ID: 1061774460

View in Genome Browser
Species Human (GRCh38)
Location 9:132951645-132951667
Sequence ATCTGAAACCTGTGAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061774460_1061774463 -5 Left 1061774460 9:132951645-132951667 CCCTCTCCTCACAGGTTTCAGAT 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1061774463 9:132951663-132951685 CAGATCCATATCATAGCTGAAGG No data
1061774460_1061774465 28 Left 1061774460 9:132951645-132951667 CCCTCTCCTCACAGGTTTCAGAT 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG No data
1061774460_1061774466 29 Left 1061774460 9:132951645-132951667 CCCTCTCCTCACAGGTTTCAGAT 0: 1
1: 0
2: 2
3: 20
4: 209
Right 1061774466 9:132951697-132951719 GTCCAGCTCCTCCTCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061774460 Original CRISPR ATCTGAAACCTGTGAGGAGA GGG (reversed) Intronic
900890978 1:5449450-5449472 AGCTGGAACAGGTGAGGAGATGG + Intergenic
903257330 1:22111656-22111678 ATCAGAAGGGTGTGAGGAGAGGG - Intergenic
903505958 1:23835986-23836008 ATCTGAAAACTGTGTTGAAATGG + Intronic
905290614 1:36919605-36919627 AACTGATACCTGGAAGGAGATGG - Intronic
908342810 1:63199401-63199423 ATCTAAAACCTATGAAGGGATGG - Intergenic
910703667 1:90103768-90103790 AACTTAAATCTGTGAGGAAATGG + Intergenic
916272372 1:162957281-162957303 ATATTAAACATGTGATGAGAGGG - Intergenic
917048812 1:170894243-170894265 ATCTGGTTCCTTTGAGGAGATGG - Intergenic
917265705 1:173218424-173218446 ATCTGAAAGCTGTGAGGAAGTGG - Intergenic
917475424 1:175365304-175365326 TCCTGAAACACGTGAGGAGATGG + Intronic
917524684 1:175777386-175777408 AACTGAAAAAAGTGAGGAGAAGG + Intergenic
918169445 1:181982469-181982491 ATCTGAAAGCAATGAGGTGAAGG + Intergenic
919909507 1:202102089-202102111 ATAAGAAACCTGTGGGGAGAAGG - Intergenic
922503565 1:226113769-226113791 AGCTGCACACTGTGAGGAGAAGG - Intergenic
1063275468 10:4562600-4562622 ATCTGAGACCAGTTAGGAGGTGG - Intergenic
1064367145 10:14718241-14718263 AGCTGAAACCTGGGAGGCGGAGG + Intronic
1065727573 10:28680495-28680517 ATGTAAAACTTGTGAGGAGGAGG + Intronic
1066011943 10:31202326-31202348 ATCAGAAATCTGGAAGGAGAAGG - Intergenic
1067018216 10:42773136-42773158 ATCAGAAACCTGAGTGGAGCTGG + Intergenic
1067993141 10:51238496-51238518 CTCTTAAACCTGGGAGGAGGAGG + Intronic
1067998926 10:51308877-51308899 AGCTGAGACCTTTGAGGAGGGGG + Intronic
1068980916 10:63061277-63061299 TGCTTAAACCTGGGAGGAGAAGG + Intergenic
1072899657 10:99395806-99395828 TTCAGAAAGCTGTGAAGAGATGG + Intergenic
1073564782 10:104525765-104525787 GTCTCAAAGCTGTGAGAAGATGG - Intergenic
1074129389 10:110559814-110559836 TTCTGAAACCTTTTAGGGGATGG - Intergenic
1075015244 10:118905847-118905869 ACCAGAAAACTGTGAGGAGGAGG + Intergenic
1076809937 10:132881275-132881297 ATCTGCAAAGGGTGAGGAGACGG - Intronic
1078083419 11:8219720-8219742 ATCTGAGAGCTCTCAGGAGAGGG - Intergenic
1079852639 11:25556129-25556151 AGCTTGAACCTGAGAGGAGAAGG - Intergenic
1081048252 11:38303940-38303962 TTTTGAAACCTGTGAGGTGGAGG - Intergenic
1081456379 11:43227276-43227298 AACTGAAATATGTGAGGTGAAGG - Intergenic
1081803952 11:45879647-45879669 AACAGAAACCAGAGAGGAGAAGG - Intronic
1081813707 11:45927301-45927323 ATCTGCAGCCTATGGGGAGAGGG - Exonic
1084361267 11:68669905-68669927 ATCTGAAACCAGGGTGGGGAGGG + Intergenic
1084979087 11:72819370-72819392 CTCTGAAAGCTGTATGGAGAAGG - Intronic
1085668459 11:78438548-78438570 ATCTGCAAACTGTCAGCAGAGGG + Intronic
1086353307 11:85965898-85965920 TGCTGAAACCTGGGAGGCGAAGG - Intronic
1086826308 11:91503578-91503600 ATCTGAGACCTGGGAGAAGAGGG + Intergenic
1087193455 11:95280889-95280911 ATCTGAAAACAATGAGTAGATGG + Intergenic
1087272459 11:96125363-96125385 ATCTGAGACTTGTTAGGGGAAGG + Intronic
1088686120 11:112285857-112285879 ACCTGAAGCCTGTGATGAGACGG - Intergenic
1089170751 11:116509875-116509897 AGCTGAAAGCTGTCAGAAGATGG - Intergenic
1090669509 11:128936641-128936663 ATCTGAAACCTGAGAGGAAATGG + Exonic
1092465854 12:8730821-8730843 CTCTGGAACCTGGGAGGAGGAGG - Intronic
1092658739 12:10716265-10716287 ATCTGCAAAATGGGAGGAGAGGG - Intronic
1094822880 12:34240625-34240647 AGCTGGAACCTGGGAGGAGGAGG + Intergenic
1097210122 12:57361289-57361311 CGCTGGAACCTGTGAGGAGGAGG + Intronic
1099135851 12:78900325-78900347 AACTTAAATCTGGGAGGAGAAGG + Intronic
1100576269 12:95894133-95894155 ATCTTAAACCTGGGAGGCGGAGG + Intronic
1101352750 12:103947677-103947699 ATTTGGATCCTGTGTGGAGAGGG + Exonic
1101611370 12:106295438-106295460 ATTTTATACCTGTGAGGATAAGG + Intronic
1103064251 12:117883790-117883812 TGCTTAAACCTGTGAGGCGAAGG + Intronic
1104401594 12:128480956-128480978 AGCTGGACCCTGTGAGGAGCTGG - Intronic
1105577522 13:21667971-21667993 AGCTGGGACCCGTGAGGAGAGGG + Intergenic
1106039969 13:26080445-26080467 CTCTGAACTCTGTAAGGAGATGG - Intergenic
1106607104 13:31238954-31238976 ATGTGAAGCCTGAGAGGAGAAGG + Intronic
1107794088 13:44032070-44032092 TGCTTGAACCTGTGAGGAGAGGG - Intergenic
1110671004 13:78177702-78177724 ATCTGATACCTGTGAAAATAAGG - Intergenic
1113349457 13:109514020-109514042 ATGTGCAACCTGTGATAAGAAGG - Intergenic
1114704976 14:24715470-24715492 ACCTGAAACCTGTGTGGGGCTGG + Intergenic
1116510739 14:45743466-45743488 ATTTCAAATCTGTGAGGAAAGGG - Intergenic
1118280209 14:64421370-64421392 ATCTGAAACTTGAGATGGGAAGG - Intronic
1121031581 14:90662981-90663003 ATCTGAGACCCTTGAGAAGAGGG + Intronic
1122730524 14:103793771-103793793 AACTGACACCTGTGTGGGGAAGG + Intronic
1124602746 15:31148755-31148777 CACAGAAACCTGTGGGGAGAAGG + Intronic
1128714016 15:69893838-69893860 ATCTGAAAGCTGTGAAGTGGAGG - Intergenic
1129696202 15:77741888-77741910 AGCTGAAACCAGAGAGGAGAGGG + Intronic
1135796179 16:25445011-25445033 TCCTGAGACCTGGGAGGAGAGGG + Intergenic
1138339307 16:56278371-56278393 TTCTTACACCTGTGAGGAGCAGG + Intronic
1138701299 16:58866374-58866396 AGCTGAAACCTCTGAGTAGCTGG - Intergenic
1140002314 16:71038221-71038243 ATATGAAACCTCAGAGGGGAGGG - Intronic
1141877773 16:86837911-86837933 ATGTGAAGACTGGGAGGAGACGG + Intergenic
1142298809 16:89244338-89244360 ATCTTGAACCTGGGAGGCGAAGG + Intergenic
1143486934 17:7260528-7260550 AACTCATACCTGTGAAGAGAAGG + Exonic
1147148702 17:38500500-38500522 TTCTGAAGCCTTTGAGGAGAGGG + Intronic
1147391932 17:40114699-40114721 AACTGAAACCTGAGAAGAGAAGG - Intergenic
1149039027 17:52165484-52165506 TTCTGAAACCAATGTGGAGATGG + Intergenic
1150092491 17:62340263-62340285 ATCTAAAACCTGAGAGAACAGGG + Intergenic
1150568752 17:66367026-66367048 ATCTGAAAACAGAAAGGAGAGGG - Intronic
1150764052 17:67989140-67989162 CTCTTAAACCTGGGAGGTGAAGG + Intergenic
1150822489 17:68446670-68446692 ATCAGAAACCTCTGAACAGAAGG - Intronic
1153570719 18:6470908-6470930 ATCAGCAATCTGTGAGGAGTGGG - Intergenic
1153925122 18:9828546-9828568 ATGTAAAACAAGTGAGGAGATGG - Intronic
1154949450 18:21194377-21194399 TTCTTAAAGCTTTGAGGAGAAGG - Intergenic
1159824530 18:73190354-73190376 ATCTGAAACTTGTAAAGAGTAGG + Intronic
1159913171 18:74165489-74165511 ATCTGATTCCTGGGAAGAGAAGG - Intergenic
1160166263 18:76515417-76515439 CTCTTAAACCTGGGAGGCGAAGG - Intergenic
1160244964 18:77150488-77150510 TTCTGAGAGCTGTGAGGAAAAGG - Intergenic
1160338763 18:78068025-78068047 ATCTCAAACCTGGGAGGCGGAGG + Intergenic
1161534241 19:4809125-4809147 TGCTTAAACCTGTGAGGCGAAGG + Intergenic
1164579826 19:29427996-29428018 CTCTGCAACCTGGGAGGACAAGG - Intergenic
1165661698 19:37586471-37586493 ATCTGAAAACTGTTTGGAGAGGG + Intronic
1166918422 19:46211859-46211881 ATGTGAAACCTCTGAGGACTTGG + Intergenic
1167109207 19:47448946-47448968 CTGTGAACCCTGTGAGGACAGGG - Intronic
1167649345 19:50720930-50720952 ATGTGCAAACTCTGAGGAGACGG - Intergenic
925407287 2:3614058-3614080 AGCTTGAACCTGGGAGGAGAAGG - Intronic
925912180 2:8581202-8581224 ATCTGGAAGCTGGGAGGAGCAGG + Intergenic
926122977 2:10254872-10254894 GTCTGAAGCCTGGGAGGATATGG + Intergenic
926348776 2:11975755-11975777 ACCTAAAACCTGGGAGGAGAAGG - Intergenic
926898517 2:17722559-17722581 AACTGGAAAATGTGAGGAGATGG - Intronic
927657216 2:24959399-24959421 GTCTGGAACCTCAGAGGAGAGGG - Intronic
928077972 2:28282555-28282577 AACTTGAAGCTGTGAGGAGATGG - Intronic
928613510 2:33014090-33014112 ATTTGAAACCTGTGAGGGATGGG - Intronic
930622738 2:53661004-53661026 ATAGGAAAGCAGTGAGGAGAAGG + Intronic
931831168 2:66052909-66052931 AATTGAAATCTCTGAGGAGATGG - Intergenic
931858504 2:66329253-66329275 AATGGAAACCAGTGAGGAGAGGG + Intergenic
934050999 2:88210770-88210792 ATCCTAAATCTGTGAGGATAGGG - Intergenic
934115046 2:88780822-88780844 TTCTGAAACATGTGAAGATAAGG - Intergenic
934802042 2:97173529-97173551 TTCTGACACATGTGAGGATAAGG - Intronic
935333718 2:101996266-101996288 ATCTGACAGCTGAGAGGAGCTGG + Intronic
936781172 2:116034685-116034707 CTCTGGAACCTGGGAGGAGGAGG - Intergenic
939021342 2:136961537-136961559 ATCGTAAACCTGTGAGGAGATGG + Intronic
940415981 2:153420739-153420761 TTCTGAGGCCTGTGAGGACATGG - Intergenic
941000740 2:160201209-160201231 ATGTGAAACCTGTAAACAGAGGG + Intronic
941441538 2:165543773-165543795 AGCTAAATCCTTTGAGGAGATGG - Intronic
945583153 2:211622877-211622899 AGCTGGAACCTGGGAGGAGGAGG + Intronic
946068000 2:217006498-217006520 ACCTGCTACCTGTGTGGAGATGG + Intergenic
946629013 2:221646117-221646139 ATCTGACACCTTTGTGGAAAAGG - Intergenic
947124678 2:226855022-226855044 ATATGTAACCTCTGAGGAGTTGG - Intronic
947712113 2:232322177-232322199 CTCTGAACCCTCTGAGGAGGAGG - Intronic
948186576 2:236026138-236026160 ATCTGGGACCTGTCAGGACATGG - Intronic
1168778975 20:472760-472782 ATCTGAAGCCTGAGAGCAAAGGG - Intergenic
1169254041 20:4083711-4083733 ATCTGAAAGCAGAGAGAAGAAGG - Intergenic
1169648913 20:7845249-7845271 ATCTGAGATGTGAGAGGAGAGGG - Intergenic
1169886698 20:10407020-10407042 ATCTGAGAGCTGTCAGGAAATGG + Intronic
1170761283 20:19253646-19253668 ATGGGAAACCTGTGAGGATGGGG - Intronic
1172433629 20:34913242-34913264 ATCTGAGACTTATGGGGAGAGGG + Intronic
1172853604 20:37984205-37984227 ATCTGATCCCTGTGGGGAAACGG - Intronic
1173565709 20:44036915-44036937 TTCTGAAATCTGAGAGGAGAGGG - Intronic
1174664518 20:52245453-52245475 ACCTGATGCCTGTGAGGAGGTGG + Intergenic
1174769300 20:53283475-53283497 AGCTGAAAGCTGTGTGGTGATGG - Intronic
1174898022 20:54471255-54471277 AGCTGAAAGCTGTTAGGAGTAGG + Intergenic
1178799484 21:35779151-35779173 CTCTGTCACCTGAGAGGAGAAGG + Intronic
1179125680 21:38588614-38588636 ATCTGAAAACTGTGAGTAAGAGG + Intronic
1180743905 22:18073839-18073861 ATGTGGAACCAGTGTGGAGAAGG + Intergenic
1182119623 22:27778468-27778490 ATCGGGAACCTGTGAGGGGAGGG - Intronic
1184179963 22:42814484-42814506 GTTTGAAACCTGGGAGCAGATGG - Intronic
1184328643 22:43811707-43811729 ACTTGAAACCTGTGGGGTGAAGG - Intronic
1184811966 22:46841861-46841883 AACTGTAACATGTGAGGTGAAGG + Intronic
1184944781 22:47795510-47795532 ATGTGAAGCCCGTGAGGACACGG + Intergenic
950620662 3:14202839-14202861 ACCTGAAATGGGTGAGGAGATGG + Intergenic
954782417 3:53071472-53071494 TGCTGAAACCTGTGAGGATCAGG - Intronic
954938114 3:54345537-54345559 ATCAGAGACCTGTGGTGAGAGGG + Intronic
955135069 3:56209151-56209173 ATCTGAAACTAGTGAGAAAAAGG - Intronic
956424429 3:69118687-69118709 ATCTTAAACCTGTAAGTAGAAGG - Exonic
956471044 3:69567105-69567127 ATATGCATCCTGTGAGGAGATGG - Intergenic
960510674 3:118545245-118545267 ATGTGAAGCCTGGGAAGAGAAGG - Intergenic
962895110 3:139707001-139707023 TTCTGATATCTGTGAGGGGAAGG + Intergenic
962895117 3:139707059-139707081 TTCTGACATCTGTGAGGGGAAGG + Intergenic
964974586 3:162603721-162603743 ATCTTGAACCTGGGAGGTGAAGG - Intergenic
967104491 3:186244486-186244508 CTCTGGAACCTGGGAGGTGAAGG - Intronic
968075295 3:195812828-195812850 GACTGTAACCTGTGAGGAGGTGG + Intergenic
969575916 4:8035623-8035645 ATAAGAAACCTCTGAGGAGTAGG + Intronic
972876787 4:43372180-43372202 ATCTGAAACGAGAGACGAGAGGG + Intergenic
973324985 4:48851015-48851037 AGCTGAAATCTGTTAAGAGATGG - Intronic
973607407 4:52601140-52601162 ATCTAAAACCTATGAGGGCAGGG + Intronic
973683983 4:53350791-53350813 ATCTTGAACCTGGGAGGAGGAGG - Intronic
975465218 4:74701409-74701431 ATCTGAAACAAGTGTGGAGAAGG - Intergenic
976864364 4:89706363-89706385 ATCTGAAACATATGAGCTGAAGG - Intergenic
977441186 4:97070252-97070274 ATCTGAAAGTTGAGAGGAGTTGG + Intergenic
978621683 4:110639475-110639497 CTCTGAAACCTGAAAGGGGAGGG - Intronic
980844305 4:138305636-138305658 TTCTGAAGGCTGTGAGGGGAGGG + Intergenic
983044229 4:162967062-162967084 ATTTGAAACCAGTGAGAACAAGG - Intergenic
983557739 4:169073458-169073480 AAATCAAACCTATGAGGAGATGG - Intergenic
983858960 4:172680453-172680475 ATCTGAAAGCTGTGATGAAGGGG + Intronic
984996138 4:185432111-185432133 ATCTGAATCAAGTGAGGAGACGG + Exonic
985380415 4:189388964-189388986 ACCTGCCACATGTGAGGAGAAGG + Intergenic
987585725 5:19853660-19853682 GTCTGAAACCTGTGTGCAGTTGG + Intronic
989126821 5:38062292-38062314 ATCTCAAACCTATGGTGAGAAGG - Intergenic
989153724 5:38324585-38324607 CTCTAAAACCTGTGTGGAGAAGG - Intronic
991258043 5:64637209-64637231 ACATAAATCCTGTGAGGAGATGG + Intergenic
991932264 5:71765521-71765543 ATGAGAAACCGGTGAGGAGCAGG + Intergenic
992930370 5:81637240-81637262 ATCTTAGACCTCTAAGGAGAGGG - Intronic
994414369 5:99449411-99449433 AGCTGAAACCTGGGAGGCGGAGG + Intergenic
995591988 5:113708903-113708925 ATCTGACATCTGTGAAAAGAGGG + Intergenic
997855000 5:137365154-137365176 AACTGCAGCCTGGGAGGAGAGGG - Intronic
999129519 5:149272046-149272068 ATCTGAAGCCGGAGAGGAGGAGG + Intronic
1000692638 5:164342245-164342267 TACTGGAACCTGGGAGGAGAAGG - Intergenic
1000863676 5:166486757-166486779 ATTTTAAACATGGGAGGAGAAGG - Intergenic
1001343257 5:170866362-170866384 ATCTGAAACTACTGAGAAGAAGG + Intronic
1004294461 6:14397576-14397598 GTTTGAGTCCTGTGAGGAGAAGG - Intergenic
1004872384 6:19920023-19920045 ATTTGATACCTGTGAGGTCAAGG + Intergenic
1004992599 6:21155413-21155435 ATCAGAAACATGGAAGGAGAAGG + Intronic
1006324478 6:33343189-33343211 AACTTAAACCTGTGAGGTGAAGG - Intergenic
1006593825 6:35178186-35178208 AGCTGAGAACTATGAGGAGAGGG + Intergenic
1008371986 6:50743198-50743220 ATGTGAAATATGTGTGGAGAGGG + Intronic
1009197015 6:60698835-60698857 ATCTGAAAAATGTGATTAGAGGG + Intergenic
1011945729 6:92900282-92900304 ATCTGTAGTCTGTCAGGAGAAGG - Intergenic
1012283891 6:97365007-97365029 ATCTGAACTCTGTGAGAAAAAGG - Intergenic
1012963056 6:105643407-105643429 ATCTGAAAGCTGTGAGATTAAGG + Intergenic
1013048212 6:106508622-106508644 TTCTGAAACATGTAAGGATATGG - Intergenic
1014461261 6:121698521-121698543 TTCTGGGACCTGTGGGGAGAGGG + Intergenic
1014580143 6:123126982-123127004 ATTGTAAACCTGTGAGGAAAAGG - Intergenic
1015511148 6:134039242-134039264 ATCTGAAATCTGTGATGTGGAGG - Intronic
1017267350 6:152463427-152463449 AATTGAAACCTGTGATGAGATGG - Exonic
1017781667 6:157720309-157720331 ATCTGAAACCCCTTAGGAAAGGG - Intronic
1019016389 6:168883482-168883504 ATTTCAAACTTGTTAGGAGACGG + Intergenic
1021400036 7:20199233-20199255 ACAAGAAATCTGTGAGGAGAAGG + Intronic
1022264343 7:28739372-28739394 ATCTGAAAGGTGAGAGGGGAGGG + Intronic
1023028025 7:36069355-36069377 AGCTCAAACCTGGGAGGTGAAGG + Intergenic
1024425410 7:49219940-49219962 ATCTGAAACCTTGGAGGGCATGG - Intergenic
1024626274 7:51210616-51210638 AGCTCAACCCTGTGAGGACATGG + Intronic
1024654021 7:51434111-51434133 AACTGACCCCTGTGAGCAGAAGG + Intergenic
1025297952 7:57791142-57791164 CTCTCGAACCTGGGAGGAGAAGG + Intergenic
1027026133 7:74852873-74852895 CTCTGGAACCTGGGAGGCGAAGG + Intergenic
1027061623 7:75091246-75091268 CTCTGGAACCTGGGAGGCGAAGG - Intergenic
1029113492 7:98224872-98224894 GTCGGAAACCTGGGAGGAGTGGG + Exonic
1030788650 7:113695248-113695270 ATCTGAGAGTTGTGATGAGAAGG - Intergenic
1031083776 7:117282559-117282581 CTCTGCAACGTGTGAGGAGCAGG + Intronic
1032439088 7:131928215-131928237 GCCTGAAGCCTGTGAGGAAAAGG - Intergenic
1032441367 7:131945333-131945355 ACCTGAACTCTGTGAGGAAAGGG - Intergenic
1033158479 7:138976435-138976457 ATCCGAAACCTTGGAGGAGGGGG - Intronic
1033440254 7:141372070-141372092 AACTGGTACCAGTGAGGAGAAGG - Intronic
1034209611 7:149351663-149351685 AGCTCAAACCTGGGAGGCGAAGG + Intergenic
1036047489 8:5160223-5160245 CTCTTGAACCTGGGAGGAGAAGG - Intergenic
1037668677 8:20996160-20996182 CTCTGTAAACTGTAAGGAGATGG + Intergenic
1041038425 8:53820090-53820112 ATCTGAAAAATGTGTGTAGAAGG + Intronic
1046678390 8:117138486-117138508 AACTGGAAGCTGGGAGGAGAGGG - Intronic
1047598620 8:126404448-126404470 TTCTCAAACCTGGGAGGTGAAGG - Intergenic
1050483171 9:6106967-6106989 CACTGAAACCTTTGAGGACAGGG + Intergenic
1052860102 9:33432701-33432723 CTCTTAAACCTGGGAGGAGGAGG - Intergenic
1061774460 9:132951645-132951667 ATCTGAAACCTGTGAGGAGAGGG - Intronic
1061839731 9:133351544-133351566 ATCCTAAACCTGGGAGGCGAAGG - Intergenic
1188766116 X:34093654-34093676 ATTTCAAAACTGTGAGGAGAAGG + Intergenic
1189155934 X:38756863-38756885 CTCTGATATCAGTGAGGAGAAGG + Intergenic
1191150438 X:57215800-57215822 CTCTGAAACCTGTCAGGTGGTGG + Intergenic
1194011309 X:88566058-88566080 AACTGAAACCTGTTAGGTCAAGG - Intergenic
1194022645 X:88712022-88712044 CTCTGGAACCTGTGAGAGGAAGG + Intergenic
1197313944 X:124940766-124940788 CTCTGAAACATGAGAGGAGCAGG - Intronic
1197728770 X:129793515-129793537 AGCTGGAAGCAGTGAGGAGAGGG + Intronic
1198939296 X:141935154-141935176 AGCTGGAACCTGGGAGGCGAAGG + Intergenic
1199357361 X:146877048-146877070 GTCTGAATATTGTGAGGAGATGG - Intergenic