ID: 1061754351

View in Genome Browser
Species Human (GRCh38)
Location 9:132802394-132802416
Sequence TTCAGACAGAAGTGTATCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061754344_1061754351 21 Left 1061754344 9:132802350-132802372 CCCTGGAACCTGGGCTGGCCCCA 0: 1
1: 0
2: 5
3: 39
4: 392
Right 1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG No data
1061754346_1061754351 13 Left 1061754346 9:132802358-132802380 CCTGGGCTGGCCCCAGTGACAAG 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG No data
1061754342_1061754351 25 Left 1061754342 9:132802346-132802368 CCCTCCCTGGAACCTGGGCTGGC 0: 1
1: 1
2: 22
3: 96
4: 578
Right 1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG No data
1061754340_1061754351 26 Left 1061754340 9:132802345-132802367 CCCCTCCCTGGAACCTGGGCTGG 0: 1
1: 0
2: 7
3: 98
4: 592
Right 1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG No data
1061754345_1061754351 20 Left 1061754345 9:132802351-132802373 CCTGGAACCTGGGCTGGCCCCAG 0: 1
1: 2
2: 7
3: 54
4: 497
Right 1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG No data
1061754347_1061754351 3 Left 1061754347 9:132802368-132802390 CCCCAGTGACAAGCTCTGTGAAC 0: 1
1: 0
2: 2
3: 15
4: 214
Right 1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG No data
1061754349_1061754351 1 Left 1061754349 9:132802370-132802392 CCAGTGACAAGCTCTGTGAACAG 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG No data
1061754348_1061754351 2 Left 1061754348 9:132802369-132802391 CCCAGTGACAAGCTCTGTGAACA 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG No data
1061754343_1061754351 24 Left 1061754343 9:132802347-132802369 CCTCCCTGGAACCTGGGCTGGCC 0: 1
1: 0
2: 12
3: 87
4: 503
Right 1061754351 9:132802394-132802416 TTCAGACAGAAGTGTATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061754351 Original CRISPR TTCAGACAGAAGTGTATCCT GGG Intronic
No off target data available for this crispr