ID: 1061762008

View in Genome Browser
Species Human (GRCh38)
Location 9:132857675-132857697
Sequence CAGGTACAGGATGCAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061761998_1061762008 15 Left 1061761998 9:132857637-132857659 CCTCCCTGACAACACCCATTCAG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG No data
1061761995_1061762008 29 Left 1061761995 9:132857623-132857645 CCAGATTCCTCTGCCCTCCCTGA 0: 1
1: 0
2: 1
3: 32
4: 453
Right 1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG No data
1061762003_1061762008 1 Left 1061762003 9:132857651-132857673 CCCATTCAGGAGGCAGTGTTCAA 0: 1
1: 0
2: 1
3: 11
4: 160
Right 1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG No data
1061762000_1061762008 12 Left 1061762000 9:132857640-132857662 CCCTGACAACACCCATTCAGGAG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG No data
1061761996_1061762008 22 Left 1061761996 9:132857630-132857652 CCTCTGCCCTCCCTGACAACACC 0: 1
1: 1
2: 4
3: 49
4: 468
Right 1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG No data
1061761997_1061762008 16 Left 1061761997 9:132857636-132857658 CCCTCCCTGACAACACCCATTCA 0: 1
1: 0
2: 1
3: 23
4: 648
Right 1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG No data
1061762001_1061762008 11 Left 1061762001 9:132857641-132857663 CCTGACAACACCCATTCAGGAGG 0: 1
1: 0
2: 0
3: 13
4: 116
Right 1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG No data
1061761994_1061762008 30 Left 1061761994 9:132857622-132857644 CCCAGATTCCTCTGCCCTCCCTG 0: 1
1: 0
2: 3
3: 42
4: 488
Right 1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG No data
1061762004_1061762008 0 Left 1061762004 9:132857652-132857674 CCATTCAGGAGGCAGTGTTCAAA 0: 1
1: 0
2: 0
3: 12
4: 189
Right 1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061762008 Original CRISPR CAGGTACAGGATGCAGAGAA GGG Intronic
No off target data available for this crispr