ID: 1061762611

View in Genome Browser
Species Human (GRCh38)
Location 9:132860821-132860843
Sequence GGGTGGGCTGCTGCAGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061762602_1061762611 13 Left 1061762602 9:132860785-132860807 CCGGGTGGGCTCTTGCAGGTCAT 0: 1
1: 0
2: 0
3: 18
4: 129
Right 1061762611 9:132860821-132860843 GGGTGGGCTGCTGCAGATTGTGG No data
1061762601_1061762611 14 Left 1061762601 9:132860784-132860806 CCCGGGTGGGCTCTTGCAGGTCA 0: 1
1: 0
2: 0
3: 13
4: 181
Right 1061762611 9:132860821-132860843 GGGTGGGCTGCTGCAGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061762611 Original CRISPR GGGTGGGCTGCTGCAGATTG TGG Intronic
No off target data available for this crispr