ID: 1061760051

View in Genome Browser
Species Human (GRCh38)
Location 9:132844586-132844608
Sequence GACAGGATTTCAAGAGTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061760051_1061760058 20 Left 1061760051 9:132844586-132844608 CCTCTTACTCTTGAAATCCTGTC 0: 1
1: 0
2: 3
3: 22
4: 194
Right 1061760058 9:132844629-132844651 AGGCAATGGATGCCCCTTAAAGG No data
1061760051_1061760057 6 Left 1061760051 9:132844586-132844608 CCTCTTACTCTTGAAATCCTGTC 0: 1
1: 0
2: 3
3: 22
4: 194
Right 1061760057 9:132844615-132844637 GGGAAGAGATGAAAAGGCAATGG No data
1061760051_1061760055 0 Left 1061760051 9:132844586-132844608 CCTCTTACTCTTGAAATCCTGTC 0: 1
1: 0
2: 3
3: 22
4: 194
Right 1061760055 9:132844609-132844631 TCCAGCGGGAAGAGATGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061760051 Original CRISPR GACAGGATTTCAAGAGTAAG AGG (reversed) Intronic
901535383 1:9879415-9879437 GACATGTTTTCCAGAGAAAGCGG + Intronic
906380371 1:45328592-45328614 GACAGGATTTGAGGAGTGGGTGG - Intergenic
907615483 1:55920623-55920645 GACAGGATTAGATGTGTAAGAGG + Intergenic
908946131 1:69499663-69499685 GACTGCATCTCAAGAGAAAGAGG + Intergenic
909115531 1:71530465-71530487 GCAAGGATTTAAAGAGTATGTGG - Intronic
910787584 1:91017496-91017518 CAGAGGATTTCAAGAGTAAGAGG - Intronic
914225489 1:145716562-145716584 GGCAGGATTTCAAAAGGCAGGGG - Intergenic
916393597 1:164360503-164360525 AACAGGAATTCAAGAGGAAAAGG - Intergenic
916521442 1:165567136-165567158 GGCAGAATTTCATGAGTAACTGG + Intergenic
916955515 1:169829334-169829356 TACAGGGATTAAAGAGTAAGGGG + Exonic
917210409 1:172626103-172626125 GACAGCATTCCTAGAGTTAGTGG - Intergenic
917780628 1:178392405-178392427 GACAGGAATTGAAAAGTATGTGG + Intronic
918016343 1:180636748-180636770 GACAGTATTAGAAAAGTAAGGGG + Intronic
921423553 1:214976537-214976559 GAGAGGCTTTCAAAAGGAAGGGG - Intergenic
923225252 1:231933318-231933340 GACAGCCTTTCAATTGTAAGAGG + Intronic
923742994 1:236672925-236672947 GACAGGCTTTGCAGAGGAAGTGG - Intergenic
923925704 1:238624897-238624919 GAGAGGCTTTCAAGAGCAAGAGG - Intergenic
1066240809 10:33533147-33533169 GACATGACTTAAAGAGTGAGGGG + Intergenic
1066614856 10:37284012-37284034 GACAGAATAGCAAGAGAAAGGGG + Intronic
1070479904 10:76871751-76871773 GGTAGGATTTCTAGAGAAAGGGG - Intronic
1072001492 10:91199840-91199862 GACAAGAATTTGAGAGTAAGTGG + Intronic
1074100990 10:110354847-110354869 GACAGGATTTCAGGAATGAGTGG + Intergenic
1075466580 10:122655876-122655898 GACAGGGTATCTGGAGTAAGAGG + Intergenic
1075468646 10:122671331-122671353 GACAGGGTATCTGGAGTAAGAGG + Intergenic
1076187171 10:128459041-128459063 TCCAGGATATCAAGAGGAAGAGG - Intergenic
1078048733 11:7943168-7943190 GACAGGATTTCAAATGTTTGTGG + Intergenic
1078333067 11:10441952-10441974 GTCAGGAATTCATGAGGAAGGGG + Intronic
1078512421 11:11995293-11995315 GACAGGAGTTCAAGACCAACCGG - Intronic
1079063388 11:17269317-17269339 GACAGGATTTCCAAGGTAACAGG + Intronic
1079978198 11:27119271-27119293 GGAAGGATTTCAAGGGGAAGAGG - Intronic
1081260860 11:40958806-40958828 TACAGGATTACAACAGGAAGAGG + Intronic
1084675576 11:70631995-70632017 GAAAGCATTTCAAAAATAAGGGG - Intronic
1084796220 11:71506162-71506184 GACTGGATGTCAACAGTAACAGG - Intronic
1085718630 11:78894576-78894598 TAAAGGATTTCTAGAGTAAGAGG + Intronic
1087128374 11:94647915-94647937 GCCACGATTTGAAGAGTAATGGG + Intergenic
1087850808 11:103027345-103027367 GACAGAATTTCATGAATAATTGG + Intergenic
1088404068 11:109452389-109452411 GACAGGATTGCTTGAGTCAGGGG + Intergenic
1088528946 11:110787092-110787114 GGCAGGATTTCTAAAGGAAGAGG - Intergenic
1088672063 11:112151789-112151811 GAGAGCATTTCAAGATTGAGGGG - Intronic
1090936771 11:131350054-131350076 GACAGAATTTCAGGTGTAAGAGG - Intergenic
1091559432 12:1600076-1600098 AACCCGATTTCAAGAGTAAAAGG - Intronic
1094031245 12:26013450-26013472 CACAGGATTTAAAGAATCAGCGG - Intronic
1094347949 12:29491642-29491664 GACTGTAATTCAAGAGAAAGTGG + Intronic
1094348075 12:29493457-29493479 GACTGTAATTCAAGAGAAAGTGG - Intronic
1098007614 12:66015217-66015239 GCCAGCATGTCAAGAGTAACAGG + Intergenic
1098465181 12:70779056-70779078 GTCAGGAGTTCAAGACCAAGTGG - Intronic
1108449144 13:50542860-50542882 GACAAGAGTTCAAGAGGAAATGG - Intronic
1108593662 13:51932539-51932561 GATAGGATTTTAACAGTAGGGGG - Intergenic
1108848333 13:54700907-54700929 GACAGAATGTCAAGCGAAAGGGG - Intergenic
1110467528 13:75818789-75818811 GACAGGATTGCATGAGACAGTGG - Intronic
1111021520 13:82458135-82458157 GACAGAATAGCAAGAGAAAGTGG - Intergenic
1113048894 13:106186715-106186737 GACAGGACTTCATGACTAACTGG + Intergenic
1113677476 13:112216397-112216419 GACAGGATTCCAGGTGGAAGAGG + Intergenic
1113895591 13:113762168-113762190 GTCAGATTTTCAAGAGAAAGGGG - Intronic
1114349938 14:21838562-21838584 AACAGGATTTCCAGAGTGAGAGG + Intergenic
1114514224 14:23286878-23286900 GACTTGATTTCAAGAGTTCGAGG + Intronic
1117472710 14:56062587-56062609 TGCAGGATTGCAAGAGCAAGAGG + Intergenic
1118966700 14:70593956-70593978 GACAAGATTTCCATAGTGAGAGG - Intronic
1119059302 14:71458882-71458904 GACGGGGTTTCAGGAGTTAGAGG - Intronic
1119070322 14:71576745-71576767 GCCTGGAATTCAAGAGTAACTGG - Intronic
1120812473 14:88818364-88818386 GACAGAATTTCAAAAAGAAGAGG - Intergenic
1121478973 14:94244781-94244803 GACACGATTCCAAGAAGAAGGGG - Intronic
1124252437 15:28115739-28115761 GAAAGGATGTGAAGAGTTAGAGG - Intronic
1125521106 15:40348316-40348338 GACAGGTTTTCCACAGTATGAGG - Intergenic
1125903258 15:43368826-43368848 AAAGGGATTTCAGGAGTAAGTGG - Intronic
1126332974 15:47553857-47553879 TATAGGATTTCAAGAATAAGGGG + Intronic
1129188922 15:73926599-73926621 GACAGCATTTCAAGGCCAAGGGG - Exonic
1129546404 15:76400238-76400260 GACAGGAATGAAAGAGGAAGAGG - Intronic
1129780968 15:78270845-78270867 GCCAGGATTTCAAGACCAACCGG + Intronic
1132173007 15:99682706-99682728 AACCAAATTTCAAGAGTAAGAGG - Intronic
1132923061 16:2409986-2410008 GACAAGACTCCAAGAGTAACTGG + Intergenic
1133356852 16:5143097-5143119 GACAGGATTCCAAGAGTCCTGGG - Intergenic
1134563757 16:15232996-15233018 GCCAGGATTTCAAGACTAGCCGG + Intergenic
1134738736 16:16523697-16523719 GCCAGGATTTCAAGACTAGCCGG - Intergenic
1134928763 16:18188456-18188478 GCCAGGATTTCAAGACTAGCCGG + Intergenic
1138196417 16:55055468-55055490 GACAGGAAGTAAAGAGGAAGGGG - Intergenic
1138629733 16:58283860-58283882 GGCAGGATTTTTAGAGCAAGGGG - Intronic
1140876409 16:79156701-79156723 CACAGGATTTCAAATTTAAGAGG + Intronic
1145246397 17:21272673-21272695 AACAGGATTTCAAGGGTGAGTGG - Intergenic
1146229198 17:31093939-31093961 GAAAGGATTTCATGTGTAATTGG - Intergenic
1150639137 17:66937900-66937922 AACTGGACTTCAAGAGGAAGGGG - Intergenic
1151629684 17:75301989-75302011 GACATGATTGCAAGAGAAAGGGG + Intergenic
1152396143 17:80035124-80035146 CACAGGATTTCAGGATTCAGCGG + Intronic
1153763597 18:8354431-8354453 GACAGCATTTCAACAGGAAGGGG + Intronic
1156369823 18:36462835-36462857 GCCAGGAGTTCAAGATTAATCGG - Intronic
1159036122 18:63278488-63278510 GATAAGATATCAAGAGTTAGGGG - Intronic
1160814137 19:1027619-1027641 GACAGGATTCCCAGGGAAAGTGG + Intronic
1162837276 19:13328929-13328951 GAAAGGATGGCAAGAGAAAGAGG - Intronic
925171634 2:1753723-1753745 GGAAGGAATTCAAGAGTGAGAGG - Intergenic
926874169 2:17456846-17456868 GACAGGGTTTTGAGAGTAACTGG + Intergenic
926995981 2:18736384-18736406 GACAGGGTTTTAAGAGCAACTGG - Intergenic
928281643 2:29951687-29951709 TACAGGATTGGAAGAGTATGAGG - Intergenic
928613151 2:33010277-33010299 GAAGGGAGTTCAAGAGGAAGTGG + Intronic
932285161 2:70525492-70525514 TACAGGTTTTCAAGAGTTAAGGG + Intronic
935736656 2:106111800-106111822 CACAGGATTTTCAGAGTAACAGG + Intronic
937635822 2:124154287-124154309 GACAGGAATTCAAGTGCAAGGGG + Intronic
939901343 2:147853860-147853882 GGCATTATTTCAAGAGGAAGGGG + Intronic
940221114 2:151352793-151352815 GACATGTTTTCAAGACTTAGAGG + Intergenic
944119263 2:196223562-196223584 GACAGAATTTCTAGAGAATGAGG + Intronic
944656160 2:201878472-201878494 GAAAGGATTTCTTGAGGAAGTGG - Intronic
944767855 2:202882900-202882922 AACAGAATTTTAAGATTAAGTGG - Intronic
945774352 2:214085954-214085976 GACAGGCTTTCAAAAGGCAGAGG - Intronic
946234854 2:218317759-218317781 GACAGGAGTTCATGAGAAAATGG + Intronic
1169853621 20:10079421-10079443 GACAAGAATTCAAGTGTAAGTGG - Intergenic
1170118369 20:12885723-12885745 GATAGGATTTCAAGCATCAGGGG - Intergenic
1171379684 20:24724964-24724986 GACAGGATTTCTAGGTTAACTGG - Intergenic
1172588754 20:36103005-36103027 GACAGGATTTCAACAGTGATTGG - Intronic
1173795635 20:45857632-45857654 GACCGGGTTACAAGAGGAAGGGG - Exonic
1174712997 20:52727196-52727218 ATCAGCATTTCAAGAGAAAGGGG - Intergenic
1177382347 21:20361269-20361291 GACATGAGTTCAAGAGTAAAAGG + Intergenic
1180130266 21:45822571-45822593 GACAGGATTAGGAGAGCAAGGGG + Intronic
1182063440 22:27414137-27414159 GGAAGGATTTAAAGAGTCAGAGG + Intergenic
1182518822 22:30873712-30873734 CACAGCATTTCACGAGGAAGAGG - Intronic
949304595 3:2625726-2625748 GAGAGGATATCAATAGTAAGTGG - Intronic
949485081 3:4530474-4530496 GAAAGCTTTTCAAGAGTAACAGG - Intronic
950612078 3:14133245-14133267 GACAGGCTTTCCAGAGGCAGCGG + Intronic
950759689 3:15210207-15210229 GCCAGGAGTTCAAGACTAACTGG - Intronic
951144460 3:19210593-19210615 AACAGAATTTCAGGAGTAAAAGG - Intronic
951370830 3:21845560-21845582 GAGAGGTTTTCTAGATTAAGTGG - Intronic
960611981 3:119562965-119562987 GACAGCATTTTAAGAGGAAGAGG - Intergenic
966980739 3:185132698-185132720 GACAGTATTTGAAGAGCAGGTGG + Intronic
969414009 4:7047114-7047136 CGCAGGATTCCAAGAGTTAGAGG + Intronic
970213759 4:13737532-13737554 GAGAGGATATCAAGAGGAAGAGG + Intergenic
970370698 4:15403285-15403307 TACAGCATTACTAGAGTAAGAGG - Intronic
970928818 4:21484698-21484720 GACAGACTTTCTAGAGAAAGTGG - Intronic
971314918 4:25559859-25559881 TCCAGAATTTCAAGATTAAGTGG + Intergenic
971316703 4:25573670-25573692 GACAGAACTTCAAGAGCAAGAGG + Intergenic
971593993 4:28504559-28504581 GACAGTATTTTAAGACTAAATGG - Intergenic
974483769 4:62479531-62479553 TACAAGATTTCAGGAGTTAGAGG + Intergenic
975586040 4:75950250-75950272 GACAATGTTACAAGAGTAAGAGG - Exonic
976057764 4:81088586-81088608 GATAGGATTTCAGAAGTAAAAGG - Exonic
976856903 4:89614643-89614665 GAGAGGATTTGAAGGGTCAGTGG + Intergenic
977816561 4:101419988-101420010 GAAGAGAATTCAAGAGTAAGTGG - Intronic
983696178 4:170534642-170534664 GACATGATTTAAATAGTAATGGG + Intergenic
984595013 4:181656810-181656832 GTAAGGATTTCAAGAGGAAAGGG + Intergenic
985209360 4:187575613-187575635 GGCAGTATTTGAAGAGTGAGTGG + Intergenic
985993464 5:3582977-3582999 GACAGGATTTAATGTGTCAGAGG - Intergenic
987544244 5:19291722-19291744 GGCAGAATTTCAAGAGACAGAGG - Intergenic
988857639 5:35244833-35244855 GCCAGGATTTCAAGTGTAAGTGG + Intergenic
989298001 5:39852141-39852163 GACAGGCTTTCATAAGTAAAAGG - Intergenic
989461112 5:41699191-41699213 TACAGGGATTGAAGAGTAAGAGG - Intergenic
991725120 5:69528204-69528226 TACAGGTTCTCAACAGTAAGTGG - Intronic
991728200 5:69558439-69558461 GACAGGATTTTAAAAGGGAGAGG - Intergenic
991804629 5:70413586-70413608 GACAGGATTTTAAAAGGGAGAGG - Intergenic
991866755 5:71069436-71069458 GACAGGATTTTAAAAGGGAGAGG + Intergenic
992971989 5:82070982-82071004 GAGATAATTTCAAGAGGAAGGGG - Intronic
993315555 5:86401596-86401618 GACAGGAATCCAAGAATCAGAGG + Intergenic
993914062 5:93720019-93720041 GACAGGATTTGAAAAGGAAACGG - Intronic
998253306 5:140566997-140567019 GTCAGGGCTTGAAGAGTAAGGGG - Exonic
999838459 5:155399639-155399661 TACAGGATTTCAGGATTGAGTGG - Intergenic
1000200224 5:159002180-159002202 CACAGGACTTGAAGAGTAAATGG - Intronic
1001016102 5:168142708-168142730 GTCAGGATTTTAAGAGAAAGGGG - Intronic
1002557994 5:180059113-180059135 GAAAGGAGTTAGAGAGTAAGGGG - Intronic
1004019029 6:11759760-11759782 TTAAGGATTTTAAGAGTAAGAGG + Intronic
1004926529 6:20421175-20421197 GACAGGGGTTCAAGACTTAGTGG - Intronic
1005366419 6:25082767-25082789 GATAGCATTTGAGGAGTAAGGGG - Intergenic
1007888069 6:45255631-45255653 GCCAGGAGTTCAAGACTAACTGG - Intronic
1008136733 6:47785882-47785904 GACTAGATATCAAGGGTAAGTGG - Intronic
1008816672 6:55576937-55576959 GACTGGAATTCAAGAGAAATAGG + Intronic
1013295359 6:108753834-108753856 CAAAGGATTTCAAGAGGAAGGGG - Intergenic
1013939283 6:115642287-115642309 GACAGAAGTTCAAGAACAAGGGG + Intergenic
1014270415 6:119330051-119330073 TACAGGATGTGCAGAGTAAGTGG - Intronic
1016782270 6:147972482-147972504 GTCAGAATTTCAAGGGTGAGAGG + Intergenic
1018304882 6:162444558-162444580 GGCAGGATTTCAATAGGAAGAGG - Intronic
1018392085 6:163348335-163348357 GACAAGTTTTGAAGAGGAAGAGG + Intergenic
1019075173 6:169381016-169381038 AACATGATTTAATGAGTAAGTGG - Intergenic
1020048465 7:5062598-5062620 GACAGGGTTTCGAGAGCAACCGG + Intronic
1021387055 7:20044440-20044462 ATCAGGATTTTAAAAGTAAGGGG + Intergenic
1023244951 7:38192388-38192410 GAGAGGGTTAGAAGAGTAAGAGG + Intronic
1030689494 7:112517803-112517825 GAGAGGATTTCAAGGGCAACAGG + Intergenic
1030975461 7:116116557-116116579 GAAAGGATTTCAACAATGAGAGG + Intronic
1031137813 7:117904319-117904341 ACCACGACTTCAAGAGTAAGGGG - Intergenic
1031205282 7:118749183-118749205 GTCAGGAGTTCAAGAGCAACTGG + Intergenic
1033351749 7:140567776-140567798 GACAGGAGTTCCTGAGTTAGTGG - Intronic
1035426590 7:158780392-158780414 GACAGAACTTCAAAAGTAAAAGG - Intronic
1035853785 8:2950299-2950321 GAAAAGCTTTCAGGAGTAAGTGG + Exonic
1036735320 8:11309191-11309213 AACAGGATTGCAAATGTAAGTGG + Intronic
1038160822 8:25035775-25035797 AACAGGATTTAAATGGTAAGGGG + Intergenic
1038295246 8:26286393-26286415 TCCATGAATTCAAGAGTAAGGGG - Intergenic
1039275683 8:35932571-35932593 GACAGAATAGCAAGAGAAAGGGG - Intergenic
1039396466 8:37229230-37229252 GACAGAATTTCCAGAGCAAAGGG - Intergenic
1039748494 8:40455024-40455046 GAGAGGACTTCTAGAGTACGCGG + Intergenic
1040025554 8:42778703-42778725 GACAGGGTTTTGAGAGTAACCGG + Intronic
1040737808 8:50531847-50531869 TACAGGAGTTCAAGGGTATGAGG - Intronic
1043160404 8:76839873-76839895 TACAGGGTTTCCAGAGAAAGTGG + Intronic
1044052669 8:87527717-87527739 TACGGGATTTTAAGAGCAAGGGG - Intronic
1046256680 8:111707882-111707904 AACAAGATTTCAAGTGTTAGAGG + Intergenic
1046581335 8:116096485-116096507 GAGGTAATTTCAAGAGTAAGAGG - Intergenic
1046868418 8:119176636-119176658 GACAGGATGTCAAGGGTAGGGGG - Intronic
1048119751 8:131566285-131566307 GAAAGGATTCCAAGAATAAAAGG - Intergenic
1050720052 9:8577911-8577933 CACAGGATTTCAATAGAAAAGGG - Intronic
1051056351 9:12991845-12991867 GAAGGTATTTCAAGAGAAAGTGG - Intergenic
1051614419 9:18993658-18993680 GGTAGGATTTCAACAGAAAGGGG + Intronic
1052423229 9:28270964-28270986 GAAAGTATTTTAAGAGTAATAGG - Intronic
1053335091 9:37261122-37261144 TACAAGATTACAAGATTAAGGGG - Intronic
1056164813 9:83930727-83930749 GTCAGGAGTTCAAGACTATGTGG + Intergenic
1056803275 9:89708762-89708784 GACAGGACTTCAGGAGTGATGGG - Intergenic
1057990953 9:99769035-99769057 GTAAGGATTTCTAGAGTTAGTGG + Intergenic
1058533639 9:105932155-105932177 GACAGGATTTCAAGAGAGAGAGG + Intergenic
1058602930 9:106690649-106690671 CACATGAATTGAAGAGTAAGTGG - Intergenic
1059319301 9:113455586-113455608 TTCAAGATTTCAAGTGTAAGCGG - Intronic
1059401495 9:114073172-114073194 GACAGGCTCCCAAGAGGAAGAGG + Intronic
1061406574 9:130395708-130395730 GACAGGAACTCCAGAGAAAGGGG + Intronic
1061760051 9:132844586-132844608 GACAGGATTTCAAGAGTAAGAGG - Intronic
1062714651 9:138002406-138002428 AAGATGATTTAAAGAGTAAGAGG + Intronic
1185716262 X:2345108-2345130 GGCAGTATTTCAAGAGGCAGGGG - Intronic
1186156653 X:6733114-6733136 GACAAGGCTTCAAGCGTAAGTGG - Intergenic
1186622901 X:11260304-11260326 GAAATGAATTCAAGAGTAAGGGG + Intronic
1187596620 X:20779647-20779669 GACAGTATGTCATGATTAAGTGG + Intergenic
1191667386 X:63717352-63717374 GCCAGGCTTTCAAGACTAATAGG - Intronic
1192618105 X:72648977-72648999 GGCAGGATTTGGAGAGGAAGAGG + Intronic
1194651700 X:96522837-96522859 GCCAGGAGTTCAAGAAAAAGAGG + Intergenic
1195583880 X:106540050-106540072 GACTGAATTTGAAGAGTGAGTGG - Intergenic
1196728412 X:118918034-118918056 GTGAGAATTTCAAGGGTAAGTGG + Intergenic
1197496049 X:127182316-127182338 GACAGGATTCCTACAGTATGAGG + Intergenic
1197788589 X:130226293-130226315 AATAAGATTTCAAGAGAAAGAGG + Intronic
1198238638 X:134761630-134761652 GACTGGAGGTCAAGGGTAAGAGG + Intronic
1201729870 Y:17191977-17191999 GACAGAATAGCAAGAGAAAGGGG + Intergenic
1201862657 Y:18616277-18616299 GATAGGATTTAATTAGTAAGAGG + Intergenic
1201870666 Y:18704103-18704125 GATAGGATTTAATTAGTAAGAGG - Intergenic