ID: 1061756286

View in Genome Browser
Species Human (GRCh38)
Location 9:132814751-132814773
Sequence ACACCCATTAAATTTTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 282}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061756281_1061756286 11 Left 1061756281 9:132814717-132814739 CCCACAGCAGACTGAAGGAGAGG 0: 1
1: 0
2: 2
3: 22
4: 282
Right 1061756286 9:132814751-132814773 ACACCCATTAAATTTTAAATAGG 0: 1
1: 0
2: 0
3: 27
4: 282
1061756279_1061756286 27 Left 1061756279 9:132814701-132814723 CCTCTTTCAGCAGTTGCCCACAG 0: 1
1: 0
2: 0
3: 18
4: 165
Right 1061756286 9:132814751-132814773 ACACCCATTAAATTTTAAATAGG 0: 1
1: 0
2: 0
3: 27
4: 282
1061756283_1061756286 10 Left 1061756283 9:132814718-132814740 CCACAGCAGACTGAAGGAGAGGG 0: 1
1: 0
2: 6
3: 38
4: 278
Right 1061756286 9:132814751-132814773 ACACCCATTAAATTTTAAATAGG 0: 1
1: 0
2: 0
3: 27
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061756286 Original CRISPR ACACCCATTAAATTTTAAAT AGG Intronic
903194980 1:21679185-21679207 ACCCCCCTTAAATATAAAATTGG + Exonic
903441196 1:23389183-23389205 ACATCCAATAAATTTTGAATGGG - Intronic
904954625 1:34272681-34272703 ACACTCATTAAATATTCATTGGG + Intergenic
910587406 1:88894695-88894717 AAAATCATTAAATTTTAAACAGG - Intergenic
910895269 1:92062686-92062708 AGACCCAGTAAAATTTAAATTGG - Intronic
911832371 1:102568604-102568626 ACACCAATTAAAAATAAAATAGG - Intergenic
911966672 1:104380663-104380685 ACACCTCATCAATTTTAAATTGG + Intergenic
913553537 1:119940064-119940086 ACTTCCATTAAATTTTAGAATGG - Intronic
915080962 1:153351993-153352015 AGATCCATTAAATTTTAAGAGGG + Intergenic
916099922 1:161385932-161385954 ACAGCCATTAAATTTCAAAGTGG - Intergenic
916315274 1:163441872-163441894 ACAGTAATTCAATTTTAAATAGG - Intergenic
916316118 1:163449889-163449911 ACAAGCGTTAAATTTTAATTGGG - Intergenic
916393135 1:164354844-164354866 ACCCCTATTAAAGTTTAAAATGG + Intergenic
916439338 1:164807482-164807504 ACACCAAATAAATATAAAATGGG - Intronic
916578721 1:166089266-166089288 AGACACATTAAATCATAAATAGG - Intronic
916673763 1:167048273-167048295 ATTCCAATTAAATTTTATATTGG - Intergenic
917476815 1:175375805-175375827 ATACCCATTCAATTTTTTATTGG - Intronic
917947146 1:179986053-179986075 ACACCCATTAGGATGTAAATAGG - Intronic
918908783 1:190536985-190537007 GCATCCATTCATTTTTAAATGGG + Intergenic
919271266 1:195349722-195349744 ACACTCATTCAATTTTACAGTGG + Intergenic
919673580 1:200360014-200360036 ACATGCATTATATTTGAAATTGG + Intergenic
920005575 1:202831298-202831320 AAAACCATTAAATTTGAACTTGG + Intergenic
920124876 1:203686221-203686243 ACACCCATCAGAATTTAAACAGG + Intronic
920165114 1:204030317-204030339 CCACCTATCAAATTTTAAATGGG - Intergenic
920513468 1:206567404-206567426 TCACCCACTCAATATTAAATTGG - Intronic
921083425 1:211763764-211763786 CCAACAAATAAATTTTAAATAGG - Intronic
921443511 1:215217235-215217257 ACACCCATGCAATTGTACATGGG + Intronic
921938814 1:220818695-220818717 ACTCCCAGTAAATTCTAAAGAGG - Exonic
922779928 1:228243941-228243963 ACCCCCATAATATTTTAAAGAGG + Intronic
923582832 1:235234644-235234666 ACACACAAGCAATTTTAAATTGG + Intronic
924289283 1:242522093-242522115 ACACCCTTTCAATTAGAAATGGG - Intronic
1063169789 10:3497530-3497552 ACACCCATTCAAAATAAAATTGG + Intergenic
1063930601 10:11025005-11025027 AAACTCATTAAATTTTAAGGTGG + Intronic
1065308385 10:24390416-24390438 ACACACAATAAAAATTAAATAGG + Intronic
1067002455 10:42629636-42629658 ACACTAATTAAAATATAAATTGG - Intronic
1067254870 10:44627566-44627588 ACATCCATTGAATATTTAATTGG + Intergenic
1069472039 10:68702116-68702138 AAAACCAGTTAATTTTAAATAGG - Intergenic
1071890982 10:90006815-90006837 ACAAAAATTAAATTTTTAATAGG - Intergenic
1072100234 10:92222678-92222700 ACATTCATTAAATTTTCAAAGGG - Intronic
1073844191 10:107533792-107533814 ACACACATTATATTTTCATTAGG - Intergenic
1075496295 10:122922368-122922390 ACACCCATTCAAGTTTATTTAGG - Intergenic
1080226825 11:29971306-29971328 GTACCCATTAAACTTTAAATGGG + Intergenic
1081235320 11:40640537-40640559 AAACCCCTAATATTTTAAATAGG + Intronic
1081458541 11:43249390-43249412 AAAGCCATTAATTTTTAAAGTGG - Intergenic
1081698468 11:45136307-45136329 GCACACATTAATTTTAAAATAGG - Intronic
1082215558 11:49563060-49563082 ACTCCTATAAAATATTAAATGGG - Intergenic
1085499412 11:77005920-77005942 ATACCAATTATATTTTAAATGGG - Intronic
1085846017 11:80066025-80066047 ACTCCCAATAATTTGTAAATTGG + Intergenic
1086174902 11:83879717-83879739 ATACCCAATAAATGTTAATTGGG + Intronic
1086634018 11:89061421-89061443 ACTCCTATAAAATATTAAATGGG + Intronic
1088103493 11:106180123-106180145 ATACCAATTAAATTATTAATTGG - Intergenic
1088946078 11:114513878-114513900 AAATTCATTAAATTTTGAATCGG + Intergenic
1090620400 11:128555582-128555604 AAAACCATTAAATTTGAATTTGG - Intronic
1092840710 12:12538619-12538641 ACACCCATTAAGTGTTTAAAAGG - Intronic
1093616327 12:21230038-21230060 ACTCCCATTAAACTTGGAATAGG - Intronic
1093662862 12:21776606-21776628 GCACCATTTAAATTATAAATGGG + Intergenic
1094399770 12:30049780-30049802 AAACCCCTTAAATTTTACAGTGG + Intergenic
1095611685 12:44135880-44135902 ATACCCATTAAAATTGAACTTGG + Intronic
1096064518 12:48728916-48728938 ACAGCCATTGAATTTTTAGTAGG + Intergenic
1096922690 12:55104824-55104846 ACAACCAGACAATTTTAAATTGG + Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1099381579 12:81960168-81960190 AAACCCAAGAACTTTTAAATTGG - Intergenic
1099742550 12:86659536-86659558 AGAAACATTAAATATTAAATAGG + Intronic
1100286024 12:93167688-93167710 ACACCTATAAAATTTGATATGGG - Intergenic
1102778763 12:115544727-115544749 AGACCCATGAAATGTTAAAATGG + Intergenic
1106659776 13:31786690-31786712 AGACACATTTATTTTTAAATGGG + Intronic
1106716107 13:32390071-32390093 AAACAAATTAAATTTTAAAAAGG - Intronic
1106799861 13:33244891-33244913 TCAGCCATTAAATTTGAATTCGG + Intronic
1107318467 13:39160042-39160064 ACACTTGTTAAATTTCAAATTGG + Intergenic
1107384890 13:39897586-39897608 ACAACCATTAAATTTGCATTTGG + Intergenic
1109163288 13:59002890-59002912 ACACCGATTAAATGTAAACTTGG + Intergenic
1112611637 13:100960644-100960666 ATACTTTTTAAATTTTAAATAGG - Intergenic
1114399516 14:22396418-22396440 AGAGCCATAAAATTTTAATTTGG - Intergenic
1115313267 14:32001251-32001273 ACACCAATTAATTATTAATTTGG + Intergenic
1115442889 14:33456410-33456432 ACATGCATGAAATTTTAAAATGG + Intronic
1116361031 14:43998294-43998316 ACACACATTAAATATTTAATAGG - Intergenic
1118072998 14:62266395-62266417 ACAGTCATTTATTTTTAAATAGG + Intergenic
1123178947 14:106449210-106449232 ACACAAATTAATTTTAAAATGGG - Intergenic
1124530900 15:30505242-30505264 ACATCAATAAAATTTTAAACAGG + Intergenic
1124767757 15:32502453-32502475 ACATCAATAAAATTTTAAACAGG - Intergenic
1125471348 15:40007396-40007418 CCACCAATTAAGTTTTAAAAGGG - Intronic
1125871615 15:43107108-43107130 ATACCCATTTAATTTTGTATAGG - Intronic
1128409803 15:67383423-67383445 ACATCTTTTATATTTTAAATTGG + Intronic
1129049238 15:72764943-72764965 ATACCTATTAAACTGTAAATAGG - Intronic
1129440121 15:75575490-75575512 ACTCCAAATAAATGTTAAATTGG + Intronic
1130628627 15:85542282-85542304 ACACCCTTTAAATCCTGAATTGG + Intronic
1131829574 15:96345376-96345398 ACAGCCACTAAACTTTAAAATGG - Intergenic
1134112852 16:11526551-11526573 ATACACATTAAATGTTGAATGGG + Intergenic
1135784220 16:25333983-25334005 GCACCGATAAAATTTAAAATGGG - Intergenic
1137651073 16:50121042-50121064 ACTTCCATTATATTTTAAGTTGG + Intergenic
1138714048 16:59001580-59001602 ACACCCATTAACTTGTCATTTGG + Intergenic
1140946533 16:79773488-79773510 ACATCAAATAAAATTTAAATTGG - Intergenic
1146932534 17:36787759-36787781 TAATCCATTAAATTTTAAAAAGG + Intergenic
1149017289 17:51923138-51923160 ACAGCTATTGAGTTTTAAATGGG + Intronic
1149111964 17:53045309-53045331 ACACCCATTCTATTTTAGCTTGG - Intergenic
1155825429 18:30436555-30436577 AAATTCATGAAATTTTAAATGGG + Intergenic
1156412762 18:36850025-36850047 ACCCCAATTTTATTTTAAATGGG - Intronic
1156875782 18:42009365-42009387 ACACCAAATAATTTTTAAAAAGG - Intronic
1157623903 18:49032396-49032418 TCACCCACTAAATTCTAGATGGG - Intergenic
1158056295 18:53285040-53285062 AAAGGCATTAAATTTTACATGGG + Intronic
1158869356 18:61669675-61669697 ACACTCATCAAATTTTAACTGGG - Intergenic
1159367916 18:67493383-67493405 TCACCCATTAATTATTGAATTGG + Intergenic
1159378326 18:67623671-67623693 GAACCTATTAAATTTTAATTTGG - Intergenic
1160146333 18:76368021-76368043 ACATTCATTAATATTTAAATCGG - Intronic
1161178436 19:2862892-2862914 ACACCCACTGAAATTTAGATTGG - Intergenic
1165464573 19:35966013-35966035 AGACCCAGTTTATTTTAAATTGG + Intergenic
925220175 2:2132875-2132897 ACACCCAATAAATTTCCAACAGG - Intronic
925529772 2:4846233-4846255 AGACCCATTGAATTAAAAATTGG + Intergenic
925734986 2:6956105-6956127 ACCCCCAATAAGCTTTAAATGGG - Intronic
926487237 2:13477273-13477295 ACACCTCCTTAATTTTAAATTGG + Intergenic
926640264 2:15228593-15228615 TCACCCATTAATCTTTAGATGGG - Intronic
926646745 2:15297898-15297920 ACACCCATTAGGTTTTCAACTGG + Intronic
927230237 2:20815972-20815994 ACAAATATTAAATTTTAAAAAGG + Intronic
927334830 2:21909339-21909361 TCCCCCATAAATTTTTAAATAGG + Intergenic
928162150 2:28938534-28938556 ACATCCATTATATTTTAAGCTGG + Intronic
930464331 2:51727036-51727058 CTACCCATTATATTTTAAATGGG + Intergenic
930487847 2:52030697-52030719 ATACCCATTAAATTAAAAACAGG + Intergenic
931051549 2:58420428-58420450 ACACACAAAAAATTTTAGATAGG + Intergenic
931063595 2:58558968-58558990 TAACTCTTTAAATTTTAAATAGG - Intergenic
931875766 2:66510114-66510136 ACAGCATTTAAATTTTCAATGGG - Intronic
932640883 2:73444993-73445015 ACACCAGTGATATTTTAAATGGG - Intronic
933215079 2:79620578-79620600 ATACCCACTAAATAGTAAATAGG + Intronic
933457599 2:82536385-82536407 ATACCAAATAAATTTTAAAAAGG - Intergenic
936981682 2:118270585-118270607 ACAGTCGTTAAATTTTAATTAGG + Intergenic
937693747 2:124784911-124784933 AAACTCATTAAATTGTCAATGGG - Intronic
939026249 2:137016992-137017014 ACTCCCATTATGTTGTAAATAGG + Intronic
939326701 2:140700221-140700243 ACAGTAATTCAATTTTAAATAGG - Intronic
939425951 2:142036666-142036688 ATAACAATTAAATTTAAAATTGG + Intronic
939519532 2:143212396-143212418 CCAGCCATTTAATGTTAAATAGG + Intronic
940089894 2:149903278-149903300 ACAATGATCAAATTTTAAATTGG - Intergenic
940273993 2:151920090-151920112 ACACCTAATAATTTCTAAATTGG - Intronic
940678570 2:156755062-156755084 ACAGCAAATAAACTTTAAATAGG + Intergenic
942346428 2:175007187-175007209 AGAACCATTGAATTTTGAATAGG + Intergenic
943008261 2:182413354-182413376 AATATCATTAAATTTTAAATGGG + Intronic
945713210 2:213326578-213326600 TAACCCACTAAATTTTATATTGG - Intronic
1168891644 20:1298889-1298911 ACACGTGTTAAATTTTATATCGG + Intronic
1169917164 20:10695082-10695104 GCACCTAATATATTTTAAATTGG - Intergenic
1173121209 20:40291191-40291213 ATATCCATTAAATAGTAAATGGG - Intergenic
1173238283 20:41268419-41268441 AAACATATTAAAATTTAAATTGG - Intronic
1177526255 21:22294691-22294713 ACACAAGTTAAATTTTATATAGG - Intergenic
1177582591 21:23045844-23045866 ATCCCCATTCGATTTTAAATGGG + Intergenic
1177608315 21:23411324-23411346 AAACACATTATCTTTTAAATTGG - Intergenic
1177619100 21:23563239-23563261 ACACCCATTAAAACATAACTTGG - Intergenic
1178781565 21:35607967-35607989 AGATACATTATATTTTAAATAGG - Intronic
1182006359 22:26963098-26963120 ATATACAATAAATTTTAAATAGG - Intergenic
949793027 3:7814343-7814365 ACATCCATTATCTTTAAAATGGG - Intergenic
949982953 3:9514323-9514345 AATCCCATCAATTTTTAAATAGG + Intronic
951020009 3:17773081-17773103 ACACCCATTAAATTGAATAATGG + Intronic
951870809 3:27360078-27360100 ATACCCATTACAGTTTAAAAAGG + Intronic
952097914 3:29977185-29977207 GTACCATTTAAATTTTAAATTGG - Intronic
952208576 3:31205329-31205351 AATCCCATTAAATGTTGAATAGG + Intergenic
952242622 3:31548431-31548453 ACATTTATTAAATTTTAAATGGG - Intronic
952263517 3:31763625-31763647 ACAGCAATTAAGTTTTAAAAGGG - Intronic
954469438 3:50679410-50679432 ATACGCATTACTTTTTAAATAGG - Intronic
954724738 3:52598129-52598151 AAAACCATTGAACTTTAAATAGG - Intronic
955782396 3:62499047-62499069 ACACCCATTTTCTTTTAACTGGG - Intronic
957199999 3:77121429-77121451 ATACCTATTACATTTTTAATTGG + Intronic
958160900 3:89815818-89815840 AAACACATTCAATTTTAAAATGG - Intergenic
958774108 3:98460736-98460758 ACACTCATTACATTTTAAAAAGG - Intergenic
959120312 3:102224475-102224497 ACAAACATTTAATTTTATATAGG + Intronic
959936528 3:112035133-112035155 GCACTGATTAAATTTTAAAATGG - Intronic
960200629 3:114831133-114831155 AAACCCATTATATTTTAAAAAGG - Intronic
960301044 3:116002838-116002860 ACAACCATTAGGGTTTAAATAGG + Intronic
960682144 3:120260461-120260483 AAACCCTTTAATCTTTAAATTGG + Intronic
961120952 3:124369281-124369303 ACACCAAAGAAATTTTAAAAGGG - Intronic
961126781 3:124425896-124425918 CCACTCATGAAATTATAAATGGG - Intronic
963656415 3:148057048-148057070 AAAACCATAAAAGTTTAAATGGG + Intergenic
964573128 3:158133168-158133190 ACAGTTATTGAATTTTAAATTGG + Intronic
965645038 3:170871093-170871115 ACATTCATTGAATTTTAACTGGG - Intergenic
966591634 3:181690354-181690376 ACAGTCCCTAAATTTTAAATTGG + Intergenic
967103070 3:186232799-186232821 ACATCTATTTAATATTAAATAGG - Intronic
968349297 3:198039448-198039470 GCTGCCATTAAATTTAAAATAGG - Intronic
974007721 4:56575318-56575340 ACACCCATCAAGTTTTCAACTGG - Intronic
974215016 4:58833663-58833685 ACACCAAATACAATTTAAATAGG - Intergenic
975037796 4:69705973-69705995 ACAACTATAGAATTTTAAATGGG - Intergenic
975056640 4:69941110-69941132 AAACATATTAAATTTTAAATTGG + Intronic
975223919 4:71847114-71847136 AGACCCATTGAATATTCAATGGG - Intergenic
975441587 4:74417438-74417460 TGACCTATTAAATTATAAATGGG - Intergenic
976843602 4:89461128-89461150 ACACACATTTACTTTTAAAAAGG + Intergenic
977478949 4:97549295-97549317 ACACTCATTTAGTTTTAACTAGG - Intronic
977743979 4:100523198-100523220 ACACCCAATAATTTTTTAATAGG - Intronic
977747589 4:100568584-100568606 ACACAAAATATATTTTAAATGGG + Intronic
977802343 4:101250769-101250791 CCAACTATTAAATTTTTAATAGG + Intronic
978474173 4:109107066-109107088 GCACTTATTAAATTTTAAATGGG - Intronic
978508631 4:109490025-109490047 ACACCCATTAAATAAGTAATAGG - Intronic
978679760 4:111365930-111365952 ACCCTCTTTATATTTTAAATTGG - Intergenic
978883704 4:113740927-113740949 ACAATTAATAAATTTTAAATTGG + Intronic
980661835 4:135870803-135870825 ATACACATGAAATTTTAAAGTGG - Intergenic
980860550 4:138494795-138494817 ACTCACATTAAAGTTTAAGTTGG - Intergenic
981183869 4:141778652-141778674 ACGCCTATTAAAATTTAAAATGG + Intergenic
982346148 4:154362364-154362386 ACTCCCATGAAATTTTTAAGAGG + Intronic
983373576 4:166896491-166896513 ACACTCATTACATTTGAAACAGG + Intronic
983544352 4:168947201-168947223 AAACTTATTAAATTTTAAAACGG - Intronic
983758731 4:171377596-171377618 ACACCCATCCAATTTTGTATAGG + Intergenic
984380303 4:178984605-178984627 CCTGCCATTAAATTTTAACTAGG - Intergenic
984987029 4:185341277-185341299 ATTCTCATTAAATTTTACATTGG - Intronic
986620171 5:9664592-9664614 CCACCCATTAAAATGCAAATTGG + Intronic
987209259 5:15662327-15662349 AAACCCTTTAAATTTAAAATTGG - Intronic
988192207 5:27953064-27953086 TCAACAATTAATTTTTAAATGGG - Intergenic
988318859 5:29666929-29666951 ACACAGATAAATTTTTAAATGGG + Intergenic
988846260 5:35131182-35131204 AATACTATTAAATTTTAAATTGG - Intronic
990098188 5:52146150-52146172 ACACCTATGAAATATTCAATAGG + Intergenic
990179780 5:53147735-53147757 ACACCCACTAAATTATTGATAGG + Intergenic
990212974 5:53500365-53500387 ACTCCCATAAAATTTTGATTTGG - Intergenic
990221396 5:53593530-53593552 ACATCAATGAAATTGTAAATAGG - Intronic
990927780 5:61048363-61048385 ACTCACATTAAACTTTAAAAAGG + Intronic
993345911 5:86782411-86782433 AGACTCATTAAATGTTAAATGGG + Intergenic
993435814 5:87892343-87892365 ACAACAATTAAAAATTAAATAGG + Intergenic
993770161 5:91916674-91916696 ACTCCCATTACCTTTTAAAGGGG - Intergenic
994551937 5:101245529-101245551 TCACCCACTAGATTTTAAGTAGG + Intergenic
996125003 5:119715055-119715077 ACATCCTTTAAATATTACATGGG - Intergenic
996485763 5:124032101-124032123 TAACCCATTAAATTAAAAATTGG - Intergenic
996929173 5:128865698-128865720 ACACAAATAAAATTGTAAATTGG - Intronic
997288999 5:132710691-132710713 ACACACAGGAAATTTTAAAATGG + Intronic
998653931 5:144153772-144153794 ACACTCAGGAAATTTAAAATGGG + Intergenic
998822094 5:146066469-146066491 ACACCTAATAAATTTTAGACTGG + Intronic
999782516 5:154861073-154861095 ATACCCATATAATGTTAAATCGG - Intronic
1000941970 5:167372594-167372616 ACACCCACTCCATTTTAAATGGG + Intronic
1001184765 5:169559156-169559178 ACACCCACTAAAGTTAAAAAGGG - Intergenic
1002672181 5:180876633-180876655 ACATTCAGTAAATTTTAAAGGGG + Intergenic
1003021387 6:2512844-2512866 AGAGACATTAAATTTAAAATCGG - Intergenic
1003757001 6:9133029-9133051 AGTCCCATTAAATTTTCAAATGG + Intergenic
1004903040 6:20211470-20211492 ACAACCATTAAAATTAAAAATGG - Intronic
1004946950 6:20625962-20625984 CCAGCCATTAAATTCTAACTAGG + Intronic
1007869975 6:45023968-45023990 ACAGGCATTAAACTTAAAATTGG + Intronic
1008835881 6:55828841-55828863 ACCCACTTTTAATTTTAAATTGG + Intronic
1009982479 6:70742260-70742282 AAAACCATTCAATTTTAAAGGGG - Intronic
1010532538 6:76986316-76986338 ATATCCATTAATTTTTAAATTGG - Intergenic
1010694884 6:78959764-78959786 AGATACATTATATTTTAAATAGG - Intronic
1011136286 6:84104510-84104532 ACAGGCATTCAATTTTAAAAGGG - Intergenic
1011757755 6:90521793-90521815 ATACCCATTATATTATAAATAGG + Intronic
1012543251 6:100387611-100387633 ACATTCAGTAAATTTTAAAATGG + Exonic
1013620663 6:111885426-111885448 ACACCAATAAAAATTTAACTGGG + Intergenic
1014056558 6:117023010-117023032 ACAGCCATTGAATTTTCAAATGG + Intergenic
1014081325 6:117289483-117289505 AGATCCATTAAATTTTTATTGGG - Intronic
1014716453 6:124869931-124869953 ACATCTATTAATTTTTAAAAAGG + Intergenic
1015028385 6:128565122-128565144 ACACCCCTTTAATTTTTAGTTGG + Intergenic
1015086657 6:129302043-129302065 ACACCCATTAAATGGTAAACAGG - Intronic
1015132063 6:129823149-129823171 AAACCCATAAAATTTTAGATGGG + Intergenic
1016443326 6:144107348-144107370 ACATCCATTTTATATTAAATGGG + Intergenic
1016706453 6:147114255-147114277 AGAACCATGAAATGTTAAATTGG - Intergenic
1017714356 6:157198163-157198185 ACACCTATTACATCTTAAAATGG - Intronic
1017827997 6:158096667-158096689 TCACCCATTGAATTTTTAAATGG + Exonic
1020994319 7:15243609-15243631 ATACCAATTAAGATTTAAATTGG + Intronic
1021372266 7:19863371-19863393 CCAACCAATAAATTTTAAGTTGG - Intergenic
1021918357 7:25457676-25457698 ACACCATTGATATTTTAAATAGG - Intergenic
1022898569 7:34778034-34778056 ACACCCATTATTTTGCAAATTGG - Intronic
1028011010 7:85644060-85644082 AAACTCACTAAATTTTAAATGGG - Intergenic
1028050685 7:86181240-86181262 ATAACCATTAAATTTAAGATGGG + Intergenic
1030805157 7:113908615-113908637 AGACCCACTGAAATTTAAATTGG - Intronic
1033684593 7:143626778-143626800 ACACCCATGCAATAATAAATTGG + Intronic
1033687769 7:143705997-143706019 ACACCCATGCAATAATAAATTGG + Intronic
1033700018 7:143830845-143830867 ACACCCATGCAATAATAAATTGG - Intergenic
1033727509 7:144134561-144134583 ACAACCATTAAACTTGAAAGAGG + Intergenic
1033825081 7:145179370-145179392 ACACCCAGTCAATTTAAAGTGGG - Intergenic
1036222924 8:6935785-6935807 ACACATATCAAATTTTAAAGAGG + Intergenic
1038153218 8:24960837-24960859 ACACCCATTTTATTTTACATTGG - Intergenic
1039122372 8:34161444-34161466 ACACATATAAAATTTTACATAGG - Intergenic
1040535536 8:48306000-48306022 ACAGCGATAGAATTTTAAATGGG - Intergenic
1042678766 8:71355388-71355410 AGACCCATTAAATTACAACTGGG - Intronic
1042678917 8:71357165-71357187 GAACCCATTGAATTTTAAATTGG - Intronic
1043622572 8:82213711-82213733 ACACCCATTTATTTTCAAAAAGG + Intergenic
1043630579 8:82326469-82326491 ACACCCTTTAAAAATGAAATAGG + Intergenic
1043649495 8:82573195-82573217 TTACCCATTAAATTGAAAATTGG + Intergenic
1043680867 8:83022879-83022901 AAAGCCATTCAATTTTAAAAGGG - Intergenic
1043813444 8:84771296-84771318 ATACCCATTGTATTTTTAATAGG - Intronic
1044657398 8:94562965-94562987 AAACCTATTAATTTTTAAAAAGG + Intergenic
1044765984 8:95574569-95574591 ATACTCATTAAATTTACAATTGG + Intergenic
1045258881 8:100554132-100554154 ACACCAATTTGATTTTAAAATGG - Intronic
1046358568 8:113119802-113119824 ACACACATTAAATTTTTGATTGG + Intronic
1046453779 8:114431675-114431697 ACACCCATGATATTTCAACTGGG + Intergenic
1046557137 8:115789319-115789341 TCACCTAGAAAATTTTAAATTGG - Intronic
1046623335 8:116551068-116551090 ACACACATTTATTTTTAAAAAGG - Intergenic
1047729894 8:127718822-127718844 ACACACTTCAAATTTTAAAAAGG + Intergenic
1047757427 8:127929351-127929373 ACACCCAATCATTTTTAATTGGG - Intergenic
1048695433 8:137022645-137022667 ACAGCAATTAAATTTTTCATAGG + Intergenic
1050846742 9:10230643-10230665 ACAACCACAAAATTTTAATTTGG - Intronic
1051161269 9:14210835-14210857 ACACAAATGAAATTTGAAATGGG - Intronic
1052828591 9:33196237-33196259 AAGCCCATTAAATTTTTATTTGG - Intergenic
1053565120 9:39241541-39241563 CCACCAATTAAAGTTTACATAGG - Intronic
1053830894 9:42079379-42079401 CCACCAATTAAAGTTTACATAGG - Intronic
1054132031 9:61377497-61377519 CCACCAATTAAAGTTTACATAGG + Intergenic
1054599662 9:67108058-67108080 CCACCAATTAAAGTTTACATAGG + Intergenic
1055775267 9:79760978-79761000 ACACCCAAAAAACTCTAAATGGG - Intergenic
1056493832 9:87136184-87136206 ACAACCTCTAAATTGTAAATTGG + Intergenic
1057065935 9:92051438-92051460 ACACTCAATAAATTAAAAATGGG + Intronic
1057562948 9:96142317-96142339 ATACCTATTAAAATTTAAAAAGG - Intergenic
1058364881 9:104197367-104197389 AAACCCCTTTAATTTTAATTCGG - Intergenic
1058738621 9:107920461-107920483 ACACCCATGGAAGTTTAAAAAGG + Intergenic
1059046797 9:110877927-110877949 ACACCTTTTAAATTTTAACATGG - Intronic
1059491468 9:114671248-114671270 ACACCCACCTCATTTTAAATTGG + Intergenic
1061756286 9:132814751-132814773 ACACCCATTAAATTTTAAATAGG + Intronic
1186345348 X:8686284-8686306 ACATCCATAAAATAATAAATCGG - Intronic
1186564355 X:10646213-10646235 ACACCCATCAACATTTAAAGCGG - Intronic
1188120058 X:26294035-26294057 AGACAGATTAAATTTAAAATTGG + Intergenic
1188818561 X:34745260-34745282 ACACCCATTAAAATGTTATTAGG + Intergenic
1189530607 X:41877956-41877978 ACCACAATTAAATTTTTAATGGG + Intronic
1190382275 X:49851512-49851534 AAAACTATGAAATTTTAAATTGG - Intergenic
1190848177 X:54213648-54213670 AAATCCATAAAATTTAAAATGGG + Intronic
1192570900 X:72203538-72203560 ACACCAGTTCAATTTTGAATTGG + Intronic
1193206224 X:78751047-78751069 AGACCCAATAAATTTTAAAATGG - Intronic
1193547649 X:82849578-82849600 ACACAAGTTAATTTTTAAATTGG + Intergenic
1193942037 X:87688228-87688250 ATATCCAATAAAATTTAAATTGG - Intergenic
1194134272 X:90120614-90120636 ACAGCCATTAAATTTCAACATGG - Intergenic
1195145416 X:102010054-102010076 AAATCAATTAAATTATAAATAGG - Intergenic
1196553140 X:117054223-117054245 AAACCCCTTAATTTTTAAAGAGG - Intergenic
1198247536 X:134844687-134844709 ACAACTATTACATATTAAATGGG - Intronic
1199087495 X:143644886-143644908 CCACTCACTAAATTTTATATTGG - Intergenic
1199558396 X:149134900-149134922 ACACACACAAAATTTTAAAATGG - Intergenic
1200480055 Y:3690726-3690748 ACAGCCATTAAATTTCAACATGG - Intergenic