ID: 1061774458

View in Genome Browser
Species Human (GRCh38)
Location 9:132951643-132951665
Sequence CTGAAACCTGTGAGGAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061774458_1061774465 30 Left 1061774458 9:132951643-132951665 CCCCCTCTCCTCACAGGTTTCAG 0: 1
1: 0
2: 4
3: 31
4: 315
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data
1061774458_1061774463 -3 Left 1061774458 9:132951643-132951665 CCCCCTCTCCTCACAGGTTTCAG 0: 1
1: 0
2: 4
3: 31
4: 315
Right 1061774463 9:132951663-132951685 CAGATCCATATCATAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061774458 Original CRISPR CTGAAACCTGTGAGGAGAGG GGG (reversed) Intronic
900174687 1:1286512-1286534 CGGGAGCCTGGGAGGAGAGGTGG + Intronic
902277403 1:15349786-15349808 CTGACACCAGGGAGGAAAGGAGG + Intronic
904836889 1:33343671-33343693 CTGAGACCTGTGAGAAGATTAGG + Intronic
905168145 1:36095590-36095612 CTCAAACCTTTCAGGAGGGGTGG - Exonic
905547591 1:38811882-38811904 CTCAAACCCCTGAGGGGAGGGGG - Intergenic
905662160 1:39735938-39735960 CTCCAACCTCTGAGGAGAGGAGG - Intronic
905811517 1:40916808-40916830 CCAAAACCTGGGAGGGGAGGTGG + Intergenic
906317136 1:44793689-44793711 TTGAAACCTGAGAGCTGAGGAGG - Intergenic
907333397 1:53685743-53685765 CTGAAGCCGCTGGGGAGAGGAGG - Intronic
907922896 1:58929804-58929826 GAGAAACCTGTCTGGAGAGGGGG - Intergenic
911735606 1:101333603-101333625 CTGTCACCTGTGAGGAATGGAGG - Intergenic
912391975 1:109309255-109309277 CTGAAACCTGTGAAGGTATGTGG + Intergenic
915060365 1:153176924-153176946 CTGAAACCTGTGAGCGCAAGGGG + Intergenic
915281282 1:154823799-154823821 CTGAGATCTGTGGGGTGAGGCGG + Intronic
915900301 1:159841938-159841960 CTGAGGCCAGTGGGGAGAGGAGG + Intronic
917208331 1:172602048-172602070 CTGAAACCTGAGATGAGAAGAGG - Exonic
917642729 1:176998521-176998543 CTGGGACCTGGGTGGAGAGGTGG + Intronic
918225390 1:182476758-182476780 ATGAAGCCAGAGAGGAGAGGTGG - Intronic
918252335 1:182714125-182714147 CTGAAACCTGTAGGGTGAGTGGG - Intergenic
918262260 1:182806637-182806659 CAGAGACCTGTCAGGAGAAGTGG - Intronic
918437671 1:184533248-184533270 ATGAAACCTGTGTGGGGAAGAGG - Intronic
918450060 1:184649376-184649398 CTGGACCCTGGGAGAAGAGGAGG + Intergenic
920314447 1:205067346-205067368 CTGAACCCTGTGAGCAGGGTTGG - Intronic
920375030 1:205503752-205503774 CTGAGGGCTGTGAGGAGAGGAGG - Intergenic
920867138 1:209762589-209762611 CCCCAGCCTGTGAGGAGAGGTGG - Exonic
923073349 1:230586324-230586346 CTTGAACCTGTGAGGCGTGGAGG + Intergenic
923316825 1:232788568-232788590 CCAACACCTGTGAGGAGAAGGGG - Intergenic
923398883 1:233595924-233595946 CTTGAACCTGGGAGGGGAGGCGG + Intergenic
923932642 1:238720341-238720363 CTGAAAAATGTGAAGAGAGTAGG + Intergenic
924866828 1:247991900-247991922 CTTTAATCTCTGAGGAGAGGAGG + Intronic
1062771539 10:105128-105150 CTGGAGCCTGTGAGGGGAGAAGG + Intergenic
1063654149 10:7970434-7970456 CTGTAGCCAGTGAGGGGAGGGGG + Intronic
1064104436 10:12489359-12489381 CTGAAGCCAGGCAGGAGAGGAGG + Intronic
1064221065 10:13440479-13440501 GGGACAGCTGTGAGGAGAGGCGG - Intronic
1065519519 10:26558079-26558101 ATGAATCCTCTGAGGACAGGAGG + Intronic
1065892587 10:30133844-30133866 TTGAGACCTGAGAGGTGAGGAGG + Intergenic
1066135033 10:32437301-32437323 CTGATACCTGTGAAAAGAGTGGG + Intergenic
1066509034 10:36074814-36074836 CTGAAGCCTGTGGTGAGAGGTGG + Intergenic
1067546703 10:47197047-47197069 CTGAGGCCTGTGAGGAGAGGTGG + Intergenic
1068529958 10:58174618-58174640 CTAAATACTGTGAGGAGTGGTGG - Intergenic
1068809385 10:61238791-61238813 ATGAGACCTTTGAGGACAGGAGG - Intergenic
1070597400 10:77842187-77842209 CTCAAACCTGGCAAGAGAGGTGG + Exonic
1071539204 10:86465278-86465300 CTGGAACCTAGGAGGCGAGGCGG - Intronic
1072402352 10:95117852-95117874 CTGAAGCCTGTCAGGGGCGGTGG - Intergenic
1073015042 10:100391892-100391914 CTGAAAATGGTGAGGAGAGGAGG - Intergenic
1073755454 10:106576262-106576284 CAGAAACTTGTGAGTAGTGGGGG + Exonic
1073984530 10:109193334-109193356 CTCAAACCCCTGAGGGGAGGGGG + Intergenic
1076573982 10:131451834-131451856 CTGAAAACTGCCTGGAGAGGTGG - Intergenic
1077138445 11:1013032-1013054 CGGAAACCTGTGCCGAGATGGGG - Exonic
1077414117 11:2416589-2416611 CTGAGACTGGTGAGAAGAGGCGG + Intronic
1077735883 11:4790257-4790279 CTTAAACCTGGGAGGTGCGGAGG + Intronic
1078099349 11:8320643-8320665 CTGAACCGTGTGAGGAGCCGTGG + Intergenic
1081525636 11:43925689-43925711 CTGAGCCCTGTGGGGAGAGGTGG + Intronic
1081608262 11:44541288-44541310 CTGAAGCATGAGAGGAGAGGAGG + Intergenic
1085054332 11:73395071-73395093 GCGGAACCTGTGAGGAGAGTGGG - Exonic
1088713363 11:112527646-112527668 CTGAAAACTGTCAGGAAGGGAGG + Intergenic
1088802710 11:113320785-113320807 CTCAAACCCCTGAGGGGAGGGGG - Intronic
1091132331 11:133156969-133156991 CTGAAACGTGTGGGGTGAGCAGG - Intronic
1091144487 11:133265733-133265755 CTGACACCTGGGAGGAGCGCCGG - Intronic
1091396708 12:157681-157703 CCGAAACCTTCGAGGTGAGGAGG + Exonic
1091857122 12:3748918-3748940 CTGAGTCCTGTGAGGGGAAGGGG + Intronic
1092658737 12:10716263-10716285 CTGCAAAATGGGAGGAGAGGGGG - Intronic
1094135367 12:27119820-27119842 CTGAAAGCTCTGAAGAGAGCAGG - Intergenic
1096846306 12:54408948-54408970 CTGAAATCTGTGAGGGGAGAAGG + Exonic
1097143160 12:56920358-56920380 CTGGAACCAGGGTGGAGAGGAGG + Intergenic
1097865439 12:64556086-64556108 CTGACACCTGTGAAGAGAGAGGG + Intergenic
1098203649 12:68083593-68083615 ATGAAAGCAGTTAGGAGAGGGGG - Intergenic
1101218622 12:102611966-102611988 CTGAAACCTGAAAGATGAGGAGG + Intergenic
1103795758 12:123501991-123502013 CTTGAACCTGGGAGGGGAGGTGG + Intronic
1103895380 12:124269670-124269692 CTGACACATGGGAGGAGCGGTGG - Intronic
1104044225 12:125150421-125150443 CTGAAGCCAGTGATGAGAGATGG - Intergenic
1105482625 13:20792867-20792889 CTTGAACCTGGGAAGAGAGGAGG - Intronic
1106187346 13:27421057-27421079 ATGAAACCTGGGAGGGTAGGTGG + Intergenic
1106878861 13:34106925-34106947 CTTGAACCTGGGAGTAGAGGTGG + Intergenic
1110697436 13:78507788-78507810 GTGAAACATGTTAGGACAGGTGG - Intergenic
1111876965 13:93909885-93909907 ATGGAACCTGAGAGCAGAGGAGG - Intronic
1112088824 13:96060117-96060139 CTGAACCTTCTAAGGAGAGGTGG + Intergenic
1114226170 14:20740841-20740863 CTGACAGGTGTGAGAAGAGGAGG - Intronic
1114494908 14:23125968-23125990 CTGAGACCTGCGAGGAGTGGGGG + Exonic
1114644385 14:24246313-24246335 CTTGAACCTGAGAGGTGAGGTGG + Intergenic
1116428783 14:44821645-44821667 CTGAAAGATGTGAGGAGAATGGG + Intergenic
1117080180 14:52143655-52143677 CTGCAGCTTGTGACGAGAGGAGG + Intergenic
1119342757 14:73894506-73894528 CTTGAACCTGGGAGGGGAGGCGG - Intronic
1120128242 14:80772726-80772748 CTGAAACCTCTTATGGGAGGGGG - Intronic
1120398842 14:84002603-84002625 CTGGAACCTGGGAGGGGAGGTGG + Intergenic
1120893628 14:89510534-89510556 ATGAGACCAGTGTGGAGAGGGGG + Intronic
1121529233 14:94640945-94640967 CAGGAAGCTGTGAGGAGGGGAGG - Intergenic
1123091036 14:105742410-105742432 CTGGAATCTGGGAGGAGAGAAGG + Intergenic
1123167162 14:106336825-106336847 CTGAAATCTGAGGAGAGAGGCGG + Intergenic
1123169778 14:106361536-106361558 CTGAAATCTGAGGAGAGAGGAGG + Intergenic
1123199151 14:106645203-106645225 CTGAAATCTGAGGAGAGAGGAGG + Intergenic
1125296015 15:38203865-38203887 CTGACACCTGTGAAGGGAGATGG - Intergenic
1125552400 15:40555596-40555618 CTGAACCCTCAGAGGAGAGTTGG + Intronic
1125984297 15:44034755-44034777 CTGAAACTTGGGAGCTGAGGGGG + Intronic
1126315427 15:47364625-47364647 CTTAACACTGTGAGTAGAGGAGG + Intronic
1128086799 15:64892234-64892256 CAGGAGCCTGGGAGGAGAGGTGG - Intronic
1129566857 15:76632854-76632876 CTGGAACCTGGGAGGTGTGGAGG - Intronic
1129867611 15:78921559-78921581 CCCAAACCTGAGTGGAGAGGTGG - Exonic
1130899643 15:88197651-88197673 CTGGAAGCTGAGAGGAAAGGGGG + Intronic
1132861109 16:2072225-2072247 CAGACTCCTGCGAGGAGAGGAGG - Exonic
1133393580 16:5428653-5428675 CTGAAACCTGGAGGGTGAGGAGG + Intergenic
1134011848 16:10859708-10859730 CTGAAAGCAGTGGGGAGAGTGGG - Intergenic
1134468242 16:14498186-14498208 GTGAAACCCCGGAGGAGAGGAGG + Intronic
1134829682 16:17313102-17313124 CAGAAACCTGAGAGCAGATGAGG - Intronic
1134956028 16:18382579-18382601 CAGAGACCTATGAGCAGAGGGGG + Intergenic
1135208160 16:20499835-20499857 CCCAAACCTGTGGGGACAGGAGG - Intergenic
1135210739 16:20523865-20523887 CCCAAACCTGTGGGGACAGGAGG + Intergenic
1135471987 16:22739456-22739478 CCCAAATCTCTGAGGAGAGGGGG - Intergenic
1136774697 16:32865621-32865643 CTGAAACCTGTCAGGTCAGCAGG + Intergenic
1137434990 16:48447663-48447685 CAGCAAGCTGTGAGGACAGGTGG + Intronic
1138074567 16:54028342-54028364 CTGAAAACGGTGAGAGGAGGAGG - Intronic
1138155486 16:54699039-54699061 CTGACTCCTGTGTGGAGAGGTGG - Intergenic
1138347435 16:56328615-56328637 CGTCAGCCTGTGAGGAGAGGTGG - Exonic
1139677056 16:68530796-68530818 CAGCACCCTGGGAGGAGAGGCGG + Intronic
1139933385 16:70548354-70548376 CTGACACCTGACAGGAGAAGAGG - Exonic
1141101916 16:81203648-81203670 CAGAAACCTCTGAGCAGAGATGG - Intergenic
1141372170 16:83498159-83498181 CTGATAGGTGAGAGGAGAGGGGG + Intronic
1141480145 16:84300886-84300908 CTTGAACCTGGGAGGCGAGGTGG + Intronic
1141607929 16:85165864-85165886 GGGACACATGTGAGGAGAGGGGG + Intergenic
1142013982 16:87733864-87733886 CTGTGACCTGTGTGGAGAGGTGG - Intronic
1142053259 16:87974567-87974589 GAGAAACTTGGGAGGAGAGGTGG + Intronic
1203077124 16_KI270728v1_random:1127757-1127779 CTGAAACCTGTCAGGTCAGCAGG + Intergenic
1143486936 17:7260530-7260552 CTCATACCTGTGAAGAGAAGGGG + Exonic
1144779835 17:17802274-17802296 CTCAGACCTGTGAGAGGAGGCGG - Intronic
1146682294 17:34816851-34816873 CTGAAACCTGAAAGGTGAGTGGG + Intergenic
1146942840 17:36855606-36855628 CTGGAACCAGAGAGAAGAGGGGG + Intergenic
1147574920 17:41593473-41593495 CAGAAAACTGTGTGGAGAGTGGG + Intergenic
1147896224 17:43753165-43753187 CTGGAACCTCAGAGGAGAGAGGG + Intergenic
1148233221 17:45950160-45950182 CTGTAACCTGTGAGGTGGGCAGG - Intronic
1148289623 17:46432985-46433007 TGGAAATCTGTGAGGAGATGTGG + Intergenic
1148311791 17:46650557-46650579 TGGAAATCTGTGAGGAGATGTGG + Intronic
1148442493 17:47718777-47718799 CTGAAAATTGTGAGAAGGGGAGG + Intergenic
1148895518 17:50836963-50836985 CCGAAGCCTGGAAGGAGAGGTGG + Intronic
1151876378 17:76869901-76869923 CGGATGCCTGGGAGGAGAGGGGG - Intronic
1153599598 18:6766677-6766699 CTGAAACCTATGATCAGAGAAGG - Intronic
1156549846 18:38004087-38004109 CTCAAACCCCTGAGGGGAGGGGG - Intergenic
1157075095 18:44457120-44457142 GGGAAACATGTGAGGAGGGGAGG - Intergenic
1158281948 18:55838153-55838175 CTGAAATCTCGGTGGAGAGGAGG + Intergenic
1159679331 18:71327456-71327478 CTGAAACCTGTGGAGAGAGCAGG - Intergenic
1160155687 18:76432329-76432351 CAGAGACCTGTGGGGAGAGCAGG - Intronic
1160244962 18:77150486-77150508 CTGAGAGCTGTGAGGAAAAGGGG - Intergenic
1160811499 19:1014850-1014872 CCCAAACCTGGGAGGAGACGAGG + Intronic
1161204479 19:3033953-3033975 CTGAAGCCTGGAGGGAGAGGCGG - Intronic
1161273070 19:3400991-3401013 CTGAGACCTGAGAAGTGAGGAGG + Intronic
1161325361 19:3661102-3661124 AGGAAACCTGTGAGGGGTGGTGG + Intronic
1163488576 19:17604174-17604196 CTAAAACCAGTGAGGAGAGGTGG - Exonic
1164933989 19:32197157-32197179 CTGAAATCTGTGATGAGGGTGGG - Intergenic
1167352722 19:48985747-48985769 CTGGATCCTGGGAGAAGAGGGGG + Intronic
1167494761 19:49811250-49811272 CTGGAAGCTGAGAGGATAGGAGG + Intronic
1168101808 19:54145365-54145387 CAGAAAGGTGTGGGGAGAGGAGG + Intronic
1168371319 19:55836781-55836803 CTGAGACCTGTGAGAAGAATGGG + Exonic
1168395295 19:56042428-56042450 CTTGAACCTGGGAGGGGAGGTGG - Intronic
1168660730 19:58163900-58163922 GAGAAACCTGGGAGAAGAGGAGG + Intergenic
925076287 2:1018949-1018971 GGGAAACCTGTCAGGACAGGAGG - Intronic
926123444 2:10257025-10257047 CTGGTCCCTGTGAGGAGAGGAGG - Intergenic
926956240 2:18303974-18303996 CAGAAGCCTGGGAGCAGAGGAGG + Intronic
927556967 2:24041769-24041791 CTTGAACCTGGGAGGGGAGGCGG + Intronic
928077970 2:28282553-28282575 CTTGAAGCTGTGAGGAGATGGGG - Intronic
928445679 2:31331663-31331685 CTGAAAGGTGTGGGGAGAGGGGG + Intergenic
931249740 2:60519452-60519474 CTATAACCTGTAAGGAGAGATGG + Intronic
932173460 2:69578076-69578098 TTGAAAGCTGAGAGGTGAGGTGG - Intronic
932436339 2:71704469-71704491 CTGAGACCTGTGGGATGAGGAGG + Intergenic
933130146 2:78662317-78662339 CTGGAACCTGTGACTAGTGGGGG + Intergenic
934844527 2:97654294-97654316 CTTAAACCTGCCAGAAGAGGGGG + Intergenic
936604009 2:113929758-113929780 CTTAAACCTGGGAGGCGGGGAGG - Intronic
936662800 2:114560659-114560681 CTGAGGCTTGTGTGGAGAGGTGG - Intronic
937657013 2:124388019-124388041 CTGAAGCCTATGAGGAGAGGTGG - Intronic
937870915 2:126785467-126785489 CTCAAACCTGTGAGGGCAGCTGG + Intergenic
937875516 2:126822728-126822750 CTGGACCGTGTGAAGAGAGGTGG + Intergenic
941210001 2:162625646-162625668 CAAAACCCTGTGAGGTGAGGTGG - Intronic
941935091 2:170975706-170975728 ATGCGACCTGTGAGGAGGGGAGG + Intergenic
944623172 2:201540110-201540132 ATGAAAGCTGAGAGGTGAGGTGG + Intronic
945114590 2:206398940-206398962 CTGGAACCTGTCAGGAGGGTGGG + Intergenic
948632672 2:239312155-239312177 CTGCAACCTGGAAGGAGGGGCGG + Intronic
948945560 2:241217496-241217518 CTGAGGCCGGTCAGGAGAGGCGG + Intronic
1169510619 20:6260149-6260171 GTGAAGGATGTGAGGAGAGGGGG + Intergenic
1170361556 20:15552117-15552139 TAGAAACCTATGAGGAGGGGAGG - Intronic
1170877489 20:20264378-20264400 CTGGAACCTTTGGGTAGAGGTGG + Intronic
1171131384 20:22656847-22656869 CCTACACCTGTGAAGAGAGGTGG + Intergenic
1171400956 20:24872761-24872783 CTGCACCCTGTGAGGAGGGATGG + Intergenic
1171479343 20:25441183-25441205 CTGAATCCTGTCACGTGAGGTGG + Intronic
1172513612 20:35517187-35517209 CTGAAAGCTAAGAGGAGAGGTGG + Exonic
1172852551 20:37977127-37977149 CTGAAAGCTTTGAAGCGAGGAGG + Intergenic
1173943154 20:46929203-46929225 CTGAAACCTGGAAGGAGGAGAGG + Intronic
1175914784 20:62420805-62420827 CTGAGACCTGTGGGTAGGGGAGG - Intronic
1176198082 20:63846748-63846770 CTGAACCCTGGGAGGGGTGGGGG - Intergenic
1176647656 21:9366009-9366031 CTGAGCCCTGGGAGGGGAGGGGG - Intergenic
1178799486 21:35779153-35779175 CTGTCACCTGAGAGGAGAAGGGG + Intronic
1181289071 22:21776905-21776927 GTGAAATCTGAGAGTAGAGGAGG - Intronic
1181712159 22:24697455-24697477 CACAACCCTGTGAGGACAGGAGG + Intergenic
1182119621 22:27778466-27778488 CGGGAACCTGTGAGGGGAGGGGG - Intronic
1182299041 22:29327928-29327950 CTGAAACCTGGGAGGCCAGGAGG + Exonic
1182354642 22:29717117-29717139 CTGAAACCTGTGATTCCAGGGGG - Intergenic
1182747356 22:32616066-32616088 CTGCAAGCTGCGAGGAGAGAGGG + Intronic
1182779168 22:32853718-32853740 CTGAAATTCGTAAGGAGAGGAGG - Intronic
1183507967 22:38219942-38219964 CTGCCACCTGTGAGGAGAGTTGG - Exonic
1183775024 22:39958337-39958359 ATGAAAACTGAGAGGAGAGATGG - Intronic
1184328641 22:43811705-43811727 TTGAAACCTGTGGGGTGAAGGGG - Intronic
949105980 3:199764-199786 CTGAAATCTTTGAAGATAGGAGG + Intronic
949467760 3:4361340-4361362 CTGAAGGCTTTGGGGAGAGGGGG + Exonic
949509489 3:4755710-4755732 CTGACACCTGAGAGAAAAGGTGG - Intronic
950314297 3:11986928-11986950 CTGACACCTGAAATGAGAGGGGG - Intergenic
950475892 3:13214593-13214615 CAGAAGCCTGTGAGGTGAGGAGG + Intergenic
951124686 3:18969454-18969476 CTGGAACCTCTGAGGAGATCTGG - Intergenic
953575314 3:44108727-44108749 ATGAAGGCTGTGAGGAGATGAGG + Intergenic
954921765 3:54197414-54197436 CTGAAAACTGAAAGGAGAGGAGG - Intronic
956021939 3:64942253-64942275 CTGAAACATGACAGGAGAGAGGG - Intergenic
956065185 3:65390199-65390221 ATGAAACCTGTGCTGAGGGGAGG + Intronic
956453987 3:69402531-69402553 CTGAAAGCTTTGAGAAGGGGAGG + Intronic
956651100 3:71505505-71505527 CTTGAACCTGGGAGGGGAGGCGG - Intronic
956895533 3:73655997-73656019 CTGAGAAATGTGAGCAGAGGTGG - Intergenic
957037091 3:75303588-75303610 CTGAGAGCTGAGGGGAGAGGGGG - Intergenic
958752844 3:98213008-98213030 CTGAATCCTGTCAGCCGAGGAGG + Intergenic
959839517 3:110958557-110958579 CTGAAACCCCTGATGGGAGGGGG + Intergenic
961505150 3:127365679-127365701 CTGAAGGCGGTGTGGAGAGGTGG + Intergenic
963079035 3:141374354-141374376 CTGAAACCTTTGAGGAATGATGG + Intronic
963863939 3:150340315-150340337 CTGCCACCTGTGAAGAGAGAAGG + Intergenic
963882591 3:150545861-150545883 GGGAGACCTGTGAGGTGAGGGGG - Intronic
964724143 3:159796592-159796614 CTAAAAAGTGTCAGGAGAGGGGG - Intronic
965573982 3:170199153-170199175 ATGAAACCTGTGCGGCCAGGTGG + Intergenic
966383583 3:179369331-179369353 CTGATAACAGTGAGGAGAGGAGG - Intronic
967213981 3:187194511-187194533 CTGAATCCTGGGAGGGCAGGAGG - Intergenic
967225818 3:187290125-187290147 CTGAGACTTGTAAGGGGAGGTGG + Intronic
1202739224 3_GL000221v1_random:38978-39000 CTGAGCCCTGGGAGGGGAGGGGG + Intergenic
969057214 4:4409557-4409579 CGGAGACCTGTGGGCAGAGGTGG - Exonic
970590420 4:17555295-17555317 CTGATACAGGTGAGGAGAGAAGG - Intergenic
971898365 4:32625596-32625618 TTGAACCCAGTGAGGAGAGGAGG + Intergenic
973607409 4:52601142-52601164 CTAAAACCTATGAGGGCAGGGGG + Intronic
975909136 4:79247798-79247820 CTGAGACCAGTGGTGAGAGGAGG - Intronic
978668178 4:111211814-111211836 CAGAATCTTGTGAGGAGAAGAGG - Intergenic
978903296 4:113978944-113978966 GTGACAGCTGAGAGGAGAGGAGG - Exonic
979638973 4:122989708-122989730 CTGGAATCTGTGGGGAGAGCTGG + Intronic
979755135 4:124330938-124330960 TTGAAAACTGTGAGGGGTGGGGG + Intergenic
980172026 4:129301345-129301367 CTGAACCATGTGAAGAAAGGTGG + Intergenic
982127701 4:152198587-152198609 CTGAAGCCTGTGAGTGGAAGTGG - Intergenic
984624863 4:181995884-181995906 CTGGGACCTGTGAAAAGAGGTGG - Intergenic
984750398 4:183267274-183267296 GTGAGACCAGTGAGGAGAGCAGG + Intronic
984881044 4:184410174-184410196 CTGCAACCAGTGAGGAGTGGAGG - Intronic
984934579 4:184879035-184879057 CTGAGACCTGCAAGGTGAGGAGG - Intergenic
985934024 5:3080697-3080719 CTGAGACCAGTGCTGAGAGGAGG + Intergenic
986223342 5:5790500-5790522 AGGAAATCTGTGAGCAGAGGGGG + Intergenic
986360982 5:6977956-6977978 CTGCCACCTGTGTGGTGAGGGGG - Intergenic
986482098 5:8199850-8199872 CTGCAACCTGGGAGCAGAGGAGG + Intergenic
987246180 5:16051290-16051312 CTGTACCCTTTGAAGAGAGGAGG - Intergenic
987495988 5:18645254-18645276 CTTGAACCTGGGAGGTGAGGTGG + Intergenic
988848502 5:35154974-35154996 CTGGAGCCTGTCAGGGGAGGGGG + Intronic
989773379 5:45171869-45171891 CTGAAGCCTGTGGGGAGGGAGGG - Intergenic
990040540 5:51373896-51373918 GTGAAACCTGTGAGTAGAGAAGG + Intergenic
990214463 5:53514693-53514715 CTTGAACCTGGGAGGTGAGGTGG + Intergenic
990590339 5:57256172-57256194 CTGGAACCTAGGAGGTGAGGTGG + Intronic
991985192 5:72277922-72277944 CTGGAGCCTGTGAGATGAGGGGG + Intronic
995749252 5:115437038-115437060 AGGAAACCTGAGAGCAGAGGAGG - Intergenic
996700374 5:126444851-126444873 CTAAGCCCTGTCAGGAGAGGTGG - Intronic
997539381 5:134648951-134648973 CTGAAGACTGGGAGAAGAGGGGG - Exonic
997733684 5:136198448-136198470 CTGACCCCTGAGAGGAGAGAGGG + Intergenic
998918426 5:147041269-147041291 CTACAGCCTGTGAGGAGAGGAGG - Intronic
999181766 5:149674821-149674843 CTGAGGTCTGTGAAGAGAGGTGG - Intergenic
999247098 5:150160889-150160911 GTGAACTCTGTGAGGACAGGAGG - Intergenic
999368343 5:151037622-151037644 CTGAAACCTTTAAGAAGATGTGG - Intronic
1000009479 5:157217981-157218003 TTGAAAACTATGGGGAGAGGGGG - Intronic
1000998251 5:167980683-167980705 CTGACTCCTGTGGGGAGAAGGGG + Intronic
1001390470 5:171374625-171374647 CTGGAATCTCTTAGGAGAGGAGG + Intergenic
1002670265 5:180861077-180861099 CTGAGACATGTGCGGGGAGGGGG + Intronic
1003241118 6:4346677-4346699 CTGAAGCCTGGCTGGAGAGGTGG - Intergenic
1003791945 6:9556013-9556035 GGGAAACCTGTGAGAAAAGGAGG + Intergenic
1003987250 6:11449162-11449184 CTGATACCAGTGAGTAGGGGAGG - Intergenic
1006908530 6:37548936-37548958 CTGAAACCTCTACGGAGGGGAGG + Intergenic
1007002403 6:38326514-38326536 ATGACAACGGTGAGGAGAGGTGG + Intronic
1008008478 6:46437881-46437903 CTGCAACCTGTGAGGAGAGAGGG - Intronic
1009963981 6:70558163-70558185 ATGAAAACTAAGAGGAGAGGTGG + Intronic
1010123193 6:72403878-72403900 CTGAAACAGGTGATGAGAGTGGG + Intergenic
1012312807 6:97749032-97749054 CTGGGACCTGTCAGGAGTGGGGG - Intergenic
1012464605 6:99503411-99503433 CTTGAACCTGGGAGGGGAGGCGG - Intronic
1012525185 6:100169013-100169035 CTTATACCTGTGAGGAAAAGAGG + Intergenic
1013589128 6:111605519-111605541 GTTAACCCTTTGAGGAGAGGAGG - Intronic
1013614136 6:111825787-111825809 CTGTAACGTGTGAGGAAAGCTGG + Intronic
1014254217 6:119145237-119145259 CTGCAACCTGGGGAGAGAGGTGG - Intronic
1014306756 6:119752643-119752665 CAGAAAACTGTGAGGAGTGCAGG + Intergenic
1016791522 6:148071287-148071309 CTGGAGCCTGTCAGGAGATGTGG - Intergenic
1017393766 6:153972478-153972500 CAGAAAGCGGTGAGGTGAGGCGG + Intergenic
1020212480 7:6166874-6166896 CTGGGGCCTGTGGGGAGAGGAGG - Intronic
1022645232 7:32223519-32223541 CTGAATCCTGTAAGGTGAGAAGG - Intronic
1023879088 7:44308466-44308488 AGGCAAGCTGTGAGGAGAGGAGG - Intronic
1024306770 7:47935730-47935752 CTCAAACCTGACAGGACAGGGGG - Intronic
1025789096 7:64671217-64671239 CTGAAAACTTAGAGGAAAGGAGG + Intronic
1025933168 7:66012590-66012612 CTACAACCTGTGAGGACAGTGGG - Intergenic
1026186562 7:68086338-68086360 CTGACACCTGTGAGTGGAGACGG + Intergenic
1027177924 7:75916175-75916197 CTCAACCCTGTGGGGAGAGCAGG - Intronic
1027640693 7:80730057-80730079 GTGAAAGGTGTGAGGACAGGTGG - Intergenic
1027817954 7:83002085-83002107 CTGAAAACTAGGAGGAGAAGTGG - Intronic
1028828691 7:95303504-95303526 ATGAAACCTGAGATGAGAGTGGG + Intronic
1030388681 7:108898775-108898797 CTGAAAAGTATAAGGAGAGGGGG - Intergenic
1031451151 7:121921697-121921719 TTGAAGCCTTTGAAGAGAGGAGG + Intronic
1033273617 7:139955198-139955220 CAAAGACCTGGGAGGAGAGGAGG - Intronic
1033547600 7:142415715-142415737 CTGAGAGCTGTGGGGAGAAGAGG - Intergenic
1033968746 7:147011330-147011352 CTTGAACCTGGGAGGCGAGGCGG + Intronic
1035317371 7:158004985-158005007 CTGAGGCTTGTGAGGAAAGGGGG - Intronic
1036626872 8:10479511-10479533 CTGAACCCTGTGGGGTGCGGAGG + Intergenic
1037880628 8:22571785-22571807 CTGAGAGGTGTTAGGAGAGGAGG - Exonic
1037920937 8:22804959-22804981 AGGAAACCTGTGAGCAGAGTGGG - Intronic
1037976751 8:23219325-23219347 CTGGAACCTGTGACCTGAGGCGG - Intronic
1039250529 8:35659331-35659353 CTCAAACCTAAGAGAAGAGGAGG - Intronic
1039363865 8:36909998-36910020 CTGATAGCTGTATGGAGAGGAGG + Intronic
1039400507 8:37265293-37265315 CTGAAGCCTGTGAAAAGACGTGG + Intergenic
1040562660 8:48538206-48538228 CAGCAATCTGGGAGGAGAGGCGG + Intergenic
1041164065 8:55073690-55073712 CTTAATCCTGTCAGGTGAGGAGG + Intergenic
1041868459 8:62604949-62604971 CTGCCACCTGTGACGAGAGCAGG - Intronic
1042511759 8:69619761-69619783 CTCAAACCCCTGATGAGAGGGGG + Intronic
1042514040 8:69641379-69641401 CTGAAAGCTCTGCAGAGAGGTGG + Intronic
1044265086 8:90172591-90172613 CTGAAGCCTGTGAGCATATGAGG - Intergenic
1044329413 8:90899035-90899057 CTGGCACCTGTGAAAAGAGGAGG + Intronic
1045811087 8:106220876-106220898 AAGAAACCTGTGAGGAGGGCTGG + Intergenic
1047624510 8:126642442-126642464 CAGAAGCCTCTGATGAGAGGTGG - Intergenic
1047676095 8:127204843-127204865 CTGATAGCTGTAAGGAGAGTGGG + Intergenic
1049299653 8:141862785-141862807 CTGAACCCATTGGGGAGAGGGGG + Intergenic
1049940818 9:544697-544719 CTGAAACCTGTTGGGTGAGGTGG + Intronic
1051011108 9:12415774-12415796 CTGAAACCTTGGATGAGGGGGGG - Intergenic
1052684238 9:31733962-31733984 CTCAAGCCTGTGAGGTGAGATGG + Intergenic
1053518630 9:38754121-38754143 ATGAAAACTGGGAGGAGAGAAGG - Intergenic
1055577967 9:77678868-77678890 CTGAACCTTGGGAGGAGTGGTGG - Intergenic
1056189062 9:84166995-84167017 CGGAAACGAGAGAGGAGAGGAGG + Intergenic
1056936797 9:90921270-90921292 CTGCAGCATGTGAGGACAGGAGG - Intergenic
1057554942 9:96080565-96080587 ATGGAATCTGGGAGGAGAGGTGG - Intergenic
1060147389 9:121264768-121264790 CTGTAACCTGTGGGTGGAGGGGG - Intronic
1061119959 9:128636237-128636259 CTGAGTCCTGAGAGGAGAGGAGG + Intronic
1061190575 9:129080568-129080590 CTGAGACCAGAGAGCAGAGGGGG - Intergenic
1061749714 9:132769378-132769400 CTGAAACCTCTGGGGAAAGTGGG + Intronic
1061774458 9:132951643-132951665 CTGAAACCTGTGAGGAGAGGGGG - Intronic
1203707955 Un_KI270742v1:69422-69444 CTGAGCCCTGGGAGGGGAGGGGG + Intergenic
1186276812 X:7948395-7948417 CTGAAACCTGTAAAGGGAAGTGG + Intergenic
1186811235 X:13190829-13190851 CAGGCACCTGAGAGGAGAGGAGG - Intergenic
1186823718 X:13316786-13316808 CTGAAACCTGTGAGTGTAGAGGG + Intergenic
1187106279 X:16245687-16245709 CTGGAGCCTGTGGGGAGTGGGGG + Intergenic
1187297106 X:18012503-18012525 CCTAAACCTGTGTGGAGAAGTGG + Intergenic
1187577184 X:20569755-20569777 CTGAAACTTGCGAGGAGACAAGG - Intergenic
1189940757 X:46118009-46118031 CAGAAACCTGTGGTGAGAGCGGG + Intergenic
1190338748 X:49279765-49279787 CTAAAACCTGAGAGGAGCTGGGG - Intronic
1191150440 X:57215802-57215824 CTGAAACCTGTCAGGTGGTGGGG + Intergenic
1193473230 X:81932622-81932644 CTAAAACTTGTGGGGAGGGGTGG - Intergenic
1193566413 X:83082369-83082391 CTGGGGCCTGTGAGGAGTGGGGG + Intergenic
1194014424 X:88601564-88601586 CTGAAAACTTTAAGGAGAGAAGG - Intergenic
1194826949 X:98576244-98576266 CTGAAAACTCTGAGATGAGGAGG + Intergenic
1196830102 X:119769046-119769068 GTAAACCCTGAGAGGAGAGGCGG - Intergenic
1197750570 X:129961117-129961139 CTGAAGCCCCAGAGGAGAGGGGG - Intergenic
1197929431 X:131679521-131679543 CTTGAACCTGGGAGGGGAGGCGG - Intergenic
1199380977 X:147172137-147172159 CGCAAACATGTGAGCAGAGGTGG - Intergenic
1199996692 X:153030565-153030587 CTGCGGCCTGAGAGGAGAGGAGG - Intergenic
1200045073 X:153396865-153396887 CTGCTGCCTGAGAGGAGAGGAGG + Intergenic
1200416397 Y:2916142-2916164 CTGAAACCTGGGAGGCCAGATGG - Intronic
1201405002 Y:13641121-13641143 CTGAAATTTGTGGGGAGAGGAGG - Intergenic
1201446850 Y:14066022-14066044 CTGAAATCTGTGAAGGGAAGTGG - Intergenic