ID: 1061759866

View in Genome Browser
Species Human (GRCh38)
Location 9:132843162-132843184
Sequence CCATTGCTAGAGGTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061759856_1061759866 9 Left 1061759856 9:132843130-132843152 CCCCACCCAAATCTCACATTAAA 0: 3
1: 119
2: 2293
3: 13626
4: 13432
Right 1061759866 9:132843162-132843184 CCATTGCTAGAGGTGGAGCCTGG No data
1061759858_1061759866 7 Left 1061759858 9:132843132-132843154 CCACCCAAATCTCACATTAAAAT 0: 2
1: 16
2: 282
3: 3306
4: 16982
Right 1061759866 9:132843162-132843184 CCATTGCTAGAGGTGGAGCCTGG No data
1061759859_1061759866 4 Left 1061759859 9:132843135-132843157 CCCAAATCTCACATTAAAATGTA 0: 2
1: 24
2: 320
3: 3165
4: 15220
Right 1061759866 9:132843162-132843184 CCATTGCTAGAGGTGGAGCCTGG No data
1061759857_1061759866 8 Left 1061759857 9:132843131-132843153 CCCACCCAAATCTCACATTAAAA 0: 1
1: 11
2: 241
3: 3074
4: 15755
Right 1061759866 9:132843162-132843184 CCATTGCTAGAGGTGGAGCCTGG No data
1061759860_1061759866 3 Left 1061759860 9:132843136-132843158 CCAAATCTCACATTAAAATGTAA 0: 4
1: 37
2: 375
3: 3149
4: 11183
Right 1061759866 9:132843162-132843184 CCATTGCTAGAGGTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061759866 Original CRISPR CCATTGCTAGAGGTGGAGCC TGG Intronic
No off target data available for this crispr