ID: 1061755530

View in Genome Browser
Species Human (GRCh38)
Location 9:132809562-132809584
Sequence CTGTCCCCACCACTGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061755516_1061755530 24 Left 1061755516 9:132809515-132809537 CCACTCAGTCAGGGCTCTTCCTG 0: 1
1: 0
2: 1
3: 22
4: 248
Right 1061755530 9:132809562-132809584 CTGTCCCCACCACTGGAGTATGG No data
1061755524_1061755530 5 Left 1061755524 9:132809534-132809556 CCTGGGGCAAGCGTGGGGGCCCA 0: 1
1: 0
2: 2
3: 22
4: 322
Right 1061755530 9:132809562-132809584 CTGTCCCCACCACTGGAGTATGG No data
1061755515_1061755530 27 Left 1061755515 9:132809512-132809534 CCTCCACTCAGTCAGGGCTCTTC 0: 1
1: 0
2: 0
3: 15
4: 189
Right 1061755530 9:132809562-132809584 CTGTCCCCACCACTGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061755530 Original CRISPR CTGTCCCCACCACTGGAGTA TGG Intronic
No off target data available for this crispr