ID: 1061747813

View in Genome Browser
Species Human (GRCh38)
Location 9:132753161-132753183
Sequence GGACAAAAGGAGGTCAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061747813_1061747819 -9 Left 1061747813 9:132753161-132753183 CCACTGTTGACCTCCTTTTGTCC 0: 1
1: 0
2: 0
3: 12
4: 282
Right 1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061747813 Original CRISPR GGACAAAAGGAGGTCAACAG TGG (reversed) Intronic
901293381 1:8141745-8141767 GTACAAATGGAGGCCTACAGAGG + Intergenic
902166506 1:14576215-14576237 GGACTAAAAGAGGTTATCAGTGG + Intergenic
903920821 1:26799385-26799407 GGGCAAAAGTAGCTCAGCAGGGG - Intergenic
904355342 1:29935074-29935096 GTCTAAAAGGAGGACAACAGAGG + Intergenic
907952179 1:59194312-59194334 AGGCAAAAGGAAGTCAAGAGAGG - Intergenic
908110154 1:60888687-60888709 GCACAGCAGGAGGTGAACAGTGG - Intronic
908994193 1:70132039-70132061 AGACAAAAGAAGGGCAATAGAGG + Intronic
910033642 1:82763436-82763458 TGACAAAAGAAGGTAACCAGAGG - Intergenic
910368560 1:86491910-86491932 GGAGAAATGAAGGTCCACAGAGG - Intronic
915296442 1:154924952-154924974 GGAGAAAATGAGGTCTCCAGAGG + Exonic
915483779 1:156205676-156205698 GGAGATAGGGAGGCCAACAGTGG - Intronic
915787249 1:158627369-158627391 GGACAACAAGATGTCAACAAAGG + Intronic
915852292 1:159338189-159338211 GGACACAAGTTGATCAACAGGGG - Intergenic
915951004 1:160190069-160190091 GGACAAAAGGGGGACAAATGTGG - Intergenic
918811897 1:189132905-189132927 GAACATAAGGATGTCACCAGAGG + Intergenic
919265055 1:195252123-195252145 GCACAGCAGGAGGTGAACAGTGG + Intergenic
920164053 1:204023048-204023070 AGATAAAAAGAGGGCAACAGTGG - Intergenic
920527396 1:206677392-206677414 TGACCCAGGGAGGTCAACAGGGG - Intronic
921501109 1:215904495-215904517 GGATAAAAGGGGTTAAACAGAGG - Intronic
922030610 1:221794013-221794035 GGAAAAAAGGAGGAGAATAGAGG - Intergenic
922208673 1:223470441-223470463 GGACAAAAGGAGAGCACCACAGG - Intergenic
923771592 1:236942300-236942322 GGCCAAAAGGAGGTCAGCATGGG + Intergenic
924690464 1:246344984-246345006 AGAGAAAAGGAGGGAAACAGGGG + Intronic
1062891843 10:1068018-1068040 GAACACATGGAGGTAAACAGTGG + Intronic
1062922766 10:1292639-1292661 GGACAAAATGTGATGAACAGAGG + Intronic
1062962740 10:1585641-1585663 GGACAACTTGAGGTCAGCAGGGG - Intronic
1068987536 10:63121027-63121049 GCACAGCAGGAGGTGAACAGTGG + Intergenic
1071024104 10:81092391-81092413 GGACAAAAGAATGTGAACAATGG - Intergenic
1072885270 10:99266980-99267002 GGACAAAAGAATCTGAACAGCGG + Intergenic
1074435508 10:113430940-113430962 AGAGAAAAGGAGGATAACAGGGG + Intergenic
1076397043 10:130146984-130147006 GGACACAAGGGTGACAACAGAGG - Intronic
1078010836 11:7572046-7572068 GGACAAAGGGCAGTCAAGAGAGG + Intronic
1078801960 11:14654940-14654962 AGAAAAAAGGAGGTCAAAAAAGG + Intronic
1079875771 11:25855517-25855539 GGACAAAAGTAAATCAACAGGGG + Intergenic
1081530926 11:43958851-43958873 GGCCAACAGGGGGTCAACTGGGG + Intergenic
1083260936 11:61522804-61522826 GGAGAAAAGGAGTGCAAGAGAGG - Intronic
1083447354 11:62717473-62717495 GGACAGAAGCAGGTAACCAGAGG + Intronic
1086424289 11:86669179-86669201 GGACAGAAGGGGAGCAACAGAGG - Intronic
1089817191 11:121186984-121187006 GCACTCAAGGAGCTCAACAGAGG + Intronic
1090158772 11:124469463-124469485 AGTCAAAAGGAGATCAAAAGAGG + Intergenic
1090280789 11:125454454-125454476 GGATAAAAGGAGGAAAACTGGGG - Intronic
1090540737 11:127700405-127700427 GGCCAAAAGGAGTTCAGCTGGGG - Intergenic
1091470099 12:719035-719057 GGACAAAAGCATGTAAATAGTGG - Intergenic
1092086244 12:5764706-5764728 GGAAAAAAGCAGGAGAACAGGGG - Intronic
1092412282 12:8263038-8263060 GCACAGAAGGAGGTGAGCAGTGG - Intergenic
1092776847 12:11951166-11951188 GGACCAAATGAAATCAACAGTGG + Intergenic
1093375445 12:18421151-18421173 GGACTAAATGATGTCAACATGGG + Intronic
1093757690 12:22870857-22870879 GGACATAAAGATGGCAACAGTGG + Intergenic
1095652687 12:44631494-44631516 GGACATAAAGACGGCAACAGCGG + Intronic
1096225531 12:49864564-49864586 GGAGAAAAAGAAGCCAACAGGGG + Intergenic
1100656753 12:96654737-96654759 GAACATATGGAGGTTAACAGTGG - Intronic
1101228636 12:102715879-102715901 GCACAGCAGGAGGTGAACAGTGG - Intergenic
1101321784 12:103679073-103679095 GGTTAAAAGGTGGTCAACATGGG + Intronic
1101865342 12:108515888-108515910 GGCCCACAGGAGGTAAACAGAGG - Intronic
1103195860 12:119043350-119043372 GGACACAGGGAGGGGAACAGGGG + Intronic
1103400938 12:120641989-120642011 GGCCACAAAGAGGTCATCAGTGG + Intronic
1106815474 13:33402697-33402719 GGAGAAAAGCAGATGAACAGTGG + Intergenic
1108051604 13:46447179-46447201 GGACTAAAGGAGGTTAAAACTGG + Intergenic
1108824947 13:54401577-54401599 CGTCAAAATGAGGTCAAAAGAGG - Intergenic
1109877965 13:68430260-68430282 GGACAGAAGGAGGTCATTATAGG + Intergenic
1110388656 13:74945528-74945550 GAAGAAAGGGAGGGCAACAGAGG + Intergenic
1111601320 13:90479127-90479149 GGAAAAAGTGAGGTCAAAAGAGG - Intergenic
1111939582 13:94595602-94595624 GAAGAAAAGGGTGTCAACAGTGG + Intronic
1112873350 13:104002595-104002617 GGACAAGAAGAGGTTAACTGGGG - Intergenic
1115450508 14:33542307-33542329 GGACAAAAAAAGGGCAACTGAGG - Intronic
1116044779 14:39731618-39731640 GGACAAAAGAATCTGAACAGTGG - Intergenic
1117294073 14:54362873-54362895 GGACAGAAGGAGGCCAAAACAGG + Intergenic
1117750911 14:58923252-58923274 GGACATAAGGATGGCAACAATGG + Intergenic
1118300111 14:64607612-64607634 GCACAAAATAAGGTCTACAGAGG - Intergenic
1118994535 14:70823824-70823846 GAAGAAATGGAGGTGAACAGAGG + Intergenic
1121863085 14:97337670-97337692 GGTCTCAAGGAGGTCCACAGTGG + Intergenic
1125870938 15:43101318-43101340 GGACAGGAAGAGGGCAACAGTGG + Intronic
1127500882 15:59553288-59553310 GGACAGAGGGAGGGCAAGAGAGG - Intergenic
1128136209 15:65265540-65265562 GGACAAAAGCAGCTCAAGAGGGG + Intronic
1128773860 15:70303837-70303859 GGAAAACAGAAGCTCAACAGAGG - Intergenic
1128858508 15:71043286-71043308 GGGAAAAAGAAGGTCAACAGTGG - Intronic
1129233440 15:74209348-74209370 GGACAAATGGAGGTAAGTAGGGG - Intronic
1129581428 15:76815606-76815628 GCACAACAGGAGGTGAGCAGTGG + Intronic
1136383869 16:29910898-29910920 GGACAAAAGCAGGTTGGCAGGGG - Intronic
1136405062 16:30040516-30040538 GGAGAAAAGGAGGCGAAGAGAGG + Intronic
1137387973 16:48058369-48058391 GGAGAAAAGGAGTTCAAGAATGG - Intergenic
1138055356 16:53827324-53827346 ACACAAAAGAAAGTCAACAGAGG - Intronic
1140430544 16:74899127-74899149 GGAAAAGAGGATGTCCACAGCGG + Intronic
1144105175 17:11977842-11977864 AGAAAAAAGGAGATTAACAGGGG + Exonic
1146580873 17:34037557-34037579 GGACAAATGGCGTTCAGCAGCGG - Intronic
1148864683 17:50622431-50622453 TGACAACAGGAGGGGAACAGTGG - Intronic
1150122110 17:62612607-62612629 GGACAAATGGCGTTCAGCAGCGG + Exonic
1150922524 17:69498463-69498485 GGACAAAAGGGCATCAGCAGGGG + Intronic
1150948389 17:69773744-69773766 GGACATAAGGATGGCAACTGGGG + Intergenic
1151699392 17:75734911-75734933 GGACAAAAGGGGGTCACTGGAGG + Intronic
1152376849 17:79922973-79922995 GGACATAAGAATGTCCACAGTGG - Intergenic
1154234001 18:12585376-12585398 AGACAAAAGGCTTTCAACAGTGG + Intronic
1155118421 18:22793462-22793484 GGACCATAGGAGGTTATCAGAGG + Intergenic
1156560539 18:38120570-38120592 GGATCAAAGGAGGTCAAAATAGG - Intergenic
1157670484 18:49524439-49524461 GGAGATAAGGAGCTGAACAGGGG + Intergenic
1159944290 18:74432292-74432314 GCACAACAGGAGGTGAGCAGTGG + Intergenic
1160249600 18:77190121-77190143 GTACAAAAGCAATTCAACAGAGG - Intergenic
1160529999 18:79557178-79557200 GGACTGAAGCAGGTCCACAGAGG + Intergenic
1161205819 19:3040900-3040922 GAGCAAACGGAGGTCCACAGGGG - Intronic
1161884839 19:6986490-6986512 TGCCAAAAGGATGCCAACAGAGG - Intergenic
1162004858 19:7771269-7771291 GCACAGCAGGAGGTGAACAGAGG - Intergenic
1162248670 19:9424400-9424422 GAACGAAAGCAGGACAACAGAGG + Intronic
1162867811 19:13562142-13562164 GGTCAAAAGGAGGTCTAGGGTGG - Intronic
1162957698 19:14108316-14108338 TGACAAAGGGAGTTGAACAGTGG + Intronic
1164023764 19:21331565-21331587 GGGCAATAGGTGGTCAGCAGTGG - Intergenic
1164307927 19:24021233-24021255 GGACAACAGGTGGCCAGCAGTGG - Intergenic
1164800274 19:31069982-31070004 GGTTAAATGGAGGTCAACCGGGG + Intergenic
1165714330 19:38034776-38034798 GGAAAAAGGGAGGCCAAGAGGGG - Intronic
1167135902 19:47615381-47615403 AGACACAAGGAGGTCACCTGAGG - Intronic
1167230728 19:48281466-48281488 GGACAGAGGGAGGGAAACAGAGG - Intronic
1167807598 19:51799357-51799379 GGACAAAAGAACATCAAGAGGGG - Intronic
925232951 2:2252231-2252253 GGACAAACAGAGGTAAGCAGAGG - Intronic
926062304 2:9812180-9812202 TGACAGGAGGAGGCCAACAGCGG - Intergenic
926911371 2:17854337-17854359 GGACATAAAGATGGCAACAGTGG - Intergenic
929167099 2:38893460-38893482 GGTCAAAAGGGGATCACCAGAGG - Intronic
929267109 2:39930452-39930474 GGACAAAAGTAGAGCTACAGAGG + Intergenic
929608347 2:43250955-43250977 GGACAGACGAAGGTGAACAGAGG + Intronic
930556541 2:52903066-52903088 GGACCAAAAGAGGACAACAATGG + Intergenic
930689149 2:54341315-54341337 GAGCAAAAAGAGGGCAACAGGGG - Intronic
931388163 2:61815879-61815901 GGGTAAAAGGAGGTAGACAGTGG - Intergenic
932089419 2:68791749-68791771 GGAGAAAAGGAGCCCAAAAGGGG - Intronic
932690247 2:73907076-73907098 GGGCAAAAGAAGGTCTCCAGAGG - Intronic
932720711 2:74137359-74137381 GGAGAAAAGGAGACCAACACAGG + Intronic
933213274 2:79596330-79596352 GGAAAAAAGGAGGGCATCAAAGG + Intronic
933851570 2:86371079-86371101 GGACAAGCAGAGGTAAACAGTGG + Intergenic
936053342 2:109242102-109242124 GGAAAACAGGAGGCGAACAGAGG - Intronic
938660526 2:133482020-133482042 GAACATAAGGAGGTAAAGAGTGG - Intronic
939795657 2:146641519-146641541 GAAGAAAAGGATGTCCACAGTGG + Intergenic
941412322 2:165174512-165174534 AAACAAAAGGAGAACAACAGAGG - Intronic
941500495 2:166269449-166269471 GGACAAAGAGAGGACAAGAGAGG + Intronic
941759110 2:169221365-169221387 GGAGAAAAAGAGGCCTACAGAGG + Intronic
942204451 2:173605581-173605603 GGAGAAAAGGCTGTCAATAGAGG - Intergenic
942339667 2:174930574-174930596 GCCCAAAGGGAGGTCAACAAAGG + Intronic
944553922 2:200869502-200869524 GGACAAAAAGATGGGAACAGTGG + Intergenic
946058215 2:216919489-216919511 GCACATAAGGAGGTCTAGAGAGG - Intergenic
946078552 2:217096654-217096676 GGGGAAGAGGAGGTCAAAAGGGG + Intergenic
946529770 2:220558759-220558781 GGCCCATAGGAGGTCAACAAGGG - Intergenic
947080903 2:226395472-226395494 ACATAAAAGGAGCTCAACAGAGG - Intergenic
947702897 2:232249946-232249968 GGAGAGAAGGATGTCAGCAGGGG + Intronic
948236927 2:236398176-236398198 GGAAGAAAGGAGGTCAAAAGGGG - Intronic
948453584 2:238093560-238093582 GGACAAAAGCAGGGGAAGAGGGG - Intronic
1168883073 20:1224423-1224445 GCACAGCAGGAGGTGAACAGTGG - Intergenic
1169963628 20:11190997-11191019 GGACAAAAGGAGGCCAGCATTGG + Intergenic
1170226057 20:13993115-13993137 GGACAGAAGAGGGGCAACAGTGG + Intronic
1170369444 20:15632800-15632822 GGAGGAAAGGAGGACAGCAGGGG - Intronic
1170389981 20:15861704-15861726 GTAGAAAAGGAGATCTACAGGGG - Intronic
1172593127 20:36131556-36131578 GGACACAAGGTGGTTAAGAGGGG - Intronic
1173100308 20:40081630-40081652 GGAAAAAATGAGGTAATCAGTGG + Intergenic
1174030809 20:47624562-47624584 GCACAGCAGGAGGTCAGCAGTGG - Intronic
1174462173 20:50690905-50690927 GGACAAATGGAGGCCTGCAGAGG + Intronic
1175573075 20:60038792-60038814 GGACAGAAGTAGGTCATGAGGGG + Intergenic
1176634638 21:9179839-9179861 GGACAAAAGCCAGTAAACAGGGG - Intergenic
1177530019 21:22346429-22346451 AGACAACAGGAGGTGAACATGGG + Intergenic
1179444052 21:41419273-41419295 GGAGAAAAGGAGGGCAAGAGAGG + Intergenic
1179938688 21:44623498-44623520 TAACAAAAGGAGGACAACATGGG - Intronic
1182041144 22:27239837-27239859 GGAGGCATGGAGGTCAACAGGGG - Intergenic
1182279335 22:29208937-29208959 GGACAAAATGAGGTCCAGAGAGG + Intronic
1183497965 22:38160905-38160927 GGACAAAAGGAGGGCTTCTGGGG + Intronic
1184375810 22:44111956-44111978 GGTCAGAAGGAGGTCAGCCGGGG + Intronic
1184396307 22:44243735-44243757 AGACAAAAGCAGAGCAACAGCGG + Exonic
1184515799 22:44961444-44961466 GGACATAAAGACGGCAACAGTGG - Intronic
952122802 3:30264588-30264610 GGACAAAAGAATCTGAACAGTGG + Intergenic
952924512 3:38311247-38311269 GGACACAACTAGGTCAAAAGAGG - Intronic
953391785 3:42538149-42538171 GGACCCAAGGAGGTCAGCATGGG - Intergenic
953890557 3:46749182-46749204 GGGAAAAGGGAGATCAACAGAGG + Intronic
954153727 3:48673211-48673233 GGACAATAGGGTTTCAACAGGGG + Intergenic
955304401 3:57815261-57815283 GCACAACAGGAGGTAAGCAGAGG - Intronic
956342943 3:68246857-68246879 GGTCAAAAGGAGTTCAAGATTGG + Intronic
956578297 3:70780700-70780722 GGACAAAAGGATGTTATTAGAGG + Intergenic
957668076 3:83262473-83262495 GCACAAGAGGAGGTAAGCAGTGG + Intergenic
957998893 3:87727071-87727093 GGACAAAATGATTTCAAAAGAGG + Intergenic
959553306 3:107688501-107688523 GGACAAATTGAGATCATCAGAGG + Intronic
960291630 3:115892521-115892543 GTACAAAAGCAGGTAAACAGGGG + Intronic
961295954 3:125884474-125884496 GCACAGAAGGAGGTGAGCAGCGG + Intergenic
961614407 3:128167460-128167482 GGCCAAATAGAGTTCAACAGTGG + Intronic
961889844 3:130121699-130121721 GCACAGAAGGAGGTGAGCAGTGG - Intergenic
962152717 3:132909926-132909948 GAAGAAAAGGAAGACAACAGGGG + Intergenic
962492726 3:135909748-135909770 GGGTAAAAGGAGGAGAACAGGGG - Intergenic
962945501 3:140165533-140165555 GGAGAACAGGAGGGCAACCGGGG + Intronic
962950710 3:140216016-140216038 GGACAGCAGGAGGTGAGCAGGGG + Intronic
963249922 3:143093869-143093891 GGACAGCAGGAGGTGAGCAGTGG + Intergenic
965115477 3:164482743-164482765 GGACAAAATGATATCAAAAGAGG + Intergenic
966728494 3:183130737-183130759 GGACAGACGGAGGTGAACTGGGG - Intronic
967881267 3:194303389-194303411 GGACAAGGGGAGGGCAATAGTGG + Intergenic
967998412 3:195184354-195184376 ATCCAAAAGGAGGTCAACTGAGG - Intronic
969000324 4:3975669-3975691 GCACAGAAGGAGGTGAGCAGTGG - Intergenic
969753693 4:9132989-9133011 GCACAGAAGGAGGTGAGCAGTGG + Intergenic
969813586 4:9669177-9669199 GCACAGAAGGAGGTGAGCAGTGG + Intergenic
970177371 4:13353044-13353066 GGACAAAAGGAATTACACAGAGG + Intergenic
970487883 4:16542605-16542627 GTGCAAAAGGAGGCCATCAGAGG + Intronic
970767491 4:19567389-19567411 GAACAAAAGAAGGTCAGCAGGGG + Intergenic
971620380 4:28848312-28848334 GGAAAAAAGGAGGACTCCAGGGG + Intergenic
973047769 4:45555892-45555914 GGACAAAAGCAGGCCAAGTGTGG - Intergenic
975614054 4:76229501-76229523 GGACAAAAGAATCTGAACAGCGG - Intronic
975737086 4:77391576-77391598 GGAGAAATGAAGCTCAACAGAGG - Intronic
976204869 4:82615211-82615233 GGACAAAGGGAAATGAACAGCGG - Intergenic
977394949 4:96459002-96459024 GCACATAAGGAGATAAACAGAGG + Intergenic
977984181 4:103362132-103362154 GGACAGAAAGAGGGCAAAAGGGG - Intergenic
978941370 4:114439938-114439960 GGACAATAAGATATCAACAGGGG - Intergenic
979233723 4:118375679-118375701 GAAAAAAAGGAGGACAACATAGG - Intergenic
980382551 4:132042674-132042696 GGAAAATAGGAAGTCAAGAGAGG - Intergenic
982797201 4:159660690-159660712 GGACAGAAAGAGGGGAACAGCGG - Intergenic
983284161 4:165718080-165718102 GTACAGAAGGAGATGAACAGTGG - Intergenic
984000524 4:174235848-174235870 AGACAGAAGGAGGTAGACAGAGG + Intergenic
984645158 4:182211006-182211028 GGACAAACCGAGGCCAACAGGGG + Intronic
986426501 5:7636800-7636822 GAACAAATGGTGGTCACCAGTGG + Intronic
986642733 5:9888269-9888291 GGAGAAAAGGAGGGCTTCAGGGG - Intergenic
986824393 5:11504946-11504968 GGACAAAAGGAGGCCATGTGGGG - Intronic
986961449 5:13218308-13218330 GGACAGAACAAGGTCAAAAGAGG + Intergenic
987062626 5:14257149-14257171 GGACAGCAGGAGGTCGCCAGAGG - Intronic
988909659 5:35826608-35826630 GGACAGAAGGAAGGGAACAGAGG - Intergenic
989139349 5:38187961-38187983 GGACAAGAGGAGGTGACAAGAGG - Intergenic
990144189 5:52740616-52740638 GGATAAAAGAAGAGCAACAGAGG + Intergenic
990981775 5:61607833-61607855 GGAAGATAGGAGTTCAACAGAGG - Intergenic
992211425 5:74483618-74483640 GCACAGCAGGAGGTAAACAGTGG + Intergenic
992664117 5:78989277-78989299 GCACAGCAGGAGGTGAACAGTGG - Intergenic
993054331 5:82964754-82964776 GGACAATAGCAGGGCAAAAGTGG + Intergenic
993849656 5:92990916-92990938 GGACAAAGGGAGGTCAGGATAGG + Intergenic
995861617 5:116647101-116647123 GCACAACAGGAGGTGAGCAGCGG - Intergenic
996256129 5:121404731-121404753 GGACAAAATGATGTCCACATTGG + Intergenic
996696957 5:126408131-126408153 GGACATAAAGATGGCAACAGTGG - Intronic
996753921 5:126916477-126916499 GGCCAAAAGGAGATCAAAAAAGG + Intronic
996778957 5:127162372-127162394 GGACCAAAAGTGGTCACCAGGGG - Intergenic
997165691 5:131658553-131658575 GGACAAAAGGGGGGCCACAAAGG + Intronic
997368079 5:133338609-133338631 GGACATCAGGAGCTCAAGAGAGG - Intronic
998393567 5:141803788-141803810 AAAAAAAAGGAGGTCCACAGAGG + Intergenic
999745608 5:154589684-154589706 GGACAAAAGTGGGTCGCCAGTGG - Intergenic
1000864728 5:166499727-166499749 GGACTAATGGAGGTCATCTGTGG + Intergenic
1002573111 5:180155256-180155278 AGAGAAAAGGAGGACCACAGAGG - Intronic
1003637408 6:7845370-7845392 TGACAAAAGGTGGGAAACAGGGG - Intronic
1003720789 6:8699908-8699930 GGAAGAAAGGTGTTCAACAGAGG - Intergenic
1005996265 6:30933307-30933329 GGACAACAGGAAGACCACAGTGG + Intergenic
1006147327 6:31967485-31967507 GGTGAAAAGGAGGGCAAGAGGGG - Intronic
1007133221 6:39496264-39496286 GGACGGATGGATGTCAACAGGGG + Intronic
1008663368 6:53692634-53692656 GCACAAAAGGAGGTGAGCAAAGG - Intergenic
1009699172 6:67154306-67154328 TGACAAAAGGATCTCAACAAAGG - Intergenic
1011307945 6:85949829-85949851 GGACAAAAGAAGGTGCAAAGAGG - Intergenic
1013076821 6:106779227-106779249 GGAAAATAGGAGCTCAAGAGGGG + Intergenic
1013877083 6:114845288-114845310 GGACATAAAGATGTCAACATTGG + Intergenic
1014658179 6:124132939-124132961 GGACAAAAGAATCTGAACAGTGG + Intronic
1016372177 6:143386617-143386639 GGAGAAAAGGAAGGCAGCAGGGG - Intergenic
1017062562 6:150499026-150499048 GGACAAAACCAGATCAACAAAGG - Intergenic
1017340106 6:153311155-153311177 GGAGAAAAGGAGTAGAACAGAGG - Intergenic
1018218440 6:161553361-161553383 GGAAAAAAGGAGGAAAAGAGAGG - Intronic
1018267775 6:162043505-162043527 GGACAAATGGAGATGAACAGAGG + Intronic
1020780227 7:12508678-12508700 ACACAACAGGAGGTGAACAGAGG + Intergenic
1022314172 7:29229094-29229116 TGCAAGAAGGAGGTCAACAGCGG - Intronic
1024176945 7:46850315-46850337 GGACATAAAGATGGCAACAGTGG + Intergenic
1026206304 7:68260750-68260772 AGATCCAAGGAGGTCAACAGAGG - Intergenic
1026337544 7:69407705-69407727 GGACAAAAGGCCGGCCACAGTGG + Intergenic
1029586772 7:101477765-101477787 GGACAAATGAAGGTATACAGAGG - Intronic
1029813707 7:103073971-103073993 AGAAAAAAAGAGGTCAACAAAGG + Intronic
1032403438 7:131639354-131639376 GGCCAAACGGAGGGCAACGGAGG - Intergenic
1032706110 7:134422483-134422505 GGAAAAAAAGAAGTCACCAGAGG + Intergenic
1033514680 7:142094332-142094354 GGGGAAAAGGAGGTGAACTGAGG - Intronic
1036723996 8:11202121-11202143 GAAAATCAGGAGGTCAACAGAGG - Intergenic
1037177085 8:15960571-15960593 GGACACAAAGAGGACAACAAGGG - Intergenic
1037221184 8:16523977-16523999 TGACAAAAAGATGCCAACAGCGG + Intronic
1038625127 8:29185075-29185097 GAACAAAAGGAGGCCAAGATGGG - Intronic
1039094055 8:33864244-33864266 GGGGAAAAGGAGGTCAAATGGGG - Intergenic
1041554890 8:59142230-59142252 GCACAACAGGAGGTGAGCAGCGG + Intergenic
1042378279 8:68081328-68081350 GCACAAAAGGAGGTGAGCGGCGG - Intronic
1044064977 8:87688151-87688173 GCACAACAGGAGGTGAGCAGTGG - Intergenic
1044099152 8:88109561-88109583 GAAATATAGGAGGTCAACAGTGG + Intronic
1044323402 8:90831701-90831723 GGAGAAAAGAAGGGCATCAGAGG - Intronic
1044728527 8:95212382-95212404 GGACATAAGGAGGTGGAAAGAGG + Intergenic
1045414765 8:101954624-101954646 GGACAAAGGGAGGAGAAGAGAGG + Intronic
1047599453 8:126411546-126411568 GGAGAAAATGAGATAAACAGGGG + Intergenic
1048035381 8:130672868-130672890 GGAAAAAATGAGGTCAGGAGCGG - Intergenic
1051024339 9:12588968-12588990 GGACAAGAGGAGGTATACAAAGG - Intergenic
1052964274 9:34327729-34327751 GGAAAAAATGAGGTCTAAAGGGG + Intronic
1053140759 9:35681355-35681377 GGAGACAAGGAGGTCAAATGTGG - Intergenic
1053406076 9:37877260-37877282 GCACAGAAGGAGGTGAGCAGTGG - Intronic
1055518533 9:77057789-77057811 GAAGAAAAGGAGGTCTAGAGAGG + Intergenic
1056640543 9:88366672-88366694 GGGCAAAAGCAATTCAACAGAGG + Intergenic
1058420240 9:104826521-104826543 GGACACAAGGAAGACAAGAGAGG + Intronic
1061747813 9:132753161-132753183 GGACAAAAGGAGGTCAACAGTGG - Intronic
1187976203 X:24708198-24708220 TGAACAGAGGAGGTCAACAGAGG - Intronic
1188639946 X:32488734-32488756 GAACAAATGGAGATCACCAGAGG - Intronic
1189761246 X:44323787-44323809 GGAAAAAACAAGGTCAAAAGAGG + Intronic
1190134195 X:47780067-47780089 GCACAACAGGAGGTGAGCAGTGG - Intergenic
1190889014 X:54552865-54552887 TGCCAAAAGGATGTCAGCAGAGG + Intronic
1192032331 X:67527254-67527276 GGGCAATAGGAGGACTACAGGGG + Intergenic
1192565664 X:72161315-72161337 GCAGAAAGGGAGGGCAACAGAGG - Intergenic
1193664446 X:84299099-84299121 GCAGAAAAGAAGGTCAACAATGG + Intergenic
1193932918 X:87579170-87579192 GTACAAAAGGAAGACACCAGAGG + Intronic
1194201002 X:90952613-90952635 GGACACAAGGTGGTCAGTAGGGG + Intergenic
1194734624 X:97497389-97497411 AGAGAAGAGGAGGTTAACAGGGG - Intronic
1195718529 X:107842479-107842501 GGATAAAAGGAGGGCAAGAAGGG + Intronic
1195735577 X:108009434-108009456 GGAAGAAAGGATGTGAACAGGGG + Intergenic
1196786567 X:119426155-119426177 GGAAAAAAGGAGGTGAAAATTGG - Intronic
1197463494 X:126772159-126772181 GGACAAAAGAATCTGAACAGCGG + Intergenic
1198169763 X:134094145-134094167 GGCCAAAAGGTGGCCCACAGTGG + Intergenic
1200528161 Y:4298226-4298248 GGACAAAAGAATCTGAACAGCGG + Intergenic
1200546848 Y:4528072-4528094 GGACACAAGGTGGTCAGTAGGGG + Intergenic