ID: 1061768726

View in Genome Browser
Species Human (GRCh38)
Location 9:132900562-132900584
Sequence GTGCTTGTATAGCTGGACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061768721_1061768726 13 Left 1061768721 9:132900526-132900548 CCAATAGGAGAAACAAGCTCACA 0: 1
1: 0
2: 0
3: 15
4: 190
Right 1061768726 9:132900562-132900584 GTGCTTGTATAGCTGGACCACGG 0: 1
1: 0
2: 0
3: 3
4: 51
1061768720_1061768726 14 Left 1061768720 9:132900525-132900547 CCCAATAGGAGAAACAAGCTCAC 0: 1
1: 0
2: 1
3: 10
4: 169
Right 1061768726 9:132900562-132900584 GTGCTTGTATAGCTGGACCACGG 0: 1
1: 0
2: 0
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061768726 Original CRISPR GTGCTTGTATAGCTGGACCA CGG Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905018822 1:34794735-34794757 GCGCCTGTACGGCTGGACCATGG + Exonic
908992395 1:70108753-70108775 GTGTTTGTATAGCTGATCTAAGG - Intronic
912718155 1:111996941-111996963 CTGCTTGTAAAGCTGTACCCAGG - Intergenic
915042300 1:152979109-152979131 GTGCTTTCAGAGGTGGACCAGGG + Intergenic
920356154 1:205374648-205374670 GTCCTTGTATAGCTGGGATAGGG + Intergenic
1075823771 10:125336280-125336302 GTGCGTGAATAGAGGGACCATGG + Intergenic
1079342828 11:19627409-19627431 GTGCCTGTTGGGCTGGACCAAGG + Intronic
1083146555 11:60764084-60764106 GTGCTTGTCTACCTGGTGCATGG - Intronic
1087237745 11:95738885-95738907 GTGCTTATATAGCTTTGCCAAGG - Intergenic
1091885179 12:4011821-4011843 GTGTTTGTCTAGCTTGACCCAGG + Intergenic
1092778772 12:11966354-11966376 GTGCTGATACAGCTGGTCCAGGG - Intergenic
1098079230 12:66766306-66766328 GTGCTTTTATAGCAAGGCCAGGG - Intronic
1101748502 12:107562925-107562947 GTGCTGGCAGATCTGGACCAGGG + Intronic
1106470229 13:30047663-30047685 CTGCTTGTAAGGCTGGATCACGG + Intergenic
1114738108 14:25063747-25063769 GTCCTTATAAAACTGGACCAAGG + Intergenic
1122295520 14:100703599-100703621 GTGCGTGTCTACCTGGAACAAGG + Intergenic
1126518267 15:49558812-49558834 GTGCCTGTAGAGTTGGAACAGGG - Intronic
1130686540 15:86042496-86042518 GAGTTTGTATCCCTGGACCAAGG - Intergenic
1132991884 16:2799630-2799652 GTGCTTGTGTAGCGGGAACAGGG - Intergenic
1148960966 17:51392469-51392491 GTGTGTGTATATCTGGAGCAGGG + Intergenic
1148982052 17:51585639-51585661 GTGATAGTAGAGCTGGACCCTGG + Intergenic
1149426142 17:56556753-56556775 GTGCTTGAATTCCTGGACCTAGG - Intergenic
1149905414 17:60521885-60521907 GTGCTTGTGTATCTAAACCAGGG - Intronic
1160701923 19:511667-511689 ATGCTTGCGGAGCTGGACCAGGG + Intronic
1160820247 19:1054487-1054509 GTGGTTGTAGAGCAGGAGCAGGG + Intronic
948658390 2:239491231-239491253 GTGCCTGGATTGCTGGCCCACGG - Intergenic
1169221661 20:3826668-3826690 GTTCCTGTCCAGCTGGACCAGGG + Exonic
1170144784 20:13161335-13161357 TTTCTTCTATAGGTGGACCATGG - Intronic
1173945742 20:46949505-46949527 GTTCAGGTATAGCTGGATCAGGG + Intronic
1182208244 22:28650685-28650707 ATGCTTGTATAGTTAGACCTAGG - Intronic
1182301141 22:29337808-29337830 GTGCTGGGGCAGCTGGACCACGG - Intronic
1182978570 22:34646655-34646677 TTGCTTGTAAATATGGACCATGG - Intergenic
1184246577 22:43238755-43238777 GTGCTTGCATAGCCGGGCCCAGG - Intronic
957641082 3:82854473-82854495 ATGATTGTAAAGCTAGACCAAGG - Intergenic
962020651 3:131497918-131497940 GTGCTTGTATATCTGTACAATGG - Intronic
974242575 4:59269316-59269338 CTGCTGGTATAGCTGCAGCATGG + Intergenic
977152409 4:93529368-93529390 GTGCTGATGCAGCTGGACCAGGG - Intronic
1002966098 6:1967997-1968019 GTGCTTTTAAAGCTGCATCAGGG + Intronic
1008070920 6:47098003-47098025 GTGGTTGTATAACTTGCCCAAGG - Intergenic
1008952874 6:57179834-57179856 GTGCTTCTATAGTTTGATCAGGG + Intronic
1018344265 6:162884349-162884371 ATCCTTGTATAAGTGGACCAGGG + Intronic
1024497850 7:50068764-50068786 GTGTTTGTAAGGCAGGACCAAGG - Intronic
1025246385 7:57320669-57320691 GTGATTGTATAGCTGTACTCTGG + Intergenic
1044598965 8:93984763-93984785 TTGCTTGTAAAGCTGGAGCAGGG + Intergenic
1045017637 8:98012742-98012764 GTGGATGTGCAGCTGGACCAGGG + Intronic
1049229388 8:141474206-141474228 GAGCCTGTACAGCAGGACCATGG - Intergenic
1052164845 9:25312759-25312781 GAGCTTATATACCTGAACCAAGG - Intergenic
1058698985 9:107585519-107585541 GGGCTTCTATGGCTGGACTAGGG + Intergenic
1058731680 9:107856541-107856563 CTGCTTCTATAGCTGGAAGATGG + Intergenic
1061768726 9:132900562-132900584 GTGCTTGTATAGCTGGACCACGG + Intronic
1061956238 9:133962576-133962598 GTGCTTGGAGAGCTGGAGCCAGG - Intronic
1192431815 X:71117873-71117895 GTGCCTCTTTAGCTAGACCAAGG + Intergenic
1197193148 X:123671122-123671144 ATGCTTTTATTGCTGGACCCAGG - Intronic
1197788496 X:130224962-130224984 CTGCTTGTATAACTGGCCCTTGG - Intronic