1001830946 5:174788944-174788966 AAAAAAGGTCAAGGGTGGCCGGG + Intergenic
1002180029 5:177426613-177426635 AAATGAGGTAAACAGAGGGCGGG + Intronic
1002554967 5:180029834-180029856 AAAAGAGGTGGATAGTGGCCAGG - Intronic
1003415468 6:5903702-5903724 CAAGGAGGTCAACAGCGCCCAGG + Intergenic
1004022031 6:11784788-11784810 AATGGAGGTCACCACGGGCCTGG + Intronic
1005797168 6:29377467-29377489 AAAAGAACTCAACAGAGGCCAGG + Intronic
1006033488 6:31194735-31194757 AAAGCAGGTCAAAAGTGGCTGGG + Intergenic
1006177154 6:32129227-32129249 ACAGGAGGTCCAGAGTGCCCAGG + Exonic
1006735828 6:36271742-36271764 GTGGGAGGTCAACAGGGGCCAGG + Intronic
1007463206 6:42033109-42033131 AAAGTATATCAACTGTGGCCAGG + Intronic
1007693417 6:43717230-43717252 AAAGAAGGTGGACAGAGGCCAGG - Intergenic
1008251563 6:49245954-49245976 AATGGAGGTCACCAGAGGCTGGG + Intergenic
1008606756 6:53147636-53147658 AAAGGAGTTCAAGACCGGCCTGG - Intronic
1009057611 6:58356044-58356066 AAAGGAGGAGATCAGTGGCATGG - Intergenic
1011940808 6:92841009-92841031 AAAAGAGTCAAACAGTGGCCGGG + Intergenic
1013134101 6:107262863-107262885 CCAGGAGTTCAACACTGGCCTGG + Intronic
1015462745 6:133511674-133511696 CAATCAGGTCAACTGTGGCCGGG + Intronic
1018388477 6:163325756-163325778 AAACAAGGTGAACAGAGGCCAGG + Intergenic
1018737698 6:166700941-166700963 ACAGGAGTTCAAAAGTTGCCTGG + Intronic
1021190641 7:17615913-17615935 AAAGTATGTAAAGAGTGGCCTGG + Intergenic
1021467048 7:20955912-20955934 AAAGGAGGTAAAAAGAGGCCGGG + Intergenic
1021700230 7:23312208-23312230 ACAGGAGTTCAAAAGTTGCCTGG + Exonic
1022314169 7:29229089-29229111 GAAGGAGGTCAACAGCGGGGAGG - Intronic
1022954057 7:35365260-35365282 ATAGGAGTTCAGCAGTGGGCAGG - Intergenic
1023021210 7:36013287-36013309 ATAAAAAGTCAACAGTGGCCGGG - Intergenic
1023082232 7:36536464-36536486 AGATGAGATCTACAGTGGCCTGG + Intronic
1024216290 7:47251904-47251926 AAAGCAGGTCAGTAGTTGCCTGG + Intergenic
1025155155 7:56598477-56598499 ACAGGAGTTCAAAAGTTGCCTGG - Intergenic
1026748613 7:73032137-73032159 AAATGAGGTCACTAGAGGCCAGG + Intergenic
1026752261 7:73060282-73060304 AAATGAGGTCACTAGAGGCCAGG + Intergenic
1026755912 7:73088409-73088431 AAATGAGGTCACTAGAGGCCAGG + Intergenic
1027034809 7:74917403-74917425 AAATGAGGTCACTAGAGGCCAGG + Intergenic
1027091494 7:75305020-75305042 AAATGAGGTCACTAGAGGCCAGG - Intergenic
1027095137 7:75332986-75333008 AAATGAGGTCACTAGAGGCCAGG - Intergenic
1027324201 7:77034683-77034705 AAATGAGGTCACTAGAGGCCAGG + Intergenic
1027653248 7:80897472-80897494 AAGGGAGGTCAGAATTGGCCAGG - Intronic
1028620801 7:92826335-92826357 AAAGGAGGTCCAAAGTTACCAGG + Intronic
1028956158 7:96694160-96694182 AAAGCAGATCAGCAGCGGCCAGG + Intronic
1029395247 7:100303727-100303749 AAATGAGGTCACTAGAGGCCAGG - Intergenic
1029819397 7:103131447-103131469 CAAGGAGTTCAAGATTGGCCTGG + Intronic
1031564449 7:123277973-123277995 AAAAGAGGTCAACATTGCCCTGG + Intergenic
1032699392 7:134365535-134365557 AAGGGATTTCATCAGTGGCCTGG + Intergenic
1033252729 7:139775292-139775314 AAAGGAGGTCATCAGAGTCTTGG + Intronic
1033604079 7:142912668-142912690 AAAGGTGGTGAACAGTGCCATGG + Exonic
1033659206 7:143392130-143392152 AAAGTAGGAGAACAGAGGCCTGG + Intronic
1034580237 7:152035262-152035284 AAAGAAGGTTAACAGAGTCCTGG + Intronic
1036430097 8:8681766-8681788 GAAGGAAGTTAACTGTGGCCTGG + Intergenic
1036667578 8:10757523-10757545 CCAGGAGTTCAAGAGTGGCCTGG - Intronic
1037085096 8:14838639-14838661 AAAGGAAGGCAAAAGTAGCCAGG - Intronic
1037773520 8:21817456-21817478 AATGGAGGTAAACGCTGGCCTGG - Intergenic
1039871885 8:41552579-41552601 AAAAGAGGTCAATACAGGCCGGG + Intergenic
1041034776 8:53776926-53776948 AAATGAGCTCAAAAGTGGACTGG + Intronic
1041274239 8:56141607-56141629 CAAGGAGATCCCCAGTGGCCAGG + Intergenic
1041659438 8:60387064-60387086 TCAGGAGGTCAAGACTGGCCTGG - Intergenic
1041662772 8:60415149-60415171 CAGGCAGGTCAACAGAGGCCAGG + Intergenic
1043947589 8:86272113-86272135 AAAAATGGTCAGCAGTGGCCGGG + Intronic
1046480658 8:114813458-114813480 AAAGCACCTCAACATTGGCCTGG + Intergenic
1048138279 8:131767883-131767905 AAAGAATGGAAACAGTGGCCAGG + Intergenic
1049984762 9:939255-939277 AAAGGAGGTCCTTAGTGGCCTGG - Intronic
1052337382 9:27333983-27334005 AAAGGATGTCAAAATTTGCCAGG - Intronic
1053080749 9:35174533-35174555 AAAGGAGTTCAAGACTAGCCTGG - Intronic
1054200149 9:62072808-62072830 AAAGGAGGTAAAAAGTCTCCGGG - Intergenic
1054638206 9:67515552-67515574 AAAGGAGGTAAAAAGTCTCCGGG + Intergenic
1055768546 9:79691546-79691568 AAAGGGGGTCCACAGTGTGCAGG - Intronic
1056627020 9:88262256-88262278 TAAGGAGGTCAACACAAGCCTGG + Intergenic
1057201578 9:93143290-93143312 AGATGAGGCCGACAGTGGCCGGG - Intergenic
1058011881 9:99987701-99987723 ATAGAAGGTCAACAGTTGCCAGG - Intronic
1059101180 9:111473443-111473465 AAGAGAGGTCAGCGGTGGCCGGG - Intronic
1059226412 9:112677084-112677106 ATAGAAAGTAAACAGTGGCCAGG - Intergenic
1061747812 9:132753156-132753178 AAAGGAGGTCAACAGTGGCCTGG - Intronic
1062012977 9:134276767-134276789 TAAGAAGGACAACAGTGGCTTGG + Intergenic
1062017510 9:134298322-134298344 AAAGGAGATGAACAGTTGCCAGG + Intergenic
1187616979 X:21006582-21006604 AAAGAAGGTCACAGGTGGCCGGG + Intergenic
1189197489 X:39164583-39164605 AGAGTGGGTCAACTGTGGCCTGG - Intergenic
1189549586 X:42079008-42079030 AAAGAAAGCCCACAGTGGCCTGG + Intergenic
1190628929 X:52366395-52366417 AAAGGAGTGCAGCTGTGGCCAGG + Intergenic
1191844662 X:65538043-65538065 AAAAGAGGTGAGCATTGGCCAGG + Intergenic
1192224785 X:69220866-69220888 AAAAGAGCTCACCACTGGCCGGG + Intergenic
1192361207 X:70441131-70441153 AAAGGAATTCAAATGTGGCCAGG + Intergenic
1192581126 X:72282464-72282486 AAAGCAGATCAGCAGTTGCCTGG - Intronic
1197529822 X:127610182-127610204 AAAAGATGTCAAAATTGGCCGGG + Intergenic
1197627430 X:128818021-128818043 AAAGAAGGTCAATAATTGCCTGG + Intergenic
1198236709 X:134742289-134742311 TAAGGAAGACAACAGTGGGCCGG + Intronic
1200143228 X:153912529-153912551 AGGGGAGCCCAACAGTGGCCTGG + Intronic
1200314180 X:155114423-155114445 AATGGTGGTCACCAGGGGCCGGG + Intronic
1200688464 Y:6279720-6279742 AAAGATTGTCAACATTGGCCAGG - Intergenic
1201349821 Y:13027491-13027513 AAAGGAGGGCAATAGTGGACAGG + Intergenic