ID: 1061765794

View in Genome Browser
Species Human (GRCh38)
Location 9:132880458-132880480
Sequence CACAGCTCCCACCATGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061765789_1061765794 -4 Left 1061765789 9:132880439-132880461 CCTCTCAACCACTACCAACCACA 0: 1
1: 0
2: 4
3: 29
4: 323
Right 1061765794 9:132880458-132880480 CACAGCTCCCACCATGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061765794 Original CRISPR CACAGCTCCCACCATGATGA GGG Intronic
No off target data available for this crispr