ID: 1061747819

View in Genome Browser
Species Human (GRCh38)
Location 9:132753175-132753197
Sequence CTTTTGTCCTGGGGAATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061747813_1061747819 -9 Left 1061747813 9:132753161-132753183 CCACTGTTGACCTCCTTTTGTCC 0: 1
1: 0
2: 0
3: 12
4: 282
Right 1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG No data
1061747810_1061747819 11 Left 1061747810 9:132753141-132753163 CCCAGGAGGAAGGAGCCAGGCCA 0: 1
1: 0
2: 6
3: 45
4: 435
Right 1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG No data
1061747808_1061747819 18 Left 1061747808 9:132753134-132753156 CCGCATTCCCAGGAGGAAGGAGC 0: 1
1: 0
2: 6
3: 75
4: 472
Right 1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG No data
1061747811_1061747819 10 Left 1061747811 9:132753142-132753164 CCAGGAGGAAGGAGCCAGGCCAC 0: 1
1: 0
2: 2
3: 57
4: 431
Right 1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG No data
1061747812_1061747819 -4 Left 1061747812 9:132753156-132753178 CCAGGCCACTGTTGACCTCCTTT 0: 1
1: 0
2: 1
3: 26
4: 308
Right 1061747819 9:132753175-132753197 CTTTTGTCCTGGGGAATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061747819 Original CRISPR CTTTTGTCCTGGGGAATCTG AGG Intronic
No off target data available for this crispr